Abstract
Ninety-six primer sets were used for amplified fragment length polymorphism (AFLP) to characterize the genomes of 20 Mycobacterium avium subsp. paratuberculosis field isolates, 1 American Type Culture Collection (ATCC) M. avium subsp. paratuberculosis isolate (ATCC 19698), and 2 M. avium subsp. avium isolates (ATCC 35716 and Mac 104). AFLP analysis revealed a high degree of genomic polymorphism among M. avium subsp. paratuberculosis isolates that may be used to establish diagnostic patterns useful for the epidemiological tracking of M. avium subsp. paratuberculosis isolates. Four M. avium subsp. paratuberculosis-polymorphic regions revealed by AFLP were cloned and sequenced. Primers were generated internal to these regions for use in PCR analysis and applied to the M. avium subsp. paratuberculosis field isolates. An appropriate PCR product was obtained in 79 of 80 reactions, while the M. avium subsp. avium isolates failed to act as templates for PCR amplification in seven of eight reactions. This work revealed the presence of extensive polymorphisms in the genomes of M. avium subsp. paratuberculosis and M. avium subsp. avium, many of which are based on deletions. Of the M. avium subsp. paratuberculosis-specific sequences studied, one revealed a 5,145-bp region with no homologue in the M. avium subsp. avium genome. Within this region are genes responsible for integrase-recombinase function. Three additional M. avium subsp. paratuberculosis-polymorphic regions were cloned, revealing a number of housekeeping genes; all were evaluated for their diagnostic and epidemiological value.
Mycobacterium avium subsp. paratuberculosis, a gram-positive, acid-fast bacillus, is the etiologic agent of the severe gastroenteritis in ruminants known as Johne's disease (1, 3, 4, 9). This debilitating disease can affect all domestic animals and causes an estimated annual agricultural loss of $1.5 billion to the cattle industry in the United States alone (3). Although this estimate may seem high, actual losses are suspected to be far greater because of the lack of accurate estimation of herd profit levels. M. avium subsp. paratuberculosis is estimated to be prevalent in 35% of U.S. dairy herds (1). Although Johne's disease primarily affects cattle, M. avium subsp. paratuberculosis infects other ruminants, including bison, and is suspected in human infections leading to Crohn's disease (1, 3, 4). However, inconsistent detection of M. avium subsp. paratuberculosis in specimens obtained from Crohn's disease patients has cast doubt on any direct link (3).
The primary route of infection of M. avium subsp. paratuberculosis is fecal-oral transmission from an infected food source. Individuals acquire the bacteria by consuming contaminated food products or food products that have come in contact with contaminated areas. Once ingested, the bacterium travels to the mucosa-associated lymphoid tissue of the small intestine, where it is endocytosed by M cells of the Peyer's patches. Endocytosis by M cells subsequently leads to phagocytosis by intraepithelial macrophages (3). Interaction with or replication within macrophages leads to an inflammatory immune response and clinical signs of disease, including a corrugated epithelium of the intestine which, as the disease progresses, results in malabsorption and chronic wasting, the clinical signs of Johne's disease.
In this study we conducted amplified fragment length polymorphism (AFLP) analysis of 20 M. avium subsp. paratuberculosis field isolates and compared the results to those of AFLP analysis of M. avium subsp. avium isolates in an effort to identify polymorphic regions present in either of these subspecies. Because of the ability of AFLP analysis to detect single nucleotide polymorphisms in addition to insertions-deletions of the bacterial genomes, the nature and extent of identified polymorphisms were further evaluated. At least one of the polymorphisms identified is due to a large genomic region present in M. avium subsp. paratuberculosis and absent from M. avium subsp. avium. With data on four such deletions PCR primer sets were devised that may be used in combination with IS900 as a diagnostic or epidemiologic tool for M. avium subsp. paratuberculosis. When applied to field isolates, to ATCC standard strains, and to a standard test set of 25 organisms supplied by the National Veterinary Services Laboratory (NVSL), Ames, Iowa, PCR assay of these polymorphic regions reveals extensive genetic variation. In contrast to the results reported by Kapur et al. (1, 2), this study shows that genomic differences between M. avium subsp. paratuberculosis and M. avium subsp. avium are not consistent throughout the genomes of M. avium subsp. paratuberculosis field isolates. Genetic variation at the subspecies level revealed by AFLP and PCR is common and may have great value in diagnostic and epidemiologic studies. The distinction between M. avium subspecies is much less clear than previously believed.
MATERIALS AND METHODS
Mycobacterial isolates.
