Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2004 Aug;42(8):3649–3654. doi: 10.1128/JCM.42.8.3649-3654.2004

Use of 16S rRNA Gene Sequencing for Rapid Confirmatory Identification of Brucella Isolates

Jay E Gee 1,*, Barun K De 1, Paul N Levett 1,†, Anne M Whitney 1, Ryan T Novak 1, Tanja Popovic 1
PMCID: PMC497563  PMID: 15297511

Abstract

Members of the genus Brucella are categorized as biothreat agents and pose a hazard for both humans and animals. Current identification methods rely on biochemical tests that may require up to 7 days for results. We sequenced the 16S rRNA genes of 65 Brucella strains along with 17 related strains likely to present a differential diagnostic challenge. All Brucella 16S rRNA gene sequences were determined to be identical and were clearly different from the 17 related strains, suggesting that 16S rRNA gene sequencing is a reliable tool for rapid genus-level identification of Brucella spp. and their differentiation from closely related organisms.


Brucella spp., the causative agents of brucellosis, are pathogenic to a variety of domesticated and wild animals. The genus Brucella is comprised of gram-negative, facultative, intracellular pathogens (1). Phenotypic characteristics, antigenic variation, and prevalence of infection in different animal hosts have resulted in the initial recognition of six species: B. abortus (cattle), B. melitensis (goats/sheep), B. suis (swine), B. canis (dogs), B. ovis (rams), and B. neotomae (desert rats) (13, 27). Recently two Brucella strains from different marine mammals have been reported (7, 11, 22), and the names B. pinnipediae (seal/otter) and B. cetaceae (porpoise/whale) have been proposed (12). DNA hybridization analyses indicate a high level of homology among the brucellae, suggesting that the genus Brucella may comprise only one species with several biovars (40).

Brucellosis impacts public health and agricultural economies worldwide because of its high infectivity rate (13). Brucella spp. have also long been considered a potential biological weapon (20), and currently, with the renewed threat of biological warfare and agricultural terrorism, B. melitensis, B. suis, and B. abortus are listed as category B biothreat agents by the Centers for Disease Control and Prevention Strategic Planning Group (34).

Infections in humans generally result from (i) transmission via the gastrointestinal route by the consumption of unpasteurized diary products (18, 32) and contaminated meat (25), (ii) airborne transmission in animal husbandry by inhaling dust contaminated by aborted tissues (23), and (iii) transmission caused by laboratory-associated exposure to aerosols (26). In the event of a bioterror attack, the preferred method of dissemination would most likely be via aerosol (3, 20, 34).

Because of the limited availability of animal vaccines, cost of animal inoculations, a lack of vaccines for human use (13, 37), and its low infectious dose for humans, human brucellosis is endemic in many parts of the world, including the Mediterranean region, Latin America, Asia, and Africa. The reported incidence varies from <0.01 to >200 per 100,000 population (13). Human brucellosis is rare in the United States, with approximately 100 human cases reported per year, mostly caused by consumption of unpasteurized diary products and, to a lesser degree, occupational exposure (10, 38).

The rapidity with which a laboratory diagnosis can be obtained is an important component of every outbreak investigation, because knowledge about the causative agent plays a pivotal role in implementing appropriate public health decisions in a timely manner (21, 34). At present, diagnosis of human brucellosis depends primarily on isolation of Brucella spp. from blood (43), followed by performing a set of bacteriological tests that allows for reliable identification to the subspecies (biotype) level but that requires up to 7 days for completion (1, 42). Another diagnostic option is the use of serologic assays; however, the specificity of these tests is inconsistent because of cross-reactivity with bacteria closely related to the genus Brucella (29).

Extensive efforts have been expended on the development of molecular diagnostic assays based on amplification of different genomic targets by the PCR for the identification of Brucella spp., as recently reviewed by Bricker (6). Although these molecular approaches appeared to be faster and more sensitive than traditional bacteriological tests, they are not considered to be confirmatory tests due to limited specificity (8, 9, 14). Recently a multiplex system has been developed that is sensitive for Brucella spp. and is able to differentiate between B. melitensis and B. abortus (33). However, discrepant results were observed with some B. abortus isolates. So far, none of these assays has been accepted for common use in diagnostic laboratories.

In collaboration with the Association of Public Health Laboratories, the Centers for Disease Control and Prevention Laboratory Response Network has developed standard algorithms based on traditional bacteriological tests (1) for the identification of Brucella spp. by Laboratory Response Network laboratories. Our current efforts are aimed at developing and validating more rapid methods that will allow confirmatory identification of Brucella spp. from cultures and, subsequently, directly in clinical specimen samples.

