Skip to main content
Clinical and Translational Science logoLink to Clinical and Translational Science
. 2008 May 21;1(1):45–49. doi: 10.1111/j.1752-8062.2008.00015.x

Nexus Between Epidermolysis Bullosa and Transcriptional Regulation by Thyroid Hormone in Epidermal Keratinocytes

Marjana Tomic‐Canic 1,2,3, Olivera Stojadinovic 1,2, Brian Lee 1, Rebecca Walsh 1, Miroslav Blumenberg 1
PMCID: PMC4973621  NIHMSID: NIHMS164221  PMID: 20443817

Abstract

Thyroid hormone, T3, through the interaction of its receptor with the recognition sequences in the DNA, regulates gene expression. This regulation includes the promoter activity of keratin genes. The receptor shares coregulators with other members of the nuclear receptor family, including RXR. Intending to define the transcriptional effects of thyroid hormones in keratinocytes, we used Affymetrix microarrays to comprehensively compare the genes expressed in T3‐treated and untreated human epidermal keratinocytes. The transcriptomes were compared at 1, 4, 24, 48, and 72 hours. Surprisingly, T3 induced only 9 and suppressed 28 genes, much fewer than expected. Significantly, genes associated with epidermolysis bullosa, a set of inherited blistering skin diseases, were found statistically highly overrepresented among the suppressed genes. These genes include Integrin β4, Plectin, Collagen XVII, MMP1, MMP3, and MMP14. The data imply that in keratinocytes T3 could suppresses the remodeling by, attachment to, and production of extracellular matrix. The results suggest that topical treatment with T3 may be effective for alleviation of symptoms in patients with epidermolysis bullosa.

Keywords: blistering, differentiation, extracellular matrix, microarrays, nuclear receptors, transcriptional profiling

Introduction

Thyroid hormone, T3, regulates gene expression through direct binding of its receptor, T3R, to the recognition elements, thyroid hormone responsive elements (TREs), in the DNA of affected genes. 1 T3R belongs to the nuclear receptors family, ligand‐dependent transcription factors that respond to extracellular signals by retinoids, steroid hormones, and other lipophilic compounds. Nuclear receptors interact with a large set of coregulators that enhance or suppress transcription, link to additional signaling pathways and unrelated transcription factors, and affect histone modification. 2 Prominent among the coregulators are RXRs, members of the nuclear receptor family that bind 9‐cis retinoic acid, which form heterodimers with several nuclear receptors, affecting their function and specificity and providing a nexus for T3, vitamin‐D, and retinoid signaling. 3 , 4 , 5

T3R can either induce or suppress gene expression, depending on the structure of the TREs and the constellation of the coregulators in a given cell. Depending on the cellular background, genes may be induced, suppressed, or not regulated by T3. Consequently, in certain cell types hundreds of genes are regulated by T3, while in others only a handful. 6 , 7

Epidermis depends on T3 for proper development. 8 Hypothyroidism as associated with dry scaly skin, and conversely, hyperthyroidism often results in shiny, smooth, and pink skin. 9 This suggests that T3 is necessary for proper epidermal differentiation. 10 T3R is universally expressed in skin and hair follicles and topical application of T3 stimulates epidermal expansion and hair growth and accelerates wound healing in mice. 11 , 12 , 13

We have shown previously that T3 suppresses the expression of many keratin genes in cultures of epidermal keratinocytes, including KRT5, KRT6, KRT10, KRT14, KRT16, and KRT17. 14 , 15 , 16 , 17 In contrast to the previously described mechanism of gene regulation by T3R, we demonstrated that unliganded T3R activated expression of those keratin genes, while the ligand‐bound T3R suppressed it. 17 , 18 , 19 Moreover, heterodimerization of T3R with the retinoid X receptor was not essential for this regulation. 19

Exceptionally, T3 uniquely and potently induces the promoter of keratin KRT15 gene. 20 This led us to suggest that topical treatment with T3 may be beneficial specifically for the treatment of epidermolysis bullosa simplex caused by mutations in the KRT14 gene. Gene replacement therapy for keratin K14 mutations is extremely difficult because of technical difficulties in treating the entire integument. However, the specific induction of KRT15 and suppression of mutant KRT14 expression may restore a functional keratin network in the basal epidermal layer of the patients and thus alleviate the skin blister formation. 21 The specificity is important, because agents that increase K15 and K14 simultaneously would not be as effective; T3 induces KRT15, but suppresses KRT14 production. 19 , 20

