Abstract
Background
The prion protein (PrP) might be useful as a tool to collect cardiac progenitor cells derived from embryonic stem (ES) cells. It is also possible that PrP+ cells include undifferentiated cells with a capacity to develop into tumors.
Methods
PrP+ cells isolated from embryoid bodies (EB) formed by mouse AB1 ES cells were examined using RT–PCR analysis and clonogeneic cell assay. To assess their potential to differentiate into cardiomyocytes, Nkx2.5GFP/+ (hcgp7) cells, another ES cell line that carries the GFP reporter gene in the Nkx2.5 loci, were used.
Results
PrP+ cells isolated from EB of day 7 and 14 did not express pluripotency markers, but expressed cardiac cell markers, while PrP+ cells isolated from EB of day 21 expressed pluripotency markers. Cultured PrP+ cells isolated from EB of day 21 expressed pluripotency markers to form colonies, whereas those isolated from EB of day 7 and 14 did not. To exclude proliferating cells from PrP+ cells, stage specific embryo antigen 1 (SSEA1) was employed as a second marker. PrP+/SSEA1– cells did not proliferate and expressed cardiac cell markers, while PrP+/SSEA1+ did proliferate.
Conclusion
PrP+ cells isolated from EB included undifferentiated cells in day 21. PrP+/SSEA1– cells included cardiomyoctes, suggesting PrP and SSEA1 may be useful as markers to enrich the fraction of cardiomyocytes.
Keywords: cell differentiation, embryonic stem cells, prion protein, stage-specific embryonic antigens
Embryonic stem (ES) cells are characterized by their capacity for self-renewal and pluripotency. They spontaneously differentiate into cardiomyocytes through the formation of embryoid bodies (EB).1–4 ES cells-derived cardiomyocytes are a potential source for cell-transplantation therapy in patients with a damaged heart.5, 6 A prerequisite for transplantation of these cells is their purity, because undifferentiated ES cells are capable of producing tumors.7 A sophisticated method is necessary to isolate cardiac progenitors from among ES cells and achieve a fraction of high purity. The normal prion protein (PrP) belongs to the glycosylphosphatidyl-inositol-anchored protein family, and is expressed in adult tissues.8–11 The PrP is anchored to the outer surface of neurons, lymphocytes and other cells that express Nestin9, 12 and promotes the differentiation of ES cells into neuronal progenitor cells.9, 12, 13 The PrP was reported to be expressed in the intestine during embryonic development9, 14, 15 as well as in the heart and neurons.9, 14–16 The PrP was reported to form a complex with stress induced phosphoprotein 1 (STIP1) to regulate neuronal development.9, 17 The PrP is known to be involved in iron uptake9, 18 and Ca2+ homeostasis9, 19 and also to play a pivotal role in cellular responses against reactive oxygen species (ROS) to form superoxide dismutase (SOD) via binding to copper.9, 11 Thus, the PrP is essential to responses to the environment by cells of the three germ layers. An abnormal PrP causes neurodegenerative diseases such as Creutzfeldt-Jakob disease, fatal familial insomnia and Gerstmann-Sträussler-Scheinker syndrome.10, 11
Hidaka et al. reported that the PrP was a marker of cardiac progenitor cells in the early phase of EB formation.16 We also found that most of PrP+ cells differentiated into cardiomyocytes.20 Since the PrP is expressed in various tissues, it is possible that PrP+ cells from ES cells include cells different from cardiac progenitor cells. Recently, the PrP was reported to enhance the expression of the transcription factor Nanog suggesting that PrP+ cells can proliferate and form tumors after transplantation.7, 9, 21 This might indicate the harmfulness of PrP+ cells as a cell source for transplantation. However, it has never been tested whether PrP+ cells from EB include undifferentiated cells. In the present study, we attempted to characterize PrP+ cells derived from EB formed by mouse ES cells. We found that PrP+ cells from EB of days 21, but not those of day 7 and 14, expressed pluripotency markers and were capable of proliferation. Combining the PrP with stage specific embryo antigen 1 (SSEA1) as the second marker enabled us to enrich the fraction of cardiomyocytes that do not proliferate.