We chose to evaluate 16S rRNA gene sequencing to determine its utility for confirmatory identification of Brucella spp. The advantage of this method is that results can be obtained within 1 day as compared to 7 days by traditional microbiological testing. Previous work on other bacteria has indicated that differences in 16S rRNA gene sequences may be useful for subtyping or for the differentiation of virulent subtypes from nonvirulent subtypes (30, 36). Low variability in the 16S rRNA locus has been noted as an impediment in using 16S rRNA gene sequencing to discriminate at the species level (41); recent studies of other biothreat select agents have indicated that even subtle differences in the 16S rRNA gene sequence may be used for differentiating and identifying closely related species, which are often cross-reactive in biochemical identification systems commonly used in diagnostic laboratories (19, 35). In this study, we have primarily focused on the applicability of 16S rRNA gene sequencing as a rapid confirmatory identification tool and consequently have sequenced the near-full-length 16S rRNA genes of a reference set of Brucella isolates that represent the species commonly encountered in animal and human infections. In addition, we sequenced 17 closely related diagnostically challenging strains.

MATERIALS AND METHODS

Bacterial strains.

In this study, 65 Brucella strains (representing six species) from a collection of over 600 were selected to represent temporal, geographic, and source diversity (Table 1). A panel of 17 related strains likely to present a differential diagnostic challenge was also selected for comparison (Table 2). All strains were stored at −70°C in defibrinated rabbit blood until testing. Identification of all strains was carried out by standard microbiological procedures as described previously (42).

TABLE 1.

Designations of 65 Brucella isolates analyzed in this study

Identifier (n) Other identifier GenBank accession no. Origina
B. abortus biovar 1 (1)
    1995009620 G9400 AY513568 Human, United States, 1995
B. abortus biovar 4 (9)
    2000031282 U.S. strain 19 AY513567 United States
    2000031287 G8108 AY513566 Human, United States, 2000
    2000032001 ATCC 27565 AY513565 Cow, United States, 1989
    2000032850 A8898 AY513564 Human, United States, 1967
    2002013039 E7789 AY513563 Human, United States, 1980
    2002013040 F6650 AY513562 Human, United States, 1985
    2002013041 G4321 AY513561 Human, United States, 1990
    2002013043 F7752 AY513560 Human, United States, 1986
    2002034574 AY513559 Human, United States, 2002
B. canis (16)
    1995011487 G9398 AY513521 Human, United States, 1995
    1997019052 H0263 AY513519 Human, United States, 1995
    2000032857 C6328 AY513516 Human, United States, 1973
    2000032858 C6744 AY513515 Dog, United States, 1973
    2000032864 B3634 AY513514 Dog, United States, 1969
    2000032900 D1408 AY513513 Human, United States, 1974
    1982065260 F3081 AY513523 Human, United States, 1982
    1982065472 F3106 AY513522 Human, United States, 1982
    1996034585 H0078 AY513520 Human, United States, 1996
    1998034421 H0801 AY513518 Human, United States, 1998
    2000031290 ATCC 23365 AY513517 Dog, United States, 1967
    2000032901 D2773 AY513512 Dog, United States, 1995
    2000032906 D8615 AY513511 United States, 1997
    2000032907 D9880 AY513510 Dog, United States, 1997
    2002009962 AY513509 Human, United States, 2002
    2002721534 A6806 AY513508 Dog, United States, 1967
B. melitensis biovar 1 (7)
    1995032533 G9653 AY513532 Human, United States, 1995
    1996013690 G9807 AY513531 Human, United States, 1996
    1996034727 H0088 AY513530 Human, United States, 1996
    1997030040 H0429 AY513529 Human, United States, 1997
    1998034324 H0794 AY513528 Human, United States, 1998
    1999012120 H0966 AY513527 Human, United States, 1990
    2000031283 ATCC 23456 AY594215 Type strain, United States
B. melitensis biovar 2 (5)
    2000031298 H0227 AY513535 Human, United States, 1997
    1995013840 G9423 AY513537 Human, United States, 1995
    1998034639 H0810 AY513536 Human, United States, 1998
    2000042326 H1696 AY513533 Human, United States, 2000
    2001025901 H1982 AY513534 Human, United States, 2001
B. melitensis biovar 3 (13)
    2000027708 H1481 AY513540 Human, United States, 2000
    2000032851 A8915 AY513539 Human, United States, 1967
    1976069495 D5927 AY513550 Human, United States, 1976
    1979030625 E4026 AY513549 Human, United States, 1979
    1994041749 AY513548 Human, United States, 1994
    1994042277 G9226 AY513547 Human, United States, 1994
    1995019300 G9541 AY513546 Human, United States, 1995
    1995019540 G9559 AY513545 Human, United States, 1995
    1995019574 G9560 AY513544 Human, United States, 1995
    1995030467 G9604 AY513543 Human, United States, 1995
    1996001118 G9715 AY513542 Human, United States, 1996
    1998015411 H0620 AY513541 Human, United States, 1998
    2002020524 AY513538 Human, United States, 2002
B. neotomae (1)
    2002721533 ATCC 23459 AY594216 Type strain, United States
B. ovis (3)
    2002013048 ATCC 25840 AY513526 Type strain, United States, 1953
    2002013049 G7864 AY513525 Ram, New Zealand, 1992
    2003007064 KC354 AY513524 Ram, United States, 1957
B. suis biovar 1 (8)
    1981096256 H0129 AY513557 Human, United States, 1981
    1973034528 C4588 AY513558 Human, United States, 1972
    1994037280 G9129 AY513556 Human, United States, 1994
    1996028458 G9992 AY513555 Human, United States, 1996
    1996028782 H0019 AY513554 Human, United States, 1996
    1997000956 H0129 AY513553 Human, United States, 1997
    1999043423 H1246 AY513552 Human, United States, 1999
    2000027958 H1498 AY513551 Human, United States, 2000
B. suis biovar 4 (2)
    1997003632 H0134 AY513506 Human, United States, 1997
    1996028684 H0012 AY513507 Human, United States, 1996
a