Topical treatment with T3 may be associated with side effects if many genes are affected by the hormone in the epidermis. To identify comprehensively the T3‐regulated genes in human epidermal keratinocytes we used Affymetrix oligonucleotide microarrays. We expected that the side effects of thyroid hormone treatment would be milder than that of interferon because skin symptoms in patients with hyperthyroidism are relatively mild. Indeed, we found that T3 in keratinocytes regulates an exceptionally small number of genes. Furthermore, the few regulated genes feature an unexpected, statistically significant nexus with the genes shown to be mutated in epidermolysis bullosa.

Results

Microarray analysis using Affymetrix DNA chips follows the transcript levels of approximately 22,000 genes. We find that somewhat more than half are expressed in keratinocytes at measurable levels and, depending on the treatment, several hundreds are regulated by hormones, growth factors, signal transduction pathway inhibitors, or UV. 22 , 23 , 24 , 25 , 26 , 27 It came as a great surprise, therefore, that the treatment with thyroid hormone regulated an extraordinarily small set of genes. For example, scatterplots that compare transcript levels show that only 3 genes are found to be regulated at a statistically significant level in the early time points, and 12 at the late time points (Figure 1A). In comparison, the treatment with RA regulates hundreds of genes (Figure 1A). The level of regulation by T3 barely exceeds the differences in pseudoduplicate experiments, for example, comparing the 24‐ and the 48‐hour time points (Figure 1B). When compared with the retinoic acid‐treated cells, the transcriptome of thyroid hormone‐treated cells is virtually indistinguishable from that of untreated, control cells (Figure 1C).

Figure 1.

Figure 1

T3 regulates a very small number of genes in keratinocytes. (A) Scatterplots comparing transcriptomes of T3‐treated and RA‐treated cells, shown for comparison, with untreated controls. The distance from the diagonal represents differentially expressed genes, induced in red, suppressed in green. The early comparisons include 1‐ and 4‐ hour time points, the late 24‐, 48‐, and 72‐hour ones. (B) Comparison of the T3‐treated samples at 24 and 48 hours. These are quasiduplicates, showing only one induced and one suppressed gene. (C) Hierarchical clustering of the transcriptomes, showing near‐identity of the control and T3‐treated samples, and the difference of the RA‐treated samples, shown as outliers.

Because inhibition of cornification is a well‐known effect of RA in keratinocytes, we specifically looked at the subset of epidermal differentiation markers represented in the DNA microarrays (Figure 2). We find that, whereas RA suppressed the expression of several epidermal differentiation genes, for example, periplakin, loricrin, SPRRs, and keratinocyte transglutaminase, the treatment with T3 affected none.

Figure 2.

Figure 2

Regulation of epidermal differentiation markers. While RA suppressed many of the known epidermal differentiation‐associated genes, shown in green, T3 was without effect.

Because of the unexpected results, that is, virtual absence of transcriptional regulation by T3, we repeated the transcriptional profiling, using a separately grown batch of keratinocytes, in a new medium and with freshly prepared T3 solution and a new researcher to perform the experiments. We obtained the same results (not shown).

The small set of genes consistently and reliably regulated by T3 is presented in its entirety in Figure 3. This set includes 9 induced genes and 28 suppressed ones. We confirmed the results of microarray analysis using real‐time polymerase chain reaction (RT‐PCR) (Figure 4). In virtually all instances, we find strict correlation between the microarray and RT‐PCR results.

Figure 3.

Figure 3

List of genes regulated by T3 in keratinocytes. Induction is shown in red, suppression in green. All 5 time points are shown, as well as the maximum and minimum fold change for induction and suppression, respectively. Note that the fold regulation is given on a log2 scale, that is, 1 = 2‐fold induction, –3 = 8‐fold suppression. The blue columns indicate relative level of expression, from low, light blue, to high, dark.

Figure 4.

Figure 4

RT‐PCR confirmation of the microarray results. In all instances the regulation seen in microarrays and in RT‐PCR are in the same direction, with the single exception of RPL37A at the 72‐hour time point.

