Role of reactive oxygen species produced by NADPH oxidase in gibberellin biosynthesis during barley seed germination

ABSTRACT

NADPH oxidase catalyzes the production of the superoxide anion (O₂⁻), a reactive oxygen species (ROS), and regulates the germination of barley (Hordeum vulgare L.). Diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor, delayed barley germination, and exogenous H₂O₂ (an ROS) partially rescued it. Six enzymes, ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase (GA20ox) and GA3-oxidase (GA3ox), catalyze the transformation of trans-geranylgeranyl diphosphate to active gibberellin, which promotes germination. Exogenous H₂O₂ promoted the expressions of HvKAO1 and HvGA3ox1 in barley embryos. These results suggest that ROS produced by NADPH oxidase are involved in gibberellin biosynthesis through the regulation of HvKAO1 and HvGA3ox1.

Introduction

Reactive oxygen species (ROS) act as signal molecules in plants, regulating growth and development, programmed cell death, hormone signaling, and responses to biotic and abiotic stresses.^1–4 ROS play a key role in seed dormancy, after-ripening, and germination.^5,6 Excess accumulation of ROS in seed causes oxidative damage, which reduces germination ability, but insufficiency suppresses germination. The ideal range of ROS levels is described as the “oxidative window” for germination.⁷ Plasma membrane NADPH oxidase is a critical enzyme involved in ROS generation. We revealed that the H₂O₂ produced by NADPH oxidase regulates germination of barley through the regulation of gibberellin (GA) and abscisic acid contents.^8,9

Here, we focused on the relationship between ROS and GA biosynthesis enzymes. Six enzymes catalyze GA biosynthesis from trans-geranylgeranyl diphosphate: ent-copalyl diphosphate synthase (CPS), ent-kaurene synthase (KS), ent-kaurene oxidase (KO), ent-kaurenoic acid oxidase (KAO), GA20-oxidase, (GA20ox) and GA3-oxidase (GA3ox).^10,11 To determine which of these are regulated by NADPH oxidase-derived ROS, we investigated their response to the ROS by using quantitative RT-PCR analysis.

Results and discussion

The germination rate of barley seeds soaked in distilled water reached 47% after 18 h and 96% within 5 d (Fig. 1). To reveal the effect of ROS, we treated some seeds with diphenyleneiodonium (DPI) chloride, an NADPH oxidase inhibitor. The germination rate of seeds treated with 1 mM DPI reached 14% after 18 h and 56% within 5 d. That of other seeds treated with 1 mM DPI + 100 mM H₂O₂, an ROS, reached 25% after 18 h and 75% within 5 d (Fig. 1). These results confirm that ROS produced by NADPH oxidase promotes barley seed germination.⁸

Figure 1.

Germination rates of barley seeds treated with distilled water (control), 1 mM diphenyleneiodonium (DPI), or 1 mM DPI + 100 mM H₂O₂. Values labeled with the same letter do not differ significantly (P < 0.01, Tukey's test). Values are means ± SD of 5 replications.

GA, a plant hormone, releases seed dormancy and promotes germination.¹² To study the relationship between ROS and GA, we examined the expression of GA biosynthesis genes in barley embryos by quantitative RT-PCR. We extracted total RNAs from embryos after 18-h imbibition, by which time germination rates differed significantly among treatments (P < 0.01; Fig. 1). Among the genes encoding the 6 enzymes that catalyze GA biosynthesis, the expressions of HvKAO1 and HvGA3ox1 in embryos treated with 1 mM DPI + 100 mM H₂O₂ was significantly higher than that in embryos treated with 1 mM DPI alone, and the transcript levels recovered to almost the same level as in the control (Fig. 2). These results suggest that HvKAO1 and HvGA3ox1 expressions are upregulated by ROS. The expression of HvKO1 was increased by DPI treatment and decreased by exogenous H₂O₂ treatment, the exact opposite expression profile to that of HvKAO1 and HvGA3ox1 (Fig. 2). In addition, it is interesting that HvKO1 expression increased by DPI treatment and decreased by exogenous H₂O₂ treatment, thus the expression profile of HvKO1 was precisely opposite as compared to HvKAO1 expression. In tobacco, the regulation of KO transcription is the target of GA negative feedback, and thus KO contributes to GA homeostasis.¹³ In barley, therefore, these results suggest that GA biosynthesis in seed is reduced by DPI treatment, supporting the notion that ROS activates GA biosynthesis in imbibed seed. Thus, ROS produced by NADPH oxidase promote GA biosynthesis in barley through promotion of HvKAO1 and HvGA3ox1 genes transcription, thereby accelerating germination.

Figure 2.

Expression of gibberellin synthesis genes in barley seeds treated with distilled water (control = 1.0), 1 mM diphenyleneiodonium (DPI), or 1 mM DPI + 100 mM H₂O₂ for 18 h. Values labeled with the same letter do not differ significantly (P < 0.05, Tukey's test). Values are means ± SD of 4 replications.

The growth of root hair in Arabidopsis thaliana are regulated by elevation of the concentration of cytoplasmic Ca²⁺ and the localized production of ROS by NADPH oxidase.^14–17 The production of O₂⁻ has been detected in the expansion zone of maize leaf blades, where DPI inhibited growth.¹⁸ In our results, the growth of seedlings after germination treated with 1 mM DPI did not recover in the presence of 100 mM H₂O₂ (Fig. 3). These results suggest that ROS produced by NADPH oxidase have different roles in seed germination and