The source and temporal origin of the isolate is given when available.

TABLE 2.

Designations of strains closely related to Brucella species

Species (n) % Sequence similarity Identifier Other identifier GenBank accession no.
Agrobacterium spp. (4) 100
    Agrobacterium tumefaciens 2002000903 H2110 AY513489
    Agrobacterium radiobacter 2003015367 H2549 AY513491
2003018195 H2587 AY513490
2001025242 H1961 AY513492
Ochrobactrum anthropi 5D (3) 100
1999045026 H1269 AY513495
2000037232 H1635 AY513494
2002030421 H2323 AY513493
Oligella urethralis (4) 99.9
2001034128 H2074 AY513496
2002020954 H2223 AY513497
2001034309 H2079 AY513498
2003015904 H2576 AY513499
Vibrio cholerae (2) 100
2002734018 VC13-Inaba AY513501
2002734019 VC12-Ogawa AY513500
Others
    Afipia broomeaa 1998029722 H0781 AY513505
    Afipia felis 2002033830 H2373 AY513503
    Bartonella henselaeb 882-ANT5 AY513504
    E. coli 2002734020 13535 AY513502
a

The level of similarity is based on BESTFIT analysis of the two most divergent isolates based on DISTANCES results in the GCG Wisconsin package.

b

Lee et al (24).

Amplification of 16S rRNA genes.

Bacteria were grown by plating one loop (1 μl) of stock cell suspension on Trypticase soy agar with 5% defibrinated sheep blood agar (BBL Microbiology Systems, Cockeysville, Md.) and incubating the bacteria aerobically for 1 to 2 days at 37°C with 5% CO2. To yield a DNA template, a single colony was suspended in 200 μl of 10 mM Tris (pH 8.0) in a 1.5-ml Millipore 0.22-μm-pore-diameter filter unit (Millipore, Bedford, Mass.) and heated at 95°C for 30 min. The filter unit was then centrifuged at 6,000 × g for 5 min to recover the filtrate containing the DNA template. Each final PCR (100 μl) contained 5 U of Expand DNA polymerase (Roche, Indianapolis, Ind.), 2 μl of DNA template, 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 1.5 mM MgCl2, 200 μM (each) dATP, dCTP, dGTP, and dTTP, and 0.4 μM each of eubacterial primers F8 (5′ AGTTTGATCCTGGCTCAG 3′) and R1492 (5′ ACCTTGTTACGACTT 3′) (17). Reaction mixtures were first incubated for 5 min at 95°C. Then 35 cycles were performed as follows: 15 s at 94°C, 15 s at 50°C, and 1 min 30 s at 72°C. Reaction mixtures were then incubated at 72°C for an additional 5 min. PCR products were purified with a Qiaquick PCR purification kit (Qiagen, Valencia, Calif.).

16S rRNA gene sequencing.

Sequencing primers were chosen from a panel of eubacterial primers: F8, R1492 (described above), F357 (5′ TACGGGAGGCAGCAG 3′), R357 (5′ CTGCTGCCTCCCGTA 3′), F530 (5′ CAGCAGCCGCGGTAATAC 3′), R530 (5′ GTATTACCGCGGCTGCTG 3′), F790 (5′ ATTAGATACCCTGGTAG 3′), R790 (5′ CTACCAGGGTATCTAAT 3′), F1068 (5′ GTCGTCAGCTCGTGTCGTGAG 3′), F1083 (5′ CGTGACATGTTGGGTTAAGTC 3′), F981 (5′ CCCGCAACGAGCGCAACCC 3′), and R981 (5′ GGGTTGCGCTCGTTGCGGG 3′) (17, 28, 35). For non-Brucella strains sequenced for comparison, four additional eubacterial primers were used: R1333 (5′ CTAGCGATTCCGACTTCATGC 3′), R180 (5′ TCTCTCAAGACGTATGCGGTA 3′), R591 (5′ CATCCTGCTTAAGTAACCGTC 3′), and F1127 (5′ ATTAGTTGCCATCATTCAGTT 3′). Sequencing was performed with an Applied Biosystems (ABI, Foster City, Calif.) BigDye terminator cycle sequencing kit (version 2.0, 1.1, or 1.0) per the manufacturer's instructions, with the exception of using 6 μl of BigDye instead of 8 μl. Sequencing products were purified by using Centri-Sep spin columns (Princeton Separations, Adelphia, N.J.), and these sequencing products were resolved with an ABI model 3100 automated DNA sequencing system (ABI).