Twenty different M. avium subsp. paratuberculosis clinical isolates (109, 126, 129, 130, 132, 135, 136, 139, 140, 141, 142, 144, 145, 148, 150, 151, 153, 155, 156, and 160) were obtained from the University of Wisconsin Veterinary Diagnostic Laboratory (UWDL). One M. avium subsp. avium clinical human isolate (Mac 104) was obtained from Raul Barletta at the University of Nebraska. Two strains were obtained from American Type Culture Collection (ATCC) and used in this study: M. avium subsp. avium ATCC 35716 and M. avium subsp. paratuberculosis ATCC 19698. A set of 25 coded fecal samples in the form of a blind fecal test set (consisting of high, moderate, and low shedders and negative feces) was generously provided by Janet Peyeur at the NVSL (see Table 3).
TABLE 3.
Results of PCR assays of NVSL isolates obtained with diagnostic primer sets
| Isolate | Type of isolatea | Sheddingb | Result obtained with internal primer setc based on:
|
|||
|---|---|---|---|---|---|---|
| Region 1 | Region 2 | Region 3 | Region 4 | |||
| 1 | MparaTb | H | + | + | + | + |
| 2 | N | N | − | − | − | − |
| 3 | MparaTb | L | + | + | − | + |
| 4 | MparaTb | M | + | + | + | − |
| 5 | MparaTb | H | + | + | + | + |
| 6 | N | N | − | − | − | − |
| 7 | MparaTb | M | + | − | − | − |
| 8 | MparaTb | L | + | + | + | + |
| 9 | MparaTb | L | + | − | − | − |
| 10 | MparaTb | H | + | + | + | + |
| 11 | N | N | − | − | − | − |
| 12 | Invalid | Invalid | + | − | − | − |
| 13 | Invalid | Invalid | − | − | − | − |
| 14 | MparaTb | L | + | + | + | − |
| 15 | MparaTb | H | − | − | − | − |
| 16 | N | N | − | − | − | − |
| 17 | MparaTb | L | + | + | + | − |
| 18 | MparaTb | L | + | + | + | + |
| 19 | MparaTb | H | + | + | + | − |
| 20 | MparaTb | H | + | − | − | − |
| 21 | N | N | − | − | − | − |
| 22 | MparaTb | M | + | − | + | − |
| 23 | N | N | − | − | − | − |
| 24 | MparaTb | H | − | − | + | − |
| 25 | MparaTb | H | + | + | + | + |
Results of the double-blind study as provided by NVSL.
NVSL isolates were either high (H), moderate (M), or low (L) shedders. Negative (N) samples and invalid samples are also shown.
A plus sign denotes the presence of a PCR product; a minus sign denotes the absence of a PCR product.
Identification of isolates to the species level.
All mycobacterial isolates were characterized by growth requirements, colony morphology, acid-fast staining, and IS900 PCR as previously described (6a). M. avium subsp. paratuberculosis colonies were evident by the 16th week of incubation at 37°C. All M. avium subsp. paratuberculosis and M. avium subsp. avium isolates were grown until sufficient growth was evident for DNA extraction. IS900 PCR analysis with primers P90 and P91 (see Table 1) coupled with restriction analysis was used to confirm the identity of M. avium subsp. paratuberculosis isolates as previously described (6a). M. avium subsp. avium isolates showed no amplification under these conditions.
TABLE 1.
Primers used in this study
| Primer type and name | Sequence (5′-3′) |
|---|---|
| Adapters | |
| PstI | GACTGCGTAGGTGCA |
| PstI | CCTACGCAGTCTACGAG |
| MseI | GACGATGAGTCCTGAG |
| MseI | TACTCAGGACTCAT |
| Internal | |
| region1F | CGCACCAAAAGGCACACTAATC |
| region1R | CGTCGTCACCATTCAGGAACTC |
| region2F | GGCTCGCCGAACTACTTGT |
| region2R | CTCGAAACAACGGTGACAGA |
| region3F | GCGGAAAGTCACACTGCTGATGC |
| region3R | CGGTCTATTCGATCCCCACCTTG |
| region4F | CGAGTTGTCCTGGGGTTTTGG |
| region4R | CGAAAGTCACCGCATCCACG |
| Primer walking | |
| PW6 | CGATCGGCTTTACACCAC |
| PW1106 | AGAAGCCGGCAACACTCGCC |
| PW952 | GCTTAGGAGGAGGTGGCTGATAATC |
| PW2485 | CCCCAACCCTGTTCGGTATG |
| PW2465 | GCATACCGAACAGGGTTGGG |
| PW3741 | GTGGCACTGGTGGACATTTTG |
| PW3706 | GTCCATCGCACACCTCAAAATG |
| PW5360 | CGCTCAGCATCATCGTGAAGTAG |
| Positive control | |
| F1-PC-190 | CAACCTCAAACCCGAATAC |
| B1-PC-190 | CTTGCTGATGGTGGTCTG |
| IS900 PCR | |
| P90 | GAAGGGTGTTCGGGGCCGTC |
| P91 | GAGGTCGATCGCCCACGTGAC |
Preparation of genomic DNA.