The small number of induced genes is not conducive to statistical analyses. However, among the genes suppressed by T3, using L2L analysis 28 we find a statistically high number of metalloproteases overrepresented in the “molecular function” category, adhesion via peptidoglycans in the “biological processes” category, and extracellular matrix components in the “cellular components” category (Figure 5A). These categories are related to one another and the results suggest that the remodeling, attachment to, and production of extracellular matrix are reduced in keratinocytes treated with T3.

Figure 5.

Figure 5

Statistically overrepresented functional categories in the list of T3‐regulated genes. (A) Molecular function, biological process, and cellular component categories are shown. Count indicates the number of genes from the 37 regulated found in each category, enrichment is fold relative to the expected number of genes in that category in the regulated 37, over the total number of genes in that particular category on the microarray and p value shows the statistical unlikelihood of the enrichments. (B) Keyword epidermolysis bullosa is highly associated with the regulated genes, with the p value of 6.5 × 10−5. The three genes causing such significant association are listed.

Moreover, using the DAVID analysis suite, 29 we found that the most significantly overrepresented category comprises the epidermolysis bullosa‐associated genes (Figure 5B)! Epidermolysis bullosa is a disease characterized by spontaneous blistering of the skin, primarily caused by the defects in the attachment of the epidermis to the underlying dermis. 30 , 31 The T3‐regulated genes associated with epidermolysis bullosa include Integrin β4, Plectin, and Collagen XVII (a.k.a. BPAG2). Mutations in Integrin β4s cause epidermolysis bullosa associated with pyloric atresia, Plectin mutations cause epidermolysis bullosa simplex with muscular dystrophy, and Collagen XVIIA mutations can cause junctional epidermolysis bullosa or GABEB, generalized atrophic benign epidermolysis bullosa. 30 , 31 In addition, the MMPs are involved in the pathologies of blister formation in epidermolysis bullosa, including MMP1 32 , 33 and MMP3. 34 , 35 MMP14 has not yet been associated with this disease.

Discussion

Transcriptional profiling of epidermal keratinocytes treated with T3 shows that an extremely small number of genes are regulated by this hormone, suggesting very low potential for adverse effects of topical application of T3. Nevertheless, the regulated genes represent a highly selective set unexpectedly associated with epidermolysis bullosa. The results suggest that topical treatment with T3 may be highly effective and have very few side effects for patients with epidermolysis bullosa.

The transcriptional effects of T3 in several cell types has been analyzed using microarrays, and the extreme paucity of regulated genes in human epidermal keratinocytes, reported here, reflects the similar dearth in human fibroblasts, murine hepatocytes, and rat brain. 7 , 36 , 37 In contrast, a significant number, 26% of the genes under study, was found to be regulated by T3 in embryonic stem cells, directly or indirectly. 38 We speculate that the housekeeping and signal transduction genes regulated in other cell types are not regulated by T3 in keratinocytes because keratinocytes express a different and characteristic set of nuclear receptor coregulator proteins; in support of this hypothesis, we note the atypical mechanisms of regulation of keratin genes by nuclear receptors for retinoic acid, vitamin D3, and glucocorticoids. 19 , 39 , 40

Although the direct effects of T3 on gene transcription in epidermal keratinocytes are limited, its role in epidermis may be wider. Our cultured cells derive from neonatal foreskins; given this caveat, we believe that they represent epidermal cells from other body sites and more advanced ages. Topical treatment with thyroid hormone has been clinically shown to reverse skin atrophy induced by long‐term topical glucocorticoid use in humans by increasing epidermal and dermal thickness and thickness of elastic fibers. 41 Furthermore, T3 has been shown to promote wound healing in mice, whereas glucocorticoids have been shown to inhibit it. 11 , 27 Clinical trials showed T3 to be ineffective in the treatment of psoriatic plaques, which is consistent with our microarray data. 42 On a molecular level, T3 prevents glucocorticoid‐mediated inhibition of keratin gene expression because T3R and GR bind to the same response element. 18 Thus, the effects of T3 in epidermis may be indirect, reversing, or balancing the effects of other hormones and vitamins.