Computer analysis of 16S rRNA gene sequences. (i) Evaluation of the 16S rRNA gene sequences of Brucella spp.

The 16S rRNA gene sequencing of the amplified products obtained with PCR primers F8 and R1492 generated 1,412-bp-long sequences that closely matched the size of previously published Brucella 16S rRNA gene sequences. The length of these sequences was close to the full length of the gene, which is 1,485 bp (5, 7, 16), and thus allowed direct comparisons.

The software package used for all data analysis was the Accelrys, Inc. (San Diego, Calif.), GCG Wisconsin package, version 10.2. The raw trace files from the ABI 3100 sequencer were visually examined, aligned, and edited (SEQMERGE).

We compared the Brucella sequences by using DISTANCES to determine the level of similarity among them. The sequences generated in this study were compared with previously published Brucella spp. sequences by using BESTFIT to determine levels of similarity between sequences.

(ii) Comparisons of 16S rRNA gene sequences of Brucella spp. to sequences of closely related strains.

The eubacterial primers F8 and R1492 were also used for the panel of related strains likely to present a differential diagnostic challenge. The 16S rRNA gene sequences from the amplification products that resulted from F8 and R1492 varied in length (1,377 to 1,491 bp). For the Agrobacterium, Ochrobactrum anthropi, Oligella urethralis, and Vibrio cholerae strains, the sequences were organized into sets by genus (Table 2) and aligned (PILEUP). A core segment of 1.4 to 1.5 kb was selected for each that was common to all the sequences in a given set by trimming sequences at the 5′ and 3′ ends. The level of similarity of the sequences in a set was then determined by using Jukes-Cantor correction (DISTANCES). The sequences within the Agrobacterium set matched each other 100%, as did the sequences within the O. anthropi and V. cholerae sets (Table 2). The most divergent sequences within the O. urethralis set matched at 99.9% (Table 2). A representative sequence from each set, as well as the 16S rRNA gene sequences from Escherichia coli O157:H7, Bartonella henselae, Afipia broomeae, and Afipia felis, were then compared to the Brucella consensus sequence to determine the level of similarity by BESTFIT (Table 3).

TABLE 3.

Similarities of Brucella 16S rRNA consensus gene sequence to 16S rRNA gene sequences of strains related to Brucella spp. and species important for diagnostic differentiation

Isolate % Similarity of 16S rRNA gene sequence to Brucella consensus sequencea Length of sequence used for analysis (bp)
Ochrobactrum anthropi 5D (1999045026) 98.8 1,427
Bartonella henselae (882-ANT5) 94.9 1,425
Agrobacterium tumefaciens (2002000903) 94.2 1,430
Afipia felis (2002033830) 91.0 1,377
Afipia broomeae (1998029722) 89.9 1,377
E. coli O157:H7 (2002734020) 81.8 1,452
Vibrio cholerae (2002734018) 81.5 1,491
Oligella urethralis (2001034128) 80.3 1,457
a

Sequence similarity is based on BESTFIT analysis in the GCG Wisconsin package.

Nucleotide sequence accession number.

A total of 82 16S rRNA gene sequences were determined in this study (Tables 1 and 2). They have been deposited in GenBank under accession no. AY513489 for Agrobacterium tumefaciens; AY513490 to AY513492 for Agrobacterium radiobacter; AY513493 to AY513495 for O. anthropi 5D; AY513496 to AY513499 for O. urethralis; AY513500 to AY5135501 for V. cholerae; AY513502 for E. coli; AY513503 for A. felis; AY513504 for B. henselae; AY513505 for A. broomeae; and AY513506 to AY513568, AY594215, and AY594216 for Brucella spp.

RESULTS

Near-full-length 1,412-bp nucleotide sequences of the 16S rRNA genes from 65 Brucella strains (Table 1) comprising six Brucella spp. were generated. Upon alignment and comparison, all 16S rRNA gene sequences were determined to be identical. This result yielded a Brucella consensus sequence that was used for all comparisons.