Genomic DNA was prepared as described by Khare et al. (unpublished), through a bead-beating method. For fecal sample processing, immunomagnetic separation of the organism was used in conjunction with this method.
AFLP analysis.
AFLP analysis was carried out on all 20 M. avium subsp. paratuberculosis field isolates, Mac 104 and both ATCC strains with all six PstI selective primers in conjunction with all 16 possible MseI selective primers for a total of 96 unique primer combinations and a total of 2,208 independent AFLP reactions. Generation of AFLP markers was carried out as described previously by Menz et al. (10), with the following modifications. Genomic DNA (500 ng) was digested with MseI (1.25 U/μg of DNA) for 2 h at 37°C in NE buffer 2 (New England Biolabs, Beverly, Mass.). After MseI digestion, the NaCl and Tris-HCl concentrations were increased to 50 and 40 μM, respectively, and the DNA was digested with PstI (1.25 U/μg of DNA; New England Biolabs) for 2 h at 37°C. MseI and PstI adapters (Table 1) were diluted to 5 and 0.5 μM, respectively, and ligated to restriction sites of the digested DNA by addition of 1 U of T4 DNA ligase (Roche) at 37°C overnight. The DNA was diluted to a final concentration of 1 ng/μl.
Preamplification of samples was performed with 5 ng of adapter-ligated template with the following primers: PstI preamp primer, 5′-GACTGCGTAGGTGCAG-3′; MseI preamp primer, 5′-ACGATGAGTCCTGAGTAA-3′. Preamplification reactions were carried out as described by Menz et al. (10).
Selective amplification was performed with two selective nucleotides on the 3′ end of the primers. The core sequences of the selective primers are 5′-GACTGCGTAGGTGCAG-3′ (PstI) and 5′-GATGAGTCCTGAGTAA-3′ (MseI). PstI selective primers include the core sequence followed by 3′ selective dinucleotides and are termed P-GC, P-GT, P-GA, P-CA, P-CG, and P-CT, respectively. MseI selective primers used the MseI core sequence with all 16 possible dinucleotide combinations on their 3′ ends. These primers are termed M-AA thru M-TT according to the selective dinucleotides at their 3′ ends. IRDye-labeled PstI selective primers were obtained from LI-COR (Lincoln, Nebr.); additional methods used in the selective amplification process have been previously reported (7).
Isolation and sequence analysis of unique M. avium subsp. paratuberculosis bands.
Selective amplification of samples was performed under the conditions described above (PstI selective primers were not labeled). The amplified samples were then electrophoresed on 2% (wt/vol) Metaphor LE agarose gel for 1.5 h at 100 V and stained with ethidium bromide to visualize them. Bands corresponding to the molecular weights observed on the AFLP gels were extracted and purified with a QIAquick gel extraction kit (QIAGEN, Valencia, Calif.). DNA fragments were plasmid ligated and transformed into Top10 Escherichia coli cells with PCR2.1-TOPO (Invitrogen, Carlsbad, Calif.) as described by the manufacturer. Transformants were identified by PCR with primers (M13+10 forward and M13 reverse) flanking the plasmid multiple cloning site, as recommended by the manufacturer (QIAGEN). Plasmids yielding amplification products of the predicted size were collected with the QIAprep Spin Miniprep kit and subjected to sequence analysis at the Genome Technologies Laboratory at Texas A&M University.
BLAST queries and diagnostic primers.
Sequence data was used as a query line in BLAST searches of existing genomes. If the BLAST search results revealed sequence homology to M. avium subsp. paratuberculosis and not to M. avium subsp. avium or (since the genomes have not yet been fully sequenced) if there is no homology to either the M. avium subsp. paratuberculosis or the M. avium subsp. avium genome, internal primer sets were then designed on the basis of the internal sequences of these polymorphic regions. Internal PCR primer sets (Table 1) were determined with MacVector and designed to have a GC content reflecting that of the M. avium subsp. paratuberculosis genome. These primers were used for PCR amplification of genomic DNA to verify the presence or absence of these polymorphic regions.
PCR analysis with internal primers.