MATERIALS AND METHODS
Cell culture and differentiation
AB1 ES cells derived from 129SV/EV mice were kindly provided by Dr. Shimotsuke (Riken CDB, Kobe, Japan). They were cultured on SNL feeder cells treated with mitomycin C (Sigma-Aldrich, St Louis, MO). SNL cells were derived from STO mouse embryonic fibroblasts with a forced expression of leukemia inhibitory factor (LIF) and neomycin resistance genes. AB1 cells were grown and maintained in Dulbecco’s-modified Eagle’s medium (DMEM; Wako Pure Chemical, Osaka, Japan) supplemented with 20% heat-inactivated fetal bovine serum (FBS; Corning, Corning, NY), 1 × penicillin-streptomycin-L-glutamine solution (Wako Pure Chemical), 1 × MEM non-essential amino acid solution (Wako Pure Chemical), 0.1 mM 2-mercaptoethanol (Sigma-Aldrich) and 1,000 units/mL LIF (ESGRO; Merck KGaA, Darmstadt, Germany).
Dr. Morisaki (National Cerebral and Cardiovascular Center, Suita, Japan) provided ht7 ES cells. These cells carry the hygromycin resistance gene in one of the Oct4 loci.22 Derived from the ht7 cells, hcgp7 (Nkx2.5GFP/+) ES cells carry the GFP reporter gene in one of the Nkx2.5 loci.23 Both ht7 and hcgp7 cells were grown and maintained on gelatin-coated dishes in Glasgow minimum essential medium (GMEM; Wako Pure Chemical) supplemented with 10% heat-inactivated FBS (Corning), 1 × penicillin-streptomycin-L-glutamine solution (Wako Pure Chemical), 1 × MEM non-essential amino acid solution (Wako Pure Chemical), 0.1 mM 2-mercaptoethanol (Sigma-Aldrich), 1 mM sodium pyruvate (Wako Pure Chemical), and 1,000 units/mL LIF (Merck KGaA), without feeder cells. Differentiation of ES cells into cardiac progenitors was induced via formation of EB. Briefly, EB were generated by plating 20 µL of cell suspension (2.5–10 × 104 cells/mL) in DMEM (Wako Pure Chemical) supplemented with 10–20% heat-inactivated FBS (Corning), 1 × penicillin-streptomycin-L-glutamine solution (Wako Pule Chemical), 0.1 mM 2-mercaptoethanol (Sigma-Aldrich) (EB medium) on the lid of a dish, followed by incubation in hanging drops for 2 days. EB were transferred into the medium and cultured as floating EB or attached out-growth cells for indicated days until analysis.
Flow cytometry
Cells were dissociated from EB at day 7 ± 1, 14 ± 1 and 21 ± 1 by Collagenase type Ⅱ (Worthington, Lakewood, NJ) with gentle pipetting, followed by a treatment with Cell Dissociation Buffer (enzyme-free, Hanks’-based; Thermo Fisher Scientific, Waltham, MA) for 5–8 min. Cells were stained with phycoerythrin (PE) -conjugated anti-PrP (mouse monoclonal clone SAF83; Funakoshi, Tokyo, Japan) labeled with the PE Labeling Kit-NH2 (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Dead cells were excluded with Draq7 (Biostatus, Shepshed, England).
The percentage of cells positive for PrP or GFP was determined by flow cytometry (BD FACS Canto II; BD, Franklin Lakes, NJ). They were resuspended in Hank’s balanced salt solution (HBSS, Wako Pure Chemical) containing 2% FBS and Draq7, diluted 100 times, and subjected to cell sorting (Moflo XDP, Beckman Coulter, Brea, CA) with Summit software to collect either PrP+ or GFP+ cells.20
Clonogenic cell assay
PrP+ cells were isolated from EB at day 7, 14 and 21 by FACS. 1,000 or 10,000 cells were seeded on gelatin-coated dish and cultured in EB medium for 7 to 17 days. Colonies fixed with 100% ethyl alcohol were stained with Giemsa.