A BLAST search (10 October 2003) on GenBank indicated that there were only 17 Brucella 16S rRNA gene sequences (from 10 strains) near 1.4 kb available in this public database (2). Eleven of these gene sequences were a 100% match to our Brucella consensus sequence. Six of these 11 sequences were from B. melitensis strain 16 M and B. suis strain 1330, for which full genome sequences were published in 2002 (15, 31). Both strains have two chromosomes, and each strain has three copies of the 16S rRNA gene with two copies on chromosome I and one copy on chromosome II (15, 31). A BLAST analysis (8 October 2003) of both genome sequences on The Institute for Genomic Research website (http://tigrblast.tigr.org/cmr-BLAST/) (2) revealed that all three copies from each strain were a 100% match to our Brucella 16S rRNA gene consensus sequence. Two additional 16S rRNA sequences that were a 100% match to our Brucella consensus sequence are those of the recently published marine Brucella strain M2357/93 and B. abortus strain 544 (GenBank accession no. AF091353 and AF091354) (7). Finally, the last three 16S rRNA gene sequences of the 11 are from a study published in 2000 that also used the B. melitensis strain 16 M (accession no. AF220149, AF220148, and AF220147) (5).

There were six near-full-length Brucella 16S rRNA gene sequences that were not 100% matches to the consensus sequence. These sequences were entered into GenBank between 1989 and 1995. The first one is that of B. ovis strain ATCC 25840 (accession no. L26168) (K. H. Wilson, unpublished data), which differs from the consensus sequence by 3 bp. Compared to the consensus sequence, this B. ovis sequence has an A instead of a G at position 600, as well as Ns at positions 426 and 700. We sequenced three B. ovis isolates, including the ATCC 25840 strain, and all three sequences were a 100% match to the Brucella consensus sequence. The Brucella consensus sequence also differs substantially from the 16S rRNA gene sequence generated in 1989 for B. abortus strain 11/19 (accession no. X13695) (16). A BESTFIT analysis indicates that there is a 19-bp difference, including an N as well as a 3-bp deletion compared to our Brucella consensus sequence. A BLAST query on GenBank indicates that the sequence of accession no. X13695 is unique and does not perfectly match any other 16S rRNA gene sequence in the public database. The remaining four Brucella 16S rRNA gene sequences in GenBank are from B. suis strain ATCC 23444, B. melitensis strain ATCC 23456, B. neotomae strain ATCC 23459 (accession no. L26169, L26166, and L26167, respectively) (Wilson, unpublished), and B. canis strain ATCC 23365 (accession no. L37584) (K. H. Wilson and H. G. Hills, unpublished data), which differed from the consensus sequence by 1 to 6 bp. Three of these four sequences had Ns in the sequences, indicating an inability to identify bases.

B. abortus strain 11/19 was not available for resequencing: however, this strain is the same as U.S. strain 19 (E. Moreno, personal communication). We sequenced the 16S rRNA genes from B. abortus U.S. strain 19, B. melitensis strain ATCC 23456, B. neotomae strain ATCC 23459, and B. canis strain ATCC 23365. All four sequences were a 100% match to the Brucella consensus sequence.

Comparisons with the panel of 17 related strains likely to present a differential diagnostic challenge indicated that the sequence most similar to the Brucella consensus sequence was that from an O. anthropi strain at 98.8% similarity (Table 3), which is consistent with the relationship seen in previous phylogenetic studies (39). There is a difference of 16 bp, as well as a deletion and an insertion, which easily differentiates the Brucella consensus sequence from this sequence. The other 16S rRNA gene sequences from this panel of strains had even more pronounced differences (Table 3).

DISCUSSION

Current confirmatory identification of Brucella isolates relies upon a set of traditional microbiological tests that requires up to 7 days for completion. At the same time, safety concerns have limited the wide application of automated identification systems, which could potentially shorten the time from collection of an unknown specimen to obtaining the laboratory diagnosis. Few evaluations of such systems for Brucella identification have been made, but all suggest that the performance of automated systems has generally been poor (D. E. Roe, J. M. Janda, D. Lindquist, N. Caton, C. Crandall, J. Wong, and B. Zimmer, Abstr. 101st Gen. Meet. Am. Soc. Microbiol., abstr. C-340, 2001; J. C. David, W. L. Thomas, R. J. Burgess, and T. L. Hadfield, Abstr. 101st Gen. Meet. Am. Soc. Microbiol., abstr. C-335, 2001). Consequently, because Brucella spp. typically require several days of incubation before attaining a level of growth sufficient for the interpretation of various phenotypic tests (1), a more rapid approach for identification is needed, especially for a timely response to a potential biothreat event.