PCR amplification of all 20 M. avium subsp. paratuberculosis isolates, ATCC 19698, Mac 104, ATCC 35716, and the NVSL test set was performed with internal primers. Except for the NVSL test set (performed with purified DNA), all PCR assays were performed with template genomic DNA on Whatman FTA membranes (Whatman Inc., Clifton, N.J.). Genomic DNA for PCR was prepared on FTA cards in accordance with the manufacturer's protocols and used directly in PCRs as template DNA. PCR was optimized with Epicenter's Fail Safe PCR kit (Epicenter Technologies, Madison, Wis.) in accordance with the manufacturer's protocols with all four internal primer sets on M. avium subsp. paratuberculosis ATCC 19698. Premix G exhibited optimal product formation for all four primer sets. PCR was carried out by heating treated and washed FTA card punches with 7.1 μl of double-distilled H2O for 5 min at 94°C and then adding 12.9 μl of master mix containing 20 pmol of each primer, 10 μl of premix G, and 1 U of Taq DNA polymerase. Amplification was performed at 94°C for 30 s, 60°C for 30 s, 72°C for 1 min for 45 cycles, followed by a final elongation at 72°C for 5 min. Samples were analyzed on a 2% (wt/vol) LE agarose gel with ethidium bromide staining. The same internal primers were also used to characterize the IS900-positive samples in a double-blind study of 25 coded fecal samples containing M. avium subsp. paratuberculosis isolates (Johne's disease fecal check test evaluation—2001).
Primer pairs for a primer walk PCR (Table 1) across a 5,145-bp region of M. avium subsp. paratuberculosis were designed with the MacVector sequence analysis program. Primer walk PCR products were amplified at 94°C for 30 s, 56°C for 30 s, 72°C for 1 min 20 s through 40 cycles and a final elongation of 5 min at 72°C. PCRs used 4 ng of genomic template DNA and 30 ng of each primer in a final volume of 20 μl in accordance with the manufacturer's (Promega) instructions. Samples were analyzed on 1.5% (wt/vol) Metaphor ME agarose.
RESULTS
Identification of polymorphic M. avium subsp. paratuberculosis sequences by AFLP analysis.
AFLP analysis revealed four regions that were present in the majority of M. avium subsp. paratuberculosis isolates and undetected in the M. avium subsp. avium genome. These regions have the following corresponding AFLP primer combinations: region 1, P-GC and M-CT (300-bp band; Fig. 1, panel 2); region 2, P-GC and M-CT (440-bp band; Fig. 1, panel 2); region 3, P-CT and M-TC (255-bp band; Fig. 1, panel 5); region 4, P-CG and M-TT (600-bp band; Fig. 1, panel 8). The criteria that warranted further investigation of a region of the AFLP gels were the appearance of the band in a majority of the 20 clinical M. avium subsp. paratuberculosis isolates and the M. avium subsp. paratuberculosis ATCC 19698 isolate and absence or reduction in band intensity in the two M. avium subsp. avium isolates. Although putative M. avium subsp. paratuberculosis-specific bands can be seen on some of the polyacrylamide gels down to 50 bp, only bands greater than 200 bp were investigated further. Analysis of the 20 M. avium subsp. paratuberculosis isolates by AFLP revealed a consistent banding pattern in as many as eight repetitions, and an apparent heterogeneity was revealed at the subspecies level among these 20 M. avium subsp. paratuberculosis field isolates. Furthermore, at least 11 genotypes are evident by obvious differences in the banding patterns of the 20 isolates.
FIG. 1.
AFLP gel showing regions 1 to 4 and polymorphism between isolates. Panels: 1, 4, 7, and 12, molecular weight markers; 2, M. avium subsp. paratuberculosis field isolates 109 to 160 (left to right), respectively, amplified with AFLP primers P-GC and M-CT showing regions 1 (300 bp) and 2 (440 bp); 3, M. avium subsp. avium isolates ATCC 35716 and Mac 104, respectively, amplified with AFLP primers P-GC and M-CT; 5, M. avium subsp. paratuberculosis field isolates 109 to 160 (left to right), respectively, amplified with AFLP primers P-CT and M-TC showing region 3 (255 bp); 6, M. avium subsp. avium isolates ATCC 35716 and Mac 104, respectively, amplified with AFLP primers P-CT and M-TC; 8, M. avium subsp. paratuberculosis field isolates 109 to 160 (left to right), respectively, amplified with AFLP primers P-CG and M-TT showing region 4 (600 bp); 9, M. avium subsp. avium isolates ATCC 35716 and Mac 104, respectively, amplified with AFLP primers P-CG and M-TT; 10, M. avium subsp. paratuberculosis field isolates 109 to 160 (left to right), respectively, amplified with AFLP primers P-GC and M-TT showing a high degree of heterogeneity among isolates; 11, M. avium subsp. avium isolates ATCC 35716 and Mac 104, respectively, amplified with AFLP primers P-GC and M-TT.
Identification of M. avium subsp. paratuberculosis-polymorphic sequences.