Microarray analyses of T3‐treated human dermal fibroblast yielded 91 upregulated and 5 downregulated genes within 24‐hour treatment. 36 Although the effects may not be comparable in different cell types, it is interesting that in fibroblasts T3 induced more genes than it suppressed (91 vs. 5), whereas in keratinocytes it predominantly suppressed gene expression (9 vs. 28), indicating differential regulation and cell‐type specificity. The cell‐type specificity of T3 action is vividly demonstrated by the analysis of the hairless gene (hr) promoter. 43 The hr expression is hair‐cycle coordinated and mutations in hr are associated with hair loss. 44 The hr is expressed in the skin, hair follicles, and brain. The TRE of the human hr gene confers T3 responsiveness in neuroblastoma cells but not in keratinocytes. 43 Therefore, while T3 has a significant role in the regulation of neuronal expression of hr, its expression in keratinocytes is T3 independent.

We note that microarray studies failed to identify keratin genes as targets of T3 signaling. 14 , 16 , 17 , 18 , 19 , 20 , 45 , 46 , 47 We believe the reason for this failure is that the keratin genes are expressed in keratinocytes at levels so high that they saturate the Affymetrix microarrays, preventing any quantification. We have observed this phenomenon before. 26 , 48 , 49 Therefore, caveats for the result presented in this work, and microarray analyses in general, include not only genes expressed at very low levels, below the reliable detection by the methodology, but also for the genes expressed at very high levels, above the saturation levels of the microarrays.

Materials and Methods

Human keratinocyte culture and treatment with thyroid hormone

Normal epidermal keratinocytes from human foreskin were obtained from Dr. M. Simon, Living Skin Bank, Burn Unit SUNY, Stony Brook, NY, USA. The cultures were initiated using 3T3 feeder layers as described 50 and then frozen in liquid N2 until used. Once thawed, the keratinocytes were grown without feeder cells in Keratinocyte Serum‐Free Medium (Gibco), supplemented with 0.025 mg/mL bovine pituitary extract, 0.2 ng/mL epidermal growth factor, 0.4 mM CaCl2, and 1% penicillin/streptomycin (growth media) at 37°C, in 5% CO2. The medium was replaced every 2 days. When the cells reached 30% confluency, they were trypsinized with 0.025% trypsin, which was neutralized with 0.5 mg/mL of trypsin inhibitor and plated in Keratinocyte Serum‐Free Medium (Invitrogen) supplemented with 0.05 mg/mL bovine pituitary extract, 2.5 ng/mL epidermal growth factor, 0.09 mM CalCl2, and 1% penicillin/streptomycin (KGM). We avoid using serum because it can promote partial keratinocyte differentiation. When the keratinocytes reach the desired confluency, they are switched to Phenol Red‐free Keratinocyte Serum Free‐Media (Invitrogen) supplemented only with 1% penicillin/streptomycin (KBM) 24 hours prior to commencing experiments. Keratinocytes were treated with 1 mM T3 (3,3′,5‐triiodo‐L‐thyronine sodium salt; Sigma) diluted in 0.1 N NaOH for 1, 4, 24, 48, and 72 hours. 19

Preparation of labeled cRNA

For microarray analyses, the cells were harvested 1, 4, 24, 48, and 72 hours after the treatments. At each time point we harvested the treated and a corresponding, matched, untreated control sample. We isolated total RNA from the cells using RNeasy kits (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. Approximately 5 to 8 μg of total RNA was reverse transcribed, amplified, and labeled as described. 22 , 25

GeneChip hybridization and array data analysis

Labeled probe, 15 μg, was hybridized to Hu133Av2 arrays (Affymetrix). Arrays were washed, stained with antibiotin streptavidin‐phycoerythrin‐labeled antibody, and scanned using the Agilent GeneArray Scanner system (Hewlett‐Packard, Palo Alto, CA, USA). We used Affymetrix Microsuite 5.0 for data extraction, as before. 24 , 26 To compare data from multiple arrays, the signal of each probe array was scaled to the same target intensity value of 500 arbitrary units. To improve reliability, we checked individually the absolute expression levels and p values at all five time points. We included in the analysis only those genes determined by the algorithm to be present in at least one sample, and with the signal value of at least 100 units on at least one microarray. Differential expressions of transcripts at each time point was determined two ways: by calculating the fold change, where genes were considered regulated if the expression levels differed more than two‐fold relative to untreated control, and by the standard Microsuite 5.0 discrimination evaluation. The hierarchical clustering was performed using TIGR MultiExperiment Viewer algorithms. 51 The data have been submitted to GEO database and can be seen with the accession number (pending).