The critical advantage of 16S rRNA gene sequencing is based on its ability to be used for identification of unknown isolates. By using the broad-range eubacterial primers, as demonstrated in this study, a 16S rRNA gene sequence can be readily obtained, allowing for rapid confirmatory identification of an unknown isolate as a Brucella species by simple comparison to the consensus sequence. Confirmatory identification can then serve as a guide to continue all subsequent work with biosafety level 3 practices, while the rapidity with which it is obtained may be the critical factor needed for quickly implementing control and preventative measures in an emergency biothreat situation (6, 34). The PCR tests previously proposed limit the laboratorian to either positively identifying gene regions associated with a Brucella species or ruling out Brucella spp., which would then require subsequent diagnostic tests to identify the etiologic agent. Sequencing the 16S rRNA gene enables querying a database such as GenBank to yield an alternative identification without the need for any additional laboratory work. Consequently, given that the clinical presentation of brucellosis can resemble diseases caused by other select agents, this global diagnostic approach will be invaluable in a potential biothreat setting. We have added to the robustness of this approach by submitting to GenBank 82 high-quality 16S rRNA gene sequences from Brucella spp. and close relatives, which allows for a more accurate comparison of sequences.

One additional advantage of using 16S rRNA gene sequencing is that this method may be able to identify the causative organism from clinical specimens of patients who have received antimicrobial agents prior to the collection of specimens, as has been demonstrated recently during the 2001 bioterrorism-associated anthrax investigation (35). Because antimicrobial and other supportive treatment will not differ regardless of the Brucella species causing the illness (4), detection of the Brucella-specific 16S rRNA gene sequence will be advantageous for timely treatment of patients even without species identification.

Our result of 100% identity of the 16S rRNA gene sequence among the large number of Brucella strains tested is consistent with previous studies using a limited number of strains (5, 7) and could also be used to support proposals that Brucella may be a monospecific genus, based on the DNA hybridization studies that indicate a >77% level of homogeneity for the Brucella spp. (40). Vizcaíno et al. observed that there was some variability in the 16S rRNA locus, but not enough to separate the Brucella species (41). Similarly, there are some Brucella 16S rRNA gene sequences in GenBank that differ from the consensus sequence. We resequenced all but one of these discrepant GenBank submissions. Each was a 100% match to the Brucella consensus sequence. We do not believe the differences in the sequences from the original GenBank entries represent microheterogeneity in the 16S rRNA genes of these Brucella strains. Rather, these discrepant sequences were submitted from 1989 to 1995 before the advent of automated sequencing technologies with higher fidelity. This is supported by the presence of unresolved bases in some of these discrepant sequences.

A comparison of the Brucella 16S rRNA consensus sequence with those of close relatives indicates that sequencing of the first 500 bp is sufficient to differentiate them. The closest match, O. anthropi, was different by 2 bp in this segment, which is a sufficient level of divergence to be detected by current automated sequencing technology. For laboratories that may wish to conserve resources, this may be a viable option compared to sequencing 1.4 kb.

This work demonstrates that 16S rRNA gene sequencing can provide rapid confirmatory identification of an isolate as a Brucella species, allowing prompt and appropriate public health responses to be implemented. This approach will be of even greater value if shown to be effective when used directly on clinical specimens; studies are under way in our laboratory to evaluate its sensitivity and specificity on clinical specimens of patients with culture-confirmed brucellosis.

Acknowledgments

We thank Timothy Barrett for supplying some of the strains used in this study.