Preparative amplifications of regions 1 to 4 were performed with the appropriate AFLP primer sets, and corresponding DNA fragments were cloned and sequenced as described in Materials and Methods. Sequence data were used as a query in BLAST nucleotide searches of both the M. avium subsp. paratuberculosis and M. avium subsp. avium genomes. The four M. avium subsp. paratuberculosis-polymorphic regions identified through the AFLP analysis described above (regions 1 to 4) correspond to contigs 161, 210, 185, and 178 of the M. avium subsp. paratuberculosis genome, respectively. None of the regions showed any significant similarity to the M. avium subsp. avium genome. These sequences were also used as a query in a BLAST amino acid search (blastx) of the National Center for Biotechnology Information (NCBI) database. Region 1 retrieved no significant similarity to any known protein in the NCBI database. We have referred to this region as unidentified region 1. Region 2 displayed amino acid sequence homology to primosomal protein N′ (PPN′) of Brucella melitensis (E value = 0.033). Region 3 displayed amino acid sequence homology to the P44k protein of Rhodococcus erythropolis (E value = 5 × 10−16). The final region described above, region 4, displayed amino acid sequence homology to the putative Streptomyces polyketide type 1 synthase (PPKS) (E value = 0.043).
PCR with internal primers derived from polymorphic M. avium subsp. paratuberculosis genomic regions.
Internal primer sets were investigated for the purpose of validating their use in conjunction with the IS900 PCR assay in identifying and tracking M. avium subspecies isolates. This PCR assay, when combined with magnetic bead isolation (6a), would provide a powerful tool for rapid analysis. Confirmation of polymorphic regions in M. avium subsp. paratuberculosis genomes was carried out through PCR analysis with primers derived from sequence data internal to these four regions. Field isolate 153 was not used in this part of the study because of loss of culture. All of the internal primers are listed in Table 1, and the PCR assay results are shown in Table 2. The primer sets for regions 1 to 3 amplified their respective products in 19 of 19 M. avium subsp. paratuberculosis field isolates and M. avium subsp. paratuberculosis strain ATCC 19698. The region 4 primer set (region4F and region4R) amplified its respective product from 18 of 19 clinical isolates and from the M. avium subsp. paratuberculosis ATCC 19698 isolate. Amplification of regions 1 to 3 was negative for both of the M. avium subsp. avium isolates reported here. The region 4 primer set showed amplification from M. avium subsp. avium ATCC 35716, while Mac 104 was negative, leading us to conclude that region 4 is not M. avium subsp. paratuberculosis specific. These primer sets correctly identified all of the isolates as M. avium subsp. paratuberculosis or M. avium subsp. avium, in agreement with the IS900 analysis, with the exception of the Mac 104 isolate.
TABLE 2.
Results of PCR assays of all isolates with internal primer sets
| Isolate | Sourcea | Result obtained with diagnostic primer setb based on:
|
|||
|---|---|---|---|---|---|
| Region 1 | Region 2 | Region 3 | Region 4 | ||
| 109 | W | + | + | + | + |
| 126 | W | + | + | + | + |
| 129 | W | + | + | + | + |
| 130 | W | + | + | + | + |
| 132 | W | + | + | + | − |
| 135 | W | + | + | + | + |
| 136 | W | + | + | + | + |
| 139 | W | + | + | + | + |
| 140 | W | + | + | + | + |
| 141 | W | + | + | + | + |
| 142 | W | + | + | + | + |
| 144 | W | + | + | + | + |
| 145 | W | + | + | + | + |
| 148 | W | + | + | + | + |
| 150 | W | + | + | + | + |
| 151 | W | + | + | + | + |
| 155 | W | + | + | + | + |
| 156 | W | + | + | + | + |
| 160 | W | + | + | + | + |
| ATCC 35716 | A | − | − | − | + |
| Mac 104 | N | − | − | − | − |
| ATCC 19698 | A | + | + | + | + |
Isolate source: W, UWDL; N: University of Nebraska Barletta Laboratory; A, ATCC.
Outcome of PCR with primers derived from sequences of unique bands present on AFLP gels: +, presence of a PCR product; −, absence of a PCR product.
Positive control primers F1-PC-190 and B1-PC-190 (Table 1) were designed to amplify a 190-bp region that is retained in both the M. avium subsp. avium and M. avium subsp. paratuberculosis genomes. PCR amplification of this region from both M. avium subsp. avium isolates was used to confirm the presence of genomic DNA and serve as a positive control.
PCR analysis of NVSL isolates with internal primers.
Because of previous PCR results suggesting genomic heterogeneity at region 4 among M. avium subsp. paratuberculosis isolates obtained from the UWDL, PCR analysis was performed with a standard test set of isolates obtained from the NVSL with the M. avium subsp. paratuberculosis-internal primer sets derived through AFLP analysis (Table 1). These M. avium subsp. paratuberculosis isolates were obtained for the purpose of conducting a double-blind diagnostic study for the detection of M. avium subsp. paratuberculosis in stool samples via PCR amplification of the IS900 insertion sequence. A portion of this DNA was used in our research to further evaluate our internal primers. PCR analysis of these 25 isolates was optimized and performed with each of the internal primer sets (regions 1 to 4). Seventeen of the 25 NVSL isolates used in this study were identified as M. avium subsp. paratuberculosis by IS900 analysis (6a), which was later confirmed by the NVSL. Six of the 25 isolates were confirmed M. avium subsp. paratuberculosis negative, and 2 were considered to be invalid by NVSL in the double-blind study because of inconsistencies in the results from the participating laboratories. The NVSL considered an isolate to be invalid if there was a less than 70% consensus of the participating laboratories (Table 3). PCR amplification with the internal primer sets for regions 1 to 4 designed in this study were performed on these 25 NVSL isolates. The region 1 primer set amplified its corresponding region in 15 of 17 M. avium subsp. paratuberculosis isolates and one of the invalid samples. The region 2 primer set amplified its corresponding region in 11 of the 17 M. avium subsp. paratuberculosis isolates. The region 3 primer set amplified its corresponding region in 12 of the 17 M. avium subsp. paratuberculosis isolates. The region 4 primer set amplified its corresponding region in only 7 of the 17 M. avium subsp. paratuberculosis isolates. One of the 17 M. avium subsp. paratuberculosis isolates (no. 15) showed no amplification with any primer set, and none of the M. avium subsp. paratuberculosis internal primer sets described here produced amplification products from the negative samples. This suggests that there is a high degree of genomic heterogeneity among these 17 M. avium subsp. paratuberculosis isolates. All of the NVSL PCR results can be seen in Table 3.
Characterization of a 5-kb deletion in M. avium subsp. avium corresponding to M. avium subsp. paratuberculosis region 2.
Entire M. avium subsp. paratuberculosis contigs including portions homologous to the M. avium subsp. paratuberculosis-polymorphic sequenced regions (regions 1 to 4) were examined by BLAST searching to determine sequence homology to the M. avium subsp. avium genome. M. avium subsp. paratuberculosis-specific region 2 originates from a 31.6-kb contig that was used as a query in a BLAST search against M. avium subsp. avium. The results of this BLAST search revealed numerous M. avium subsp. avium contigs with 99% homology to the query sequence. When these M. avium subsp. avium contigs were aligned with overlapping sequences of the contigs, a 5,145-bp region of M. avium subsp. paratuberculosis was revealed that has no homologue in the M. avium subsp. avium genome. In order to determine the extent of this deletion, a primer walk was performed over region 2 and its flanking sequences. Primer pairs PW6-PW1106, PW952-PW2485, PW2465-PW3741, and PW3706-PW5360 (Table 1) amplify PCR products spanning the 5.1-kb deletion of 1,101, 1,534, 1,277, and 1,655 bp, respectively. These primer combinations were designed so that their PCR products overlap to avoid missing any smaller deletions. PCR amplification was performed with DNA from M. avium subsp. paratuberculosis (ATCC 19698) and M. avium subsp. avium (ATCC 35716) isolates. All primer pairs produced the expected products from the M. avium subsp. paratuberculosis isolate (Fig. 2A, lanes 2 to 5). However, no products were identified from M. avium subsp. avium spanning an approximately 5,200-bp region (Fig. 2B, lanes 2 to 5). Amplification of the region conserved in both the M. avium subsp. avium and M. avium subsp. paratuberculosis genomic databases with primers F1-PC-190 and B1-PC-190 produced the expected 190-bp product, validating the presence of DNA from the M. avium subsp. avium genome (Fig. 2B, lane 6) in the PCR analysis. These results confirm that region 2 is part of a much larger genomic deletion in M. avium subsp. avium. This region contains several unidentified open reading frames; one near the 3′ end of the 5.1-kb region exhibits sequence homology to bacterial genes responsible for integrase-recombinase function (E value = 4 × 10−17). The integrase-recombinase gene we have identified is contained in contig 210 of the M. avium subsp. paratuberculosis genome and is distinct from that referred to by Bannantine et al. (1). The extent of deletions corresponding to regions 1, 3, and 4 is currently under investigation.
FIG. 2.
Primer walk across 5,145-bp deleted region. (A) Primer walk PCR across ∼5-kb region in M. avium subsp. paratuberculosis isolate ATCC 19698. Lanes: 1, 100-bp molecular weight marker; 2, 1,101-bp product obtained with primers PW6 and PW1106; 3, 1,534-bp product obtained with primers PW952 and PW2485; 4, 1,277-bp product obtained with primers PW2465 and PW3741; 4, 1,655-bp product obtained with primers PW3706 and PW5360. (B) Primer walk across M. avium subsp. avium isolate ATCC 35716. Lanes: 1, 1-kb molecular weight marker; 2, PCR with primers PW6 and PW1106 showing no product; 3, PCR with primers PW952 and PW2485 showing no product; 4, PCR with primers PW2465 and PW3741 showing no product; 5, PCR with primers PW3706 and PW5360 showing no product; 6, PCR with primers F1-PC-190 and B1-PC-190 showing the corresponding 190-bp product used as a positive control.
DISCUSSION
AFLP has proven to be a very powerful tool for the analysis of M. avium genomes from a variety of sources. While others have suggested that the species is monomorphic, the AFLP data shown here have clearly identified extensive polymorphisms. Extensive AFLP analysis of samples from the UWDL and ATCC strains illustrates a degree of polymorphism uncharacteristic of monomorphic species such as Bacillus anthracis (5, 6). Several of these observed polymorphisms were verified through cloning, sequence analysis, and PCR. Polymorphism is especially evident in clinical isolates (Fig. 1, panel 10), and at least 11 genotypes may be detected among these 20 isolates. To ensure reproducibility, AFLP patterns of clinical isolates were verified through duplication of AFLP analysis as many as eight times on single isolates. It is also evident even from PCR analysis that there is heterogeneity among the standard set of NVSL test isolates (Table 3). While the UWDL isolates were relatively homogeneous with respect to PCR of the four regions we examined, the more diverse NVSL test set was polymorphic. These data suggest that the source of the isolate may be a factor in the presence or absence of these four polymorphic regions. Because of the lack of history of all of the isolates used in this study this could not be investigated further. Approaches used by Kapur and others have suggested a more restricted genomic variation among isolates when using PCR directed against specific sequences mined from the NCBI database (1, 2). These sequences were selected on the basis of the sequence of the single M. avium subsp. paratuberculosis genome and the single M. avium subsp. avium genome used to construct the sequence databases. Our analysis of clinical isolates suggests strongly that the complement of organisms in the environment is richer and the genomes are more plastic than that represented by the NCBI database sequences. The analysis presented here complements the PCR diagnostic work of others and reveals the ability to detect and use polymorphic regions for epidemiology, as well as diagnostics. In all cases, IS900 PCR forms the basis for the diagnosis of M. avium subsp. paratuberculosis while the four primer sets are currently most useful for epidemiological analysis. Given the limited number of M. avium subsp. avium isolates used in this study, it is not possible for us to draw the conclusion that these four polymorphic regions are M. avium subsp. paratuberculosis specific. Future studies with these four AFLP-derived primer sets in conjunction with additional M. avium subsp. avium and other mycobacterium isolates will give a more definitive conclusion regarding the role of these regions in diagnostic tests.
Initially this study was directed to commonalities among the M. avium subsp. paratuberculosis isolates and to the isolation of a DNA sequence that could be used in conjunction with IS900 for diagnostics and epidemiology. As the study progressed a large degree of heterogeneity among field isolates was revealed by AFLP analysis. As the analysis continued, even the PCR primer sets designed to be M. avium subsp. paratuberculosis specific detected polymorphism to a limited extent within the UWDL isolates and to a much greater extent in the NVSL test set. When applying the PCR tools described here in combination with magnetic bead isolation techniques, it has been possible to isolate, identify, and fingerprint individual field isolates in a very short time (less than 72 h). When AFLP is required to track clinical isolates, culture will still be required. The goal is to identify enough PCR primer sets to allow multiplex identification and to enable isolate tracking and identification with a 72-h turnaround time. Compared with the weeks required for culture diagnostics, this would enable a highly improved herd management strategy and a reduction in the spread of this chronic and insidious pathogen.
Scrutiny of these M. avium subsp. paratuberculosis polymorphic regions revealed putative functions relating to housekeeping genes such as those that encode integrase-recombinase, PPN′, P44k, and PPKS. Although the functions of these genes range from the integration and recombination of genomic DNA (integrase-recombinase) (12) to priming of lagging-strand DNA during replication (PPN′) (14), cobalt binding (P44k), and the synthesis of polyketides with any number of biochemical uses (PPKS) (8, 11, 13), no genes with sequence homology to these regions have been identified within the M. avium subsp. avium genome. When examining the M. avium subsp. avium genome for genes of similar function, we found that a gene with 85% amino acid homology to an integrase-recombinase of M. bovis (E = 10−140) exists elsewhere within the genome. Whether or not this sequence represents the presence of a recombinase that can carry out the functions of the recombinase located within the M. avium subsp. paratuberculosis genome is unknown. No significant amino acid homology exists for the products of the other genes (those for PPN′, P44k, and PPKS); a search of the M. avium subsp. avium annotated sequence likewise does not reveal any obvious candidates to fulfill these functions. Any possible contribution of these regions to the virulence and pathogenesis of M. avium subsp. paratuberculosis remains to be determined.
Acknowledgments
This work was supported by USDA CSREES grant no. 2002-35204-12634 to A.R.-F.
REFERENCES
- 1.Bannantine, J. P., E. Baechler, Q. Zhang, L. Li, and V. Kapur. 2002. Genome scale comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium reveals potential diagnostic sequences. J. Clin. Microbiol. 40:1303-1310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Bannantine, J. P., Q. Zhang, L. Li, and V. Kapur. 2003. Genomic homogeneity between Mycobacterium avium subsp. avium and Mycobacterium avium subsp. paratuberculosis belies their divergent growth rates. BMC Microbiol. 3:1-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Harris, N. B., and R. G. Barletta. 2001. Mycobacterium avium subsp. paratuberculosis in veterinary medicine. Clin. Microbiol. Rev. 14:489-512. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Harris, N. B., Z. Feng, X. Liu, S. L. Cirillo, J. D. Cirillo, and R. G. Barletta. 1999. Development of a transposon mutagenesis system for Mycobacterium avium subsp. paratuberculosis. FEMS Microbiol. Lett. 175:21-26. [DOI] [PubMed] [Google Scholar]
- 5.Jackson, P. J., K. K. Hill, M. T. Laker, L. O. Ticknor, and P. Keim. 1999. Genetic comparison of Bacillus anthracis and its close relatives using amplified fragment length polymorphism and polymerase chain reaction analysis. J. Appl. Microbiol. 87:263-269. [DOI] [PubMed] [Google Scholar]
- 6.Keim, P., A. Kalif, J. Schupp, K. Hill, S. E. Travis, K. Richmond, D. M. Adair, M. Hugh-Jones, C. R. Kuske, and P. Jackson. 1997. Molecular evolution and diversity in Bacillus anthracis as detected by amplified fragment length polymorphism markers. J. Bacteriol. 179:818-824. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6a.Khare, S., T. A. Ficht, R. Santos, J. Romano, A. Ficht, S. Zhang, I. Grant, M. Libal, D. Hunter, and L. E. Adams. 2004. Rapid and sensitive detection of Mycobacterium avium subsp. paratuberculosis in bovine milk and feces by a combination of immunomagnetic bead separation-conventional PCR and real-time PCR. J. Clin. Microbiol. 42:1075-1081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Klein, P. E., R. R. Klein, S. W. Cartinhour, P. E. Ulanch, J. Dong, J. A. Obert, D. T. Morishige, S. D. Schlueter, K. L. Childs, M. Ale, and J. E. Mullet. 2000. A high-throughput AFLP-based method for constructing integrated genetic and physical maps: progress toward a sorghum genome map. Genome Res. 10:789-807. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Langfelder, K., B. Jahn, H. Gehringer, A. Schmidt, G. Wanner, and A. A. Brakhage. 1998. Identification of a polyketide synthase gene (pksP) of Aspergillus fumigatus involved in conidial pigment biosynthesis and virulence. Med. Microbiol. Immunol. 187:79-89. [DOI] [PubMed] [Google Scholar]
- 9.Marsh, I. B., and R. J. Whittington. 2001. Progress towards a rapid polymerase chain reaction diagnostic test for the identification of Mycobacterium avium subsp. paratuberculosis in faeces. Mol. Cell. Probes 15:105-118. [DOI] [PubMed] [Google Scholar]
- 10.Menz, M. A., R. R. Klein, J. E. Mullet, J. A. Obert, N. C. Unruh, and P. E. Klein. 2002. A high-density genetic map of Sorghum bicolor (L.) Moench based on 2926 AFLP, RFLP and SSR markers. Plant Mol. Biol. 48:483-499. [DOI] [PubMed] [Google Scholar]
- 11.Proctor, R. H., A. E. Desjardins, R. D. Plattner, and T. M. Hohn. 1999. A polyketide synthase gene required for biosynthesis of fumonisin mycotoxins in Gibberella fujikuroi mating population. Fungal Genet. Biol. 27:100-112. [DOI] [PubMed] [Google Scholar]
- 12.Smith, S. G., and C. J. Dorman. 1999. Functional analysis of the FimE integrase of Escherichia coli K-12: isolation of mutant derivatives with altered DNA inversion preferences. Mol. Microbiol. 34:965-979. [DOI] [PubMed] [Google Scholar]
- 13.Tsai, H. F., Y. C. Chang, R. G. Washburn, M. H. Wheeler, and K. J. Kwon-Chung. 1998. The developmentally regulated alb1 gene of Aspergillus fumigatus: its role in modulation of conidial morphology and virulence. J. Bacteriol. 180:3031-3038. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Zavitz, K. H., and K. J. Marians. 1992. ATPase-deficient mutants of the Escherichia coli DNA replication protein PriA are capable of catalyzing the assembly of active primosomes. J. Biol. Chem. 267:6933-6940. [PubMed] [Google Scholar]