The transcription factor‐binding sites in the regulated genes were identified using oPOSSUM program. 52 We first calibrated the parameters of the program using a set of identified NF‐κB‐regulated genes 25 to obtain the optimal statistical p values in the one‐tailed Fisher exact probability analysis. We then used the same parameters for the T3‐regulated genes. We developed an extensive gene annotation table describing the molecular function and biological category of the genes present on the chip based on the Gene Ontology Consortium data (MB and T. Banno, unpublished). In addition, we used L2L program to identify biological processes and cell components statistically overrepresented in our lists of differentially expressed genes. 28

RT‐PCR. PCR primers for individual genes selected after the microarray data analysis were designed to generate DNA fragments 100–200 bps in length using the Primer3 program. 53 The primer sequences were as follows:

APP forward: TCCATTCATCATGGTGTGGT,

reverse: GTTCTGCTGCATCTTGGACA;

RPL37A forward: GATCTGGCACTGTGGTTCCT,

reverse: TTCTGATGGCGGACTTTACC;

ASNS forward: CAGGAATACGTTGAACATCAGG,

reverse: AAATTTCTGGGCTGCATTTG;

KRT23 forward: CGGGAAGAATCAAAGTCGAG,

reverse: TCTTCCGTTGATGGTCTCCT;

PTRF forward: AAGAAGCTGGAGGTCAACGA,

reverse: CCGGCAGCTTCACTTCAT;

GAPDH forward: CGACCACTTTGTCAAGCTCA,

reverse: CCCTGTTGCTGTAGCCAAAT.

Total RNA (5 μg) from treated or untreated keratinocytes was reverse transcribed using ImPromII (Promega, Madison WI, USA) reaction kits, and amplified using GoTaq Green (Promega) in GeneAmp, PCR system 9700 thermocycler (PE Applied Biosystems, Foster City, CA, USA).

Acknowledgments

Our research is supported in part by DebRA‐UK Foundation with additional support from DebRA of America (M.B.) and National Institutes of Health grants AR45974 and NR08029 (M. T‐C.). We thank the NYU Genomics Facility for technical assistance with microarray analysis and Jerome Balbin for help with the RT‐PCR.

References

  • 1. Yen PM, Ando S, Feng X, Liu Y, Maruvada P, Xia X. Thyroid hormone action at the cellular, genomic and target gene levels. Mol Cell Endocrinol. 2006; 246: 121–127. [DOI] [PubMed] [Google Scholar]
  • 2. Moore JM, Guy RK. Coregulator interactions with the thyroid hormone receptor. Mol Cell Proteomics. 2005; 4: 475–482. [DOI] [PubMed] [Google Scholar]
  • 3. Bugge TH, Pohl J, Lonnoy O, Stunnenberg HG. RXR alpha, a promiscuous partner of retinoic acid and thyroid hormone receptors. Embo J. 1992; 11: 1409–1418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Levin AA, Sturzenbecker LJ, Kazmer S, Bosakowski T, Huselton C, Allenby G, Speck J, Kratzeisen C, Rosenberger M, Lovey A, Grippo JF. 9‐cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR alpha. Nature 1992; 355: 359–361. [DOI] [PubMed] [Google Scholar]
  • 5. Zechel C, Shen XQ, Chen JY, Chen ZP, Chambon P, Gronemeyer H. The dimerization interfaces formed between the DNA binding domains of RXR, RAR and TR determine the binding specificity and polarity of the full‐length receptors to direct repeats. Embo J. 1994; 13: 1425–1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Miller LD, McPhie P, Suzuki H, Kato Y, Liu ET, Cheng SY. Multi‐tissue gene‐expression analysis in a mouse model of thyroid hormone resistance. Genome Biol. 2004; 5: R31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Ventura‐Holman T, Mamoon A, Maher JF, Subauste JS. Thyroid hormone responsive genes in the murine hepatocyte cell line AML 12. Gene. 2007; 396: 332–337. [DOI] [PubMed] [Google Scholar]
  • 8. Holt PJ, Lazarus J, Marks R. The epidermis in thyroid disease. Br J Dermatol. 1976; 95: 513–518. [DOI] [PubMed] [Google Scholar]
  • 9. Hanley K, Devaskar UP, Hicks SJ, Jiang Y, Crumrine D, Elias PM, Williams ML, Feingold KR. Hypothyroidism delays fetal stratum corneum development in mice. Pediatr Res. 1997; 42: 610–614. [DOI] [PubMed] [Google Scholar]
  • 10. Isseroff RR, Chun KT, Rosenberg RM. Triiodothyronine alters the cornification of cultured human keratinocytes. Br J Dermatol. 1989; 120: 53–510. [DOI] [PubMed] [Google Scholar]
  • 11. Safer JD, Crawford TM, Holick MF. Topical thyroid hormone accelerates wound healing in mice. Endocrinology. 2005; 146: 4425–4430. [DOI] [PubMed] [Google Scholar]
  • 12. Ahsan MK, Urano Y, Kato S, Oura H, Arase S. Immunohistochemical localization of thyroid hormone nuclear receptors in human hair follicles and in vitro effect of L‐triiodothyronine on cultured cells of hair follicles and skin. J Med Invest. 1998; 44: 179–184. [PubMed] [Google Scholar]
  • 13. Safer JD, Fraser LM, Ray S, Holick MF. Topical triiodothyronine stimulates epidermal proliferation, dermal thickening, and hair growth in mice and rats. Thyroid. 2001; 11: 717–724. [DOI] [PubMed] [Google Scholar]
  • 14. Tomic M, Jiang C‐K, Epstein HS, Freedberg IM, Samuels HH, Blumenberg M. Nuclear receptors for retinoic acid and thyroid hormone regulate transcription of keratin genes. Cell Regul. 1990; 1: 965–973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Tomic‐Canic M, Freedberg IM, Blumenberg M. Codominant regulation of keratin gene expression by cell surface receptors and nuclear receptors. Exp Cell Res. 1996; 224: 96–102. [DOI] [PubMed] [Google Scholar]
  • 16. Tomie‐Canie M, Day D, Samuels HH, Freedberg IM, Blumenberg M. Novel regulation of keratin gene expression by thyroid hormone and retinoid receptors. J Biol Chem. 1996; 271: 1416–1423. [DOI] [PubMed] [Google Scholar]
  • 17. Radoja N, Diaz DV, Minars TJ, Freedberg IM, Blumenberg M, Tomic‐Canic M. Specific organization of the negative response elements for retinoic acid and thyroid hormone receptors in keratin gene family. J Invest Dermatol. 1997; 109: 566–572. [DOI] [PubMed] [Google Scholar]
  • 18. Jho SH, Radoja N, Im MJ, Tomic‐Canic M. Negative response elements in keratin genes mediate transcriptional repression and the cross‐talk among nuclear receptors. J Biol Chem. 2001; 276: 45914–45920. [DOI] [PubMed] [Google Scholar]
  • 19. Jho SH, Vouthounis C, Lee B, Stojadinovic O, Im MJ, Brem H, Merchant A, Chau K, Tomic‐Canic M. The book of opposites: the role of the nuclear receptor co‐regulators in the suppression of epidermal genes by retinoic acid and thyroid hormone receptors. J Invest Dermatol. 2005; 124: 1034–1043. [DOI] [PubMed] [Google Scholar]
  • 20. Radoja N, Stojadinovic O, Waseem A, Tomic‐Canic M, Milisavljevic V, Teebor S, Blumenberg M. Thyroid hormones and gamma interferon specifically increase K15 keratin gene transcription. Mol Cell Biol. 2004; 24: 3168–3179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Cao T, Longley MA, Wang XJ, Roop DR. An inducible mouse model for epidermolysis bullosa simplex: implications for gene therapy. J Cell Biol. 2001; 152: 651–656. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Li D, Turi TG, Schuck A, Freedberg IM, Khitrov G, Blumenberg M. Rays and arrays: the transcriptional program in the response of human epidermal keratinocytes to UVB illumination. FASEB J. 2001; 15: 2533–2535. [DOI] [PubMed] [Google Scholar]
  • 23. Banno T, Adachi M, Mukkamala L, Blumenberg M. Unique keratinocyte‐specific effects of interferon‐gamma that protect skin from viruses, identified using transcriptional profiling. Antivir Ther. 2003; 8: 541–554. [PubMed] [Google Scholar]
  • 24. Banno T, Gazel A, Blumenberg M. Effects of tumor necrosis factor‐alpha (TNF alpha) in epidermal keratinocytes revealed using global transcriptional profiling. J Biol Chem. 2004; 279: 32633–32642. [DOI] [PubMed] [Google Scholar]
  • 25. Banno T, Gazel A, Blumenberg M. Pathway‐specific profiling identifies the NF‐kB‐dependent tumor necrosis factor a‐regulated genes in epidermal keratinocytes. J Biol Chem. 2005; 280: 18973–18980. [DOI] [PubMed] [Google Scholar]
  • 26. Gazel A, Banno T, Walsh R, Blumenberg M. Inhibition of JNK promotes differentiation of epidermal keratinocytes. J Biol Chem. 2006; 281: 20530–20541. [DOI] [PubMed] [Google Scholar]
  • 27. Stojadinovic O, Lee B, Vouthounis C, Vukelic S, Pastar I, Blumenberg M, Brem H, Tomic‐Canic M. Novel genomic effects of glucocorticoids in epidermal keratinocytes: inhibition of apoptosis, interferon‐gamma pathway, and wound healing along with promotion of terminal differentiation. J Biol Chem. 2007; 282: 4021–4034. [DOI] [PubMed] [Google Scholar]
  • 28. Newman JC, Weiner AM. L2L: a simple tool for discovering the hidden significance in microarray expression data. Genome Biol. 2005; 6: R81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Dennis G, Jr. , Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, Lempicki RA. DAVID: Database for annotation, visualization, and integrated discovery. Genome Biol. 2003; 4: P3. [PubMed] [Google Scholar]
  • 30. Eady RA. Epidermolysis bullosa: scientific advances and therapeutic challenges. J Dermatol. 2001; 28: 638–640. [DOI] [PubMed] [Google Scholar]
  • 31. Pai S, Marinkovich MP. Epidermolysis bullosa: new and emerging trends. Am J Clin Dermatol. 2002; 3: 371–380. [DOI] [PubMed] [Google Scholar]
  • 32. Saarialho‐Kere UK, Vaalamo M, Airola K, Niemi KM, Oikarinen AI, Parks WC. Interstitial collagenase is expressed by keratinocytes that are actively involved in reepithelialization in blistering skin disease. J Invest Dermatol. 1995; 104: 982–988. [DOI] [PubMed] [Google Scholar]
  • 33. Lin M, Hultquist KL, Oh DH, Bauer EA, Hoeffler WK. Inhibition of collagenase type I expression by psoralen antisense oligonucleotides in dermal fibroblasts. FASEB J. 1995; 9: 1371–1377. [DOI] [PubMed] [Google Scholar]
  • 34. Sato T, Nomura K, Hashimoto I. Expression of collagenase and stromelysin in skin fibroblasts from recessive dystrophic epidermolysis bullosa. Arch Dermatol Res. 1995; 287: 428–433. [DOI] [PubMed] [Google Scholar]
  • 35. Sawamura D, Sugawara T, Hashimoto I, Bruckner‐Tuderman L, Fujimoto D, Okada Y, Utsumi N, Shikata H. Increased gene expression of matrix metalloproteinase‐3 (stromelysin) in skin fibroblasts from patients with severe recessive dystrophic epidermolysis bullosa. Biochem Biophys Res Commun. 1991; 174: 1003–1008. [DOI] [PubMed] [Google Scholar]
  • 36. Moeller LC, Dumitrescu AM, Walker RL, Meltzer PS, Refetoff S. Thyroid hormone responsive genes in cultured human fibroblasts. J Clin Endocrinol Metab. 2005; 90: 936–943. [DOI] [PubMed] [Google Scholar]