REFERENCES

  • 1.Alton, G. G., L. M. Jones, and D. E. Pietz. 1975. Laboratory techniques in brucellosis, 2nd ed. World Health Organization, Geneva, Switzerland. [PubMed]
  • 2.Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
  • 3.Anonymous. 2004. Public health response to biological and chemical weapons, 2nd ed. World Health Organization, Geneva, Switzerland.
  • 4.Bodur, H., N. Balaban, S. Aksaray, V. Yetener, E. Akinci, A. Colpan, and A. Erbay. 2003. Biotypes and antimicrobial susceptibilities of Brucella isolates. Scand. J. Infect. Dis. 35:337-338. [DOI] [PubMed] [Google Scholar]
  • 5.Bricker, B. J. 2000. Characterization of the three ribosomal RNA operons rrnA, rrnB, and rrnC, from Brucella melitensis. Gene 255:117-126. [DOI] [PubMed] [Google Scholar]
  • 6.Bricker, B. J. 2002. PCR as a diagnostic tool for brucellosis. Vet. Microbiol. 90:435-446. [DOI] [PubMed] [Google Scholar]
  • 7.Bricker, B. J., D. R. Ewalt, A. P. MacMillan, G. Foster, and S. Brew. 2000. Molecular characterization of Brucella strains isolated from marine mammals. J. Clin. Microbiol. 38:1258-1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bricker, B. J., and S. M. Halling. 1995. Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J. Clin. Microbiol. 33:1640-1642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Casanas, M. C., M. I. Queipo-Ortuno, A. Rodriguez-Torres, A. Orduna, J. D. Colmenero, and P. Morata. 2001. Specificity of a polymerase chain reaction assay of a target sequence on the 31-kilodalton Brucella antigen DNA used to diagnose human brucellosis. Eur. J. Clin. Microbiol. Infect. Dis. 20:127-131. [DOI] [PubMed] [Google Scholar]
  • 10.Chang, M. H., M. K. Glynn, and S. L. Groseclose. 2003. Endemic, notifiable bioterrorism-related diseases, United States, 1992-1999. Emerg. Infect. Dis. 9:556-564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Cloeckaert, A., M. Grayon, and O. Grepinet. 2000. An IS711 element downstream of the bp26 gene is a specific marker of Brucella spp. isolated from marine mammals. Clin. Diagn. Lab. Immunol. 7:835-839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Cloeckaert, A., M. Grayon, O. Grepinet, and K. S. Boumedine. 2003. Classification of Brucella strains isolated from marine mammals by infrequent restriction site-PCR and development of specific PCR identification tests. Microbes Infect. 5:593-602. [DOI] [PubMed] [Google Scholar]
  • 13.Corbel, M. J. 1997. Brucellosis: an overview. Emerg. Infect. Dis. 3:213-221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Da Costa, M., J. P. Guillou, B. Garin-Bastuji, M. Thiebaud, and G. Dubray. 1996. Specificity of six gene sequences for the detection of the genus Brucella by DNA amplification. J. Appl. Bacteriol. 81:267-275. [DOI] [PubMed] [Google Scholar]
  • 15.DelVecchio, V. G., V. Kapatral, R. J. Redkar, G. Patra, C. Mujer, T. Los, N. Ivanova, I. Anderson, A. Bhattacharyya, A. Lykidis, G. Reznik, L. Jablonski, N. Larsen, M. D'Souza, A. Bernal, M. Mazur, E. Goltsman, E. Selkov, P. H. Elzer, S. Hagius, D. O'Callaghan, J. J. Letesson, R. Haselkorn, N. Kyrpides, and R. Overbeek. 2002. The genome sequence of the facultative intracellular pathogen Brucella melitensis. Proc. Natl. Acad. Sci. USA 99:443-448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Dorsch, M., E. Moreno, and E. Stackebrandt. 1989. Nucleotide sequence of the 16S rRNA from Brucella abortus. Nucleic Acids Res. 17:1765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Eden, P. A., T. M. Schmidt, R. P. Blakemore, and N. R. Pace. 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction-amplified 16S rRNA-specific DNA. Int. J. Syst. Bacteriol. 41:324-325. [DOI] [PubMed] [Google Scholar]
  • 18.Fosgate, G. T., T. E. Carpenter, B. B. Chomel, J. T. Case, E. E. DeBess, and K. F. Reilly. 2002. Time-space clustering of human brucellosis, California, 1973-1992. Emerg. Infect. Dis. 8:672-678. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Gee, J. E., C. T. Sacchi, M. B. Glass, B. K. De, R. S. Weyant, P. N. Levett, A. M. Whitney, A. R. Hoffmaster, and T. Popovic. 2003. Use of 16S rRNA gene sequencing for rapid identification and differentiation of Burkholderia pseudomallei and B. mallei. J. Clin. Microbiol. 41:4647-4654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Greenfield, R. A., D. A. Drevets, L. J. Machado, G. W. Voskuhl, P. Cornea, and M. S. Bronze. 2002. Bacterial pathogens as biological weapons and agents of bioterrorism. Am. J. Med. Sci. 323:299-315. [DOI] [PubMed] [Google Scholar]
  • 21.Iqbal, S. S., M. W. Mayo, J. G. Bruno, B. V. Bronk, C. A. Batt, and J. P. Chambers. 2000. A review of molecular recognition technologies for detection of biological threat agents. Biosens. Bioelectron. 15:549-578. [DOI] [PubMed] [Google Scholar]
  • 22.Jahans, K. L., G. Foster, and E. S. Broughton. 1997. The characterisation of Brucella strains isolated from marine mammals. Vet. Microbiol. 57:373-382. [DOI] [PubMed] [Google Scholar]