Reverse transcriptase-polymerase chain reaction
Total RNA was isolated from EB using an RNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. RNA samples were treated with DNaseI (Promega Corporation, Fitchburg, WI) to eliminate genomic DNA and cDNA was synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (Takara Bio, Kusatsu, Japan). PCR amplifications were performed using Emerald Amp Max polymerase (Takara Bio) with primers listed in Table 1.
Table 1.
Primer list in gene expression analysis
| Gene | Forward | Reverse | Annealing temperature | No. cycles |
| Zfp42 | TTCACGGAGAGCTCGAAACT | CCATCCCCTTCAATAGCTCA | 60 | 30 |
| Nanog | CACCCACCCATGCTAGTCTT | ACCCTCAAACTCCTGGTCCT | 60 | 28 |
| Oct4 | ATTCTCGAACCTGGCTAAGCT | ATGGTGGTCTGGCTGAACACCTTT | 60 | 28 |
| Pax6 | CAGAAGACTTTAACCAAGGGC | TGGGCTATTTTGCTTACAACTT | 60 | 30 |
| NeuroD1 | AAGCCATGAATGCAGAGGAGGACT | AGCTGCAGGCAGCCGGCGACC | 60 | 30 |
| Afp | ACATCAGTGTCTGCTGGCAC | AGCGAGTTTCCTTGGCAACAC | 60 | 30 |
| Sox17 | AAGAAACCCTAAACACAAACAGCG | TTTGTGGGAAGTGGGATCAAGAC | 60 | 30 |
| T | GTCTTCTGGTTCTCCGATGT | CCAGGTGCTATATATTGCCT | 60 | 30 |
| Mesp1 | CAGAATCGTGGGACCCAT | CGGCGTCCAGGTTTCTAG | 60 | 30 |
| Tbx5 | ATGGTCCGTAACTGGCAAG | TTTCGTCTGCTTTCACGATG | 60 | 30 |
| Nkx2.5 | ACCGTCGCTACAAGTGCAA | CCATAGGCATTGAGACCCA | 60 | 30 |
| Anp | TGGGCTTCTTCCTCGTCTT | TTCTACCGGCATCTTCTCCT | 60 | 30 |
| Myl7 | TGACCCAGGCAGACAAGTTC | CGTGGGTGATGATGTAGCAG | 60 | 30 |
| Myl2 | AAGGTGTTTGATCCCGAGGG | GGGAAAGGCTGCGAACATCT | 60 | 30 |
| Prnp | CTGAAGCATTCTGCCTTCCT | GCCGACATCAGTCCACATAG | 60 | 30 |
| Gapdh | TGAACGGGAAGCTCACTGG | TCCACCACCCTGTTGCTGTA | 60 | 25 |
Statistical analysis
Data are expressed as mean ± SD.
RESULTS
PrP+ cells differentiated into cardiac myocytes
Figure 1A shows representative flow cytometry data indicating the prevalence of PrP+ cells in EB of AB1 cells. And Fig. 1B shows the summary of the flow cytometry analysis. The PrP+ rate were 22.9, (s = 5.8. n = 3), 13.7, (s = 1.9. n = 3) and 18.3, (s = 12.7. n = 3) (%) in EB of day 7, 14 and 21, respectively. PrP+ cells were not detected in EB before day 4 of differentiation induction (data not shown). The prevalence of PrP+ cells expressing Nkx2.5/GFP was studied using mouse Nkx2.5GFP/+ ES cells. As shown in Fig. 1C, the prevalence of PrP+ cells expressing Nkx2.5/GFP on days 7, 14 and 21 was 1.3, 0.3 and 0.1%, respectively, indicating a decline in the number of cardiac progenitor cells among PrP+ cells.
Fig. 1.
A: Flow cytometry analysis of cell surface PrP in EB derived from AB1 ES cells. Ordinate indicates the prevalence of DRAQ7-posisitve cells as dead cells and abscissa indicated the prevalence of PrP+ cells. The cells within a gated area show the population of living PrP+ cells.
B: Summary of the flow cytometry analysis. The graph shows the mean and the standard deviation of the PrP+ rate in Day 7, 14 and 21 after a differentiation induction (n = 3).
C: Prevalence of Nkx2.5/GFP-positive cell in PrP+ cells isolated from EB of hcgp7 at Day 7, 14 and 21. The ordinate showed the prevalence of PrP+ cells and the abscissa indicated the expression level of Nkx2.5/GFP-positive cells. The upper panel showed the flow cytometry analysis of ht7 cells, as negative control and the lower panel showed the flow cytometry analysis on hcgp7 cells.
EB, embryoid body; ES cells, embryonic stem cells; GFP, green fluorescent protein; PE, phycoerythrin; PrP+, prion protein positive.
Heterogeneity of PrP+ cells isolated from EB at various periods post differentiation induction
To verify whether PrP+ cells contained undifferentiated cells, mRNAs levels of pluripotency markers were examined in PrP+ cells isolated from EB. Figure 2 shows mRNA levels of pluripotency markers (Zfp42, Nanog and Oct4), ectoderm cell markers (Pax6, NeuroD1), endoderm cell markers (Afp, Sox17), mesoderm cell markers (T, Mesp1) and cardiac cell markers (Tbx5, Nkx2.5, Anp, Myl7 and Myl2) expressed in PrP+ cells isolated from EB of days 7, 14 and 21. PrP+ cells from EB of day 7 predominantly expressed mRNAs of cardiac cell markers. PrP+ cells from EB of day 14 expressed mRNAs of ectodermal and endodermal cell markers besides mesodermal cell and cardiac cell markers. Surprisingly, PrP+ cells from EB of day 21 expressed mRNAs of pluripotency markers as well as those of cells of the three germ layers.
Fig. 2.

mRNA level of pluripotent, ectodermal, endodermal, mesodermal and cardiac cell markers in PrP+ cells from EB at day 7, 14 and 21. Cells were isolated by FACS, and then mRNA was extracted from them. Each set corresponds to the transcript amplified using the indicated primers. (+) : PrP+ cell fraction, (–) : PrP– cell fraction. PCR of Gapdh from RNA sample without reverse transcriptase [Gapdh RT (–) ] did not show any fragment, indicating no contamination of cDNA by genomic DNA.
EB, embryoid body; FACS, fluorescence activated cell sorting; mRNA, messenger RNA; PrP−, prion protein negative; PrP+, prion protein positive; RT, reverse transcription.
PrP+ cells from EB included undifferentiated cells capable of proliferation
Expression of pluripotency markers suggested the prevalence of undifferentiated cells among PrP+ cells from EB of day 21. Since undifferentiated cells proliferate in a short-term culture, we examined the expression of pluripotency markers in PrP+ cells cultured for 7 days after isolation from EB. As shown in Fig. 3A, PrP+ cells from EB of day 7 expressed mesodermal, cardiac cell markers. But, they also expressed pluripotent, ectodermal and endodermal cell markers, slightly. PrP+ cells from EB of day 14 did not express pluripotency markers, ectodermal or endodermal cell markers after a 7-day culture, but they expressed cardiac cell markers in Fig. 3B. PrP+ cells from EB of day 21 expressed pluripotency markers after a 7-day culture without changes in mRNA levels of mesodermal, cardiac, ectodermal and endodermal cell markers in Fig. 3C. Next, we examined the capability of PrP+ cells from EB to proliferate by means of clonogenic cell assay. As shown in Fig. 4, PrP+ cells isolated from EB of day 21 formed colonies, while cultured PrP+ cells from EB of day 7 and 14 did not. These results indicated that PrP+ cells from EB of day 21 contained undifferentiated cells.
Fig. 3.
Changes in mRNA level of pluripotent stem, ectodermal, endodermal, mesodermal and cardiac cell markers expressed in cultured PrP+ cells from EB at various period.
A: PrP+ cells were sorted from EB at day 7 after differentiation by FACS and were cultured for another 7 days, and then mRNA was extracted from them. Each band corresponds to the transcript amplified using the indicated primers.
B: PrP+ cells were sorted from EB at day 14 by FACS and were subsequently cultured for another 7 days, and then their mRNA was extracted.
C: PrP+ cells were sorted from EB at day 21 by FACS and were subsequently cultured for another 7 days, and then their mRNA was extracted. AB1 d0: undifferentiated AB1 cells, (+) : PrP+ cell fraction, (–) : PrP− cell fraction. PCR of Gapdh from RNA sample without reverse transcriptase [Gapdh RT (–) ] did not show any fragment, indicating no contamination of cDNA by genomic DNA.
d, day; EB, embryoid body; FACS, fluorescence activated cell sorting; mRNA, messenger RNA; PrP−, prion protein negative; PrP+, prion protein positive; RT, reverse transcription.
Fig. 4.
Proliferation of cultured PrP+ cells derived from EB at day 7, 14 and 21.
PrP+ cells were sorted from EB at day 7, 14 and 21 by FACS, and were subsequently cultured for 7 days. Each cell was stained by Giemsa’s solution. The upper panels: colony formation of PrP− cells derived from EB at the various periods. The lower panels: colony derived of PrP+ cells derived from EB at the various periods.
EB, embryoid body; FACS, florescence activated cell sorting; PrP−, prion protein negative; PrP+, prion protein positive.
Use of PrP and SSEA1 as selection markers to enrich the fraction of differentiated cardiomyocytes
Stage specific embryo antigen 1 (SSEA1) is a surface marker of pluripotent stem cells.24 Figure 5A shows expression of SSEA1 in PrP+ cells isolated from EB of days 7, 14 and 21. The prevalence of PrP+/SSEA1+ cells was 0.3%, 0.1% and 0.3%, respectively. Figure 5B shows colony formation by PrP+ /SSEA1– cells and PrP+ /SSEA1+ cells from EB of day 21 cultured for 10 and 17 days, respectively. Cultured PrP+ /SSEA1– cells did not form any colony, but cultured PrP+ /SSEA1+ cells did, indicating SSEA1 is a useful marker to exclude proliferating cells from among PrP+ cells. Figure 5C shows cardiac cell markers (Tbx5 and Myl2) expressed in PrP+ /SSEA1– cells isolated from EB of day 21. The level of mRNA corresponding to cardiac cell markers was comparable between PrP+ cells and PrP+ /SSEA1– cells.
Fig. 5.
Characterization of PrP+/ SSEA1– cells isolated from EB at various periods.
A: Prevalence of PrP+/ SSEA1+ cells derived from EB at the various periods. PrP+ cells were sorted from EB at Day 7, 14 and 21 by FACS. The ordinate showed the prevalence of PrP+ cells and the abscissa indicated the prevalence of SSEA1+ cells. The upper control board showed the flow cytometry analysis as negative control and the lower control board showed the flow cytometry analysis of PrP+/ SSEA1+ cells.
B: Colongenic cell assay of cultured PrP+/ SSEA1– cells from EB at day 21. Either PrP+/ SSEA1+ or PrP+/ SSEA1– cells of 10,000 cells were isolated from EB at day 21 by FACS and were subsequently cultured for another 10 and 17 days. Upper panels: colonies of cultured PrP+/ SSEA1+ or PrP+/ SSEA1– cells from EB at day 21 for another 10 days stained with Giemsa’s dye. Lower panels: colonies of cultured PrP+/ SSEA1+ or PrP+/ SSEA1– cells from EB at day 21 for another 17 days stained with Giemsa’s dye.
C: Enrichment of cardiac myocytes in PrP+/ SSEA1– cells from EB at day 21. PrP− cells, PrP+ cells and PrP+/ SSEA1– cells were sorted from EB at day 21 by FACS and were subjected to RT−PCR using indicating primers. PCR of Gapdh from RNA sample without reverse transcriptase [Gapdh RT (−) ] did not show any fragment, indicating no contamination of cDNA by genomic DNA.
EB, embryoid body; FACS, fluorescence activated cell sorting; mRNA, messenger RNA; PE, phycoerythrin; PrP−, prion protein negative; PrP+, prion protein positive; RT, reverse transcription, SSEA1–, SSEA1 negative; SSEA1+, SSEA1 positive.
DISCUSSION
In the present study, we found that PrP+ cells isolated from EB of day 7 and 14 did not express pluripotency markers but expressed cardiac cell markers, and that PrP+ cells isolated from EB of day 21 expressed pluripotency markers as well as those of the three germ layers; that PrP+ cells isolated from EB of day 21 formed colonies and expressed pluripotency markers, whereas those from EB of day 7 and 14 did not form colonies; and that PrP+/SSEA1– cells expressed cardiac cell markers and did not proliferate, while PrP+/SSEA1+ did proliferate.
Pluripotent stem cells such as ES or induced pluripostent stem cells are a potential cellular source for cell transplantation therapy of damaged hearts.16, 20, 25 However, pluripotent stem cells-derived cells include undifferentiated cells. Several groups tried to purify cardiomyocytes among differentiated ES cells by marker gene transduction or fluorescence-based purification methods. Yet, for clinical use, fast, effective and scalable purification methods with no genetic modification are essential. A few surface markers that can be used for isolation of cardiomyocytes have been reported.16, 23 Flk1 is a marker of cardiovascular progenitors: common progenitors for cardiac, smooth muscle and endothelial cells.5 c-Kit is reported to be a cardiovascular stem cell marker of adult and embryonic heart.26, 27 Pdgfra is widely expressed in the mesoderm, including the cardiac lineage.26 Vascular cell adhesion molecule-1 (VCAM-1) has been reported as useful to isolate embryonic cardiomyocytes with 98% purity. VCAM-1 positive cells have been reported to specify committed cardiomyocytes,28 and have been confirmed in human ES cells.29 Recently, Hidaka et al. reported the PrP served to predominantly enrich the fraction of cardiomyocytes expressing cTnI, and cultured PrP+ cells from EB have been reported to differentiate into atrial and ventricular myocytes.16 Hidaka et al. also demonstrated that PrP+ cells from EB could proliferate, because PrP+ cells included cardiac progenitors.16 Nevertheless, in the present study, PrP+ cells from EB of days 21 expressed pluripotency markers and PrP+ cells from EB of day 21 proliferated in vitro. In contrast, PrP+ cells from EB of day 14 did not express pluripotency markers and did not proliferate. The mechanism of re-expression of pluripotency markers in PrP+ cells from EB of day 21 remains unclear. The PrP has been reported to activate Nanog expression through Integrin signaling.9, 25 PrP is known to influence the fate of cells and cell cycle besides their pluripotency, suggesting that prolonged expression of PrP in cultured cells may reactivate pluripotency9, 30 markers leading thereby to cell proliferation. Further experiments are necessary to examine this possibility.
Since individual markers are commonly expressed by cells of multiple lineage, a single marker may not be sufficient to distinguish cells of the cardiac lineage. Combination of two surface markers has been reported to be useful for isolation of cells of the cardiac lineage. Hidaka et al. used PDGFRa and PrP as markers to improve the purity of the cardiomyocyte fraction.16 The present data indicated that PrP+ cells from EB of days 21 included undifferentiated cells. Thus, for clinical use, it is necessary to exclude undifferentiated cells. SSEA1 is expressed in mouse pluripotent stem cells and is their authentic marker. In the present study, PrP+ /SSEA1– cells isolated from EB of day 21 included cardiomyocytes but not undifferentiated cells. Taken together, use of the PrP with SSEA1 might enable us to enrich the fraction of differentiated cardiomyocytes.
Clinical implication of the present study might be obvious. The transplantation of both c-Kit+ cells isolated from the right atrial appendage31 and cardiac progenitor cells from endomyocardial biopsies obtained from the right ventricular septum32 had been reported to improve the cardiac function in patients with ischemic heart disease, whereas other stem-cell based therapies including human bone marrow stem cells or mesenchymal stem cells failed to do so.33 This indicated the importance of enriching cardiac progenitor cells to exert positive effects in the clinical setting. The present provided a novel method to collect the cardiac progenitor cells from pluripotent stem cells and to exclude the undifferentiated cells, ensuring the feasibility as well as safety on the implantation of the cardiac progenitor cells from pluripotent stem cells.
Acknowledgments
Ackonwlegments: I would like to thank Prof. Takayuki Morisaki and Prof. Kyoko Hidaka for their useful suggestion. I also would like to thanks Ms. Yumi Miyauchi and Ms. Yoshimi Kobayashi for their excellent technical support.
The authors declare no conflict of interest.
REFERENCES
- 1. Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature. 1981;292:154-6. [DOI] [PubMed] [Google Scholar]
- 2. Martin GR. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A. 1981;78:7634-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Hescheler J, Fleischmann BK, Lentini S, Maltsev VA, Rohwedel J, Wobus AM, et al. Embryonic stem cells: a model to study structural and functional properties in cardiomyogenesis. Cardiovasc Res. 1997;36:149-62. [DOI] [PubMed] [Google Scholar]
- 4. Wobus AM, Guan K, Yang HT, Boheler KR. Embryonic stem cells as a model to study cardiac, skeletal muscle, and vascular smooth muscle cell differentiation. Methods Mol Biol. 2002;185:127-56. [DOI] [PubMed] [Google Scholar]
- 5. Yamashita JK, Takano M, Hiraoka-Kanie M, Shimazu C, Peishi Y, Yanagi K, et al. Prospective identification of cardiac progenitors by a novel single cell-based cardiomyocyte induction. FASEB J. 2005;19:1534-6. [DOI] [PubMed] [Google Scholar]
- 6. Baba S, Heike T, Yoshimoto M, Umeda K, Doi H, Iwasa T, et al. Flk1(+) cardiac stem/progenitor cells derived from embryonic stem cells improve cardiac function in a dilated cardiomyopathy mouse model. Cardiovasc Res. 2007;76:119-31. [DOI] [PubMed] [Google Scholar]
- 7. Nussbaum J, Minami E, Laflamme MA, Virag JA, Ware CB, Masino A, et al. Transplantation of undifferentiated murine embryonic stem cells in the heart: teratoma formation and immune response. FASEB J. 2007;21:134-57. [DOI] [PubMed] [Google Scholar]
- 8. Liang J, Kong Q. α-Cleavage of cellular prion protein. Prion. 2012;6:453-60. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Miranda A, Ramos-Ibeas P, Pericuesta E, Ramirez MA, Gutierrez-Adan A. The role of prion protein in stem cell regulation. Reproduction. 2013;146:R91-9. [DOI] [PubMed] [Google Scholar]
- 10. Watts JC, Westaway D. The prion protein family: diversity, rivalry, and dysfunction. Biochim Biophys Acta. 2007;1772:654-72. [DOI] [PubMed] [Google Scholar]
- 11. Yusa S, Oliveira-Martins JB, Sugita-Konishi Y, Kikuchi Y. Cellular prion protein: from physiology to pathology. Viruses. 2012;4:3109-31. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Peralta OA, Huckle WR, Eyestone WH. Expression and knockdown of cellular prion protein (PrPC) in differentiating mouse embryonic stem cells. Differentiation. 2011;81:68-77. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Steele AD, Emsley JG, Ozdinler PH, Lindquist S, Macklis JD. Prion protein (PrPc) positively regulates neural precursor proliferation during developmental and adult mammalian neurogenesis. Proc Natl Acad Sci U S A. 2006;103:3416-21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Manson J, West JD, Thomson V, McBride P, Kaufman MH, Hope J. The prion protein gene: a role in mouse embryogenesis?. Development. 1992;115:117-22. [DOI] [PubMed] [Google Scholar]
- 15. Tanji K, Saeki K, Matsumoto Y, Takeda M, Hirasawa K, Doi K, et al. Analysis of PrPc mRNA by in situ hybridization in brain, placenta, uterus and testis of rats. Intervirology. 1995;38:309-15. [DOI] [PubMed] [Google Scholar]
- 16. Hidaka K, Shirai M, Lee JK, Wakayama T, Kodama I, Schneider MD, et al. The cellular prion protein identifies bipotential cardiomyogenic progenitors. Circ Res. 2010;106:111-9. [DOI] [PubMed] [Google Scholar]
- 17. Santos TG, Silva IR, Costa-Silva B, Lepique AP, Martins VR, Lopes MH. Enhanced neural progenitor/stem cells self-renewal via the interaction of stress-inducible protein 1 with the prion protein. Stem Cells. 2011;29:1126-36. [DOI] [PubMed] [Google Scholar]
- 18. Singh A, Kong Q, Luo X, Petersen RB, Meyerson H, Singh N. Prion protein (PrP) knock-out mice show altered iron metabolism: a functional role for PrP in iron uptake and transport. PLoS One. 2009;4:e6115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Lazzari C, Peggion C, Stella R, Massimino ML, Lim D, Bertoli A, et al. Cellular prion protein is implicated in the regulation of local Ca2+ movements in cerebellar granule neurons. J Neurochem. 2011;116:881-90. [DOI] [PubMed] [Google Scholar]
- 20. Fujii H, Ikeuchi Y, Kurata Y, Ikeda N, Bahrudin U, Li P, et al. Electrophysiological properties of prion-positive cardiac progenitors derived from murine embryonic stem cells. Circ J. 2012;76:2875-83. [DOI] [PubMed] [Google Scholar]
- 21. Miranda A, Pericuesta E, Ramírez M, Gutiérrez-Adán A. Prion protein in ESC regulation. Prion. 2011;5:169-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet. 2000;24:372-6. [DOI] [PubMed] [Google Scholar]
- 23. Hidaka K, Lee JK, Kim HS, Ihm CH, Iio A, Ogawa M, et al. Chamber-specific differentiation of Nkx2.5-positive cardiac precursor cells from murine embryonic stem cells. FASEB J. 2003;17:740-2. [DOI] [PubMed] [Google Scholar]
- 24. Solter D, Knowles BB. Monoclonal antibody defining a stage-specific mouse embryonic antigen (SSEA-1). Proc Natl Acad Sci U S A. 1978;75:5565-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Miranda A, Pericuesta E, Ramírez M, Gutierrez-Adan A. Prion protein expression regulates embryonic stem cell pluripotency and differentiation. PLoS One. 2011;6:e18422. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Kataoka H, Takakura N, Nishikawa S, Tsuchida K, Kodama H, Kunisada T, et al. Expressions of PDGF receptor alpha, c-Kit and Flk1 genes clustering in mouse chromosome 5 define distinct subsets of nascent mesodermal cells. Dev Growth Differ. 1997;39:729-40. [DOI] [PubMed] [Google Scholar]
- 27. Dey D, Han L, Bauer M, Sanada F, Oikonomopoulos A, Hosoda T, et al. Dissecting the molecular relationship among various cardiogenic progenitor cells. Circ Res. 2013;112:1253-62. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Pontén A, Walsh S, Malan D, Xian X, Schéele S, Tarnawski L, et al. FACS-based isolation, propagation and characterization of mouse embryonic cardiomyocytes based on VCAM-1 surface marker expression. PLoS One. 2013;8:e82403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Uosaki H, Fukushima H, Takeuchi A, Matsuoka S, Nakatsuji N, Yamanaka S, et al. Efficient and scalable purification of cardiomyocytes from human embryonic and induced pluripotent stem cells by VCAM1 surface expression. PLoS One. 2011;6:e23657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Lee YJ, Baskakov IV. The cellular form of the prion protein is involved in controlling cell cycle dynamics, self-renewal, and the fate of human embryonic stem cell differentiation. J Neurochem. 2013;124:310-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Bolli R, Chugh AR, D’Amario D, Loughran JH, Stoddard MF, Ikram S, et al. Cardiac stem cells in patients with ischaemic cardiomyopathy (SCIPIO): initial results of a randomised phase 1 trial. Lancet. 2011;378:1847-57. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 32. Bartunek J, Behfar A, Dolatabadi D, Vanderheyden M, Ostojic M, Dens J, et al. Cardiopoietic stem cell therapy in heart failure: the C-CURE (Cardiopoietic stem Cell therapy in heart failURE) multicenter randomized trial with lineage-specified biologics. Journal of the American College of Cardiology. 2013;61:2329-38. [DOI] [PubMed] [Google Scholar]
- 33. Behfar A, Terzic A, Perez-Terzic CM. Regenerative principles enrich cardiac rehabilitation practice. Am J Phys Med Rehabil. 2014. November;93(11 Suppl 3):S169-75. [DOI] [PMC free article] [PubMed] [Google Scholar]