  • 37. Haas MJ, Mreyoud A, Fishman M, Mooradian AD. Microarray analysis of thyroid hormone‐induced changes in mRNA expression in the adult rat brain. Neurosci Lett. 2004; 365: 14–18. [DOI] [PubMed] [Google Scholar]
  • 38. Berkowitz P, Hu P, Liu Z, Diaz LA, Enghild JJ, Chua MP, Rubenstein DS. Desmosome signaling. Inhibition of p38MAPK prevents pemphigus vulgaris IgG‐induced cytoskeleton reorganization. J Biol Chem. 2005; 280: 23778–23784. [DOI] [PubMed] [Google Scholar]
  • 39. Radoja N, Komine M, Jho SH, Blumenberg M, Tomic‐Canic M. Novel mechanism of steroid action in skin through glucocorticoid receptor monomers. Mol Cell Biol. 2000; 20: 4328–4339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Tomic M, Jiang CK, Connolly D, Freedberg IM, Blumenberg M. Vitamin D3, its receptor and regulation of epidermal keratin gene expression. Epithelial Cell Biol. 1992; 1: 70–75. [PubMed] [Google Scholar]
  • 41. Yazdanparast P, Carlsson B, Oikarinen A, Risteli J, Lavin T, Faergemann J. Action of topical thyroid hormone analogue, triiodothyroacetic acid in reversing glucocorticoid‐induced skin atrophy in humans. Thyroid. 2006; 16: 1157–1162. [DOI] [PubMed] [Google Scholar]
  • 42. Vahlquist A, Torma H, Carlsson B. Inefficacy of topical thyroid hormone analogue TriAc in plaque psoriasis: results of a double‐blind placebo‐controlled trial. Br J Dermatol. 2004; 151: 489–491. [DOI] [PubMed] [Google Scholar]
  • 43. Engelhard A, Christiano AM. The hairless promoter is differentially regulated by thyroid hormone in keratinocytes and neuroblastoma cells. Exp Dermatol. 2004; 13: 257–264. [DOI] [PubMed] [Google Scholar]
  • 44. Ahmad W, Faiyaz ul Haque M, Brancolini V, Tsou HC, Ul Haque S, Lam H, Aita VM, Owen J, DeBlaquiere M, Frank J, Cserhalmi‐Friedman PB, Leask A, McGrath JA, Peacocke M, Ahmad M, Ott J, Christiano AM. Alopecia universalis associated with a mutation in the human hairless gene. Science. 1998; 279: 720–724. [DOI] [PubMed] [Google Scholar]
  • 45. Blumenberg M, Connolly DM, Freedberg IM. Regulation of keratin gene expression: the role of the nuclear receptors for retinoic acid, thyroid hormone and vitamin D3. J Invest Dermatol. 1992; 98: 42S–49S. [DOI] [PubMed] [Google Scholar]
  • 46. Tomic‐Canic M, Sunjevaric I, Freedberg IM, Blumenberg M. Identification of the retinoic acid and thyroid hormone receptor‐responsive element in the human K14 keratin gene. J Invest Dermatol. 1992; 99: 842–847. [DOI] [PubMed] [Google Scholar]
  • 47. Ohtsuki M, Tomic‐Canic M, Freedberg IM, Blumenberg M. Regulation of epidermal keratin expression by retinoic acid and thyroid hormone. J Dermatol. 1992; 19: 774–780. [DOI] [PubMed] [Google Scholar]
  • 48. Gazel A, Ramphal P, Rosdy M, De Wever B, Tornier C, Hosein N, Lee B, Tomic‐Canic M, Blumenberg M. Transcriptional profiling of epidermal keratinocytes: comparison of genes expressed in skin, cultured keratinocytes, and reconstituted epidermis, using large DNA microarrays. J Invest Dermatol. 2003; 121: 1459–1468. [DOI] [PubMed] [Google Scholar]
  • 49. Radoja N, Gazel A, Banno T, Yano S, Blumenberg M. Transcriptional profiling of epidermal differentiation. Physiol Genomics. 2006; 27: 65–78. [DOI] [PubMed] [Google Scholar]
  • 50. Simon M, Green H. Participation of membrane‐associated proteins in the formation of the cross‐linked envelope of the keratinocyte. Cell. 1984; 36: 827–834. [DOI] [PubMed] [Google Scholar]
  • 51. Dudoit S, Gentleman RC, Quackenbush J. Open source software for the analysis of microarray data. Biotechniques. 2003; Suppl: 45–51. [PubMed] [Google Scholar]
  • 52. Ho Sui SJ, Mortimer JR, Arenillas DJ, Brumm J, Walsh CJ, Kennedy BP, Wasserman WW. oPOSSUM: identification of over‐represented transcription factor binding sites in co‐expressed genes. Nucleic Acids Res. 2005; 33: 3154–3164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Van Baren MJ, Heutink P. The PCR suite. Bioinformatics. 2004; 20: 591–593. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Translational Science are provided here courtesy of Wiley

RESOURCES