  • 23.Kaufmann, A. F., M. D. Fox, J. M. Boyce, D. C. Anderson, M. E. Potter, W. J. Martone, and C. M. Patton. 1980. Airborne spread of brucellosis. Ann. N. Y. Acad. Sci. 353:105-114. [DOI] [PubMed] [Google Scholar]
  • 24.Lee, A. K., and S. Falkow. 1998. Constitutive and inducible green fluorescent protein expression in Bartonella henselae. Infect. Immun. 66:3964-3967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Malik, G. M. 1997. A clinical study of brucellosis in adults in the Asir region of southern Saudi Arabia. Am. J. Trop. Med. Hyg. 56:375-377. [DOI] [PubMed] [Google Scholar]
  • 26.Miller, C. D., J. R. Songer, and J. F. Sullivan. 1987. A twenty-five year review of laboratory-acquired human infections at the National Animal Disease Center. Am. Ind. Hyg. Assoc. J. 48:271-275. [DOI] [PubMed] [Google Scholar]
  • 27.Moreno, E., A. Cloeckaert, and I. Moriyon. 2002. Brucella evolution and taxonomy. Vet. Microbiol. 90:209-227. [DOI] [PubMed] [Google Scholar]
  • 28.Moreno, E., E. Stackebrandt, M. Dorsch, J. Wolters, M. Busch, and H. Mayer. 1990. Brucella abortus 16S rRNA and lipid A reveal a phylogenetic relationship with members of the alpha-2 subdivision of the class Proteobacteria. J. Bacteriol. 172:3569-3576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nielsen, K. 2002. Diagnosis of brucellosis by serology. Vet. Microbiol. 90:447-459. [DOI] [PubMed] [Google Scholar]
  • 30.Nilsson, W. B., R. N. Paranjype, A. DePaola, and M. S. Strom. 2003. Sequence polymorphism of the 16S rRNA gene of Vibrio vulnificus is a possible indicator of strain virulence. J. Clin. Microbiol. 41:442-446. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Paulsen, I. T., R. Seshadri, K. E. Nelson, J. A. Eisen, J. F. Heidelberg, T. D. Read, R. J. Dodson, L. Umayam, L. M. Brinkac, M. J. Beanan, S. C. Daugherty, R. T. Deboy, A. S. Durkin, J. F. Kolonay, R. Madupu, W. C. Nelson, B. Ayodeji, M. Kraul, J. Shetty, J. Malek, S. E. Van Aken, S. Riedmuller, H. Tettelin, S. R. Gill, O. White, S. L. Salzberg, D. L. Hoover, L. E. Lindler, S. M. Halling, S. M. Boyle, and C. M. Fraser. 2002. The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. Proc. Natl. Acad. Sci. USA 99:13148-13153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Porter, A. M., and E. L. Smith. 1971. Brucellosis and goat's cheese? Br. Med. J. 3:580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Probert, W. S., K. N. Schrader, N. Y. Khuong, S. L. Bystrom, and M. H. Graves. 2004. Real-time multiplex PCR assay for detection of Brucella spp., B. abortus, and B. melitensis. J. Clin. Microbiol. 42:1290-1293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Rotz, L. D., A. S. Khan, S. R. Lillibridge, S. M. Ostroff, and J. M. Hughes. 2002. Public health assessment of potential biological terrorism agents. Emerg. Infect. Dis. 8:225-230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sacchi, C. T., A. M. Whitney, L. W. Mayer, R. Morey, A. Steigerwalt, A. Boras, R. S. Weyant, and T. Popovic. 2002. Sequencing of 16S rRNA gene: a rapid tool for identification of Bacillus anthracis. Emerg. Infect. Dis. 8:1117-1123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sacchi, C. T., A. M. Whitney, M. W. Reeves, L. W. Mayer, and T. Popovic. 2002. Sequence diversity of Neisseria meningitidis 16S rRNA genes and use of 16S rRNA gene sequencing as a molecular subtyping tool. J. Clin. Microbiol. 40:4520-4527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Schurig, G. G., N. Sriranganathan, and M. J. Corbel. 2002. Brucellosis vaccines: past, present and future. Vet. Microbiol. 90:479-496. [DOI] [PubMed] [Google Scholar]
  • 38.Trout, D., T. M. Gomez, B. P. Bernard, C. A. Mueller, C. G. Smith, L. Hunter, and M. Kiefer. 1995. Outbreak of brucellosis at a United States pork packing plant. J. Occup. Environ. Med. 37:697-703. [DOI] [PubMed] [Google Scholar]
  • 39.Velasco, J., C. Romero, I. Lopez-Goni, J. Leiva, R. Diaz, and I. Moriyon. 1998. Evaluation of the relatedness of Brucella spp. and Ochrobactrum anthropi and description of Ochrobactrum intermedium sp. nov., a new species with a closer relationship to Brucella spp. Int. J. Syst. Bacteriol. 48:759-768. [DOI] [PubMed] [Google Scholar]
  • 40.Verger, J. M., M. Grayon, A. Cloeckaert, M. Lefevre, E. Ageron, and F. Grimont. 2000. Classification of Brucella strains isolated from marine mammals using DNA-DNA hybridization and ribotyping. Res. Microbiol. 151:797-799. [DOI] [PubMed] [Google Scholar]
  • 41.Vizcaino, N., A. Cloeckaert, J. Verger, M. Grayon, and L. Fernandez-Lago. 2000. DNA polymorphism in the genus Brucella. Microbes Infect. 2:1089-1100. [DOI] [PubMed] [Google Scholar]
  • 42.Weyant, R. S., C. W. Moss, R. E. Weaver, D. G. Hollis, J. G. Jordan, E. C. Cook, and M. I. Daneshvar. 1995. Identification of unusual pathogenic gram-negative aerobic and facultatively anaerobic bacteria, 2nd ed. Williams & Wilkins, Baltimore, Md.
  • 43.Yagupsky, P. 1999. Detection of Brucellae in blood cultures. J. Clin. Microbiol. 37:3437-3442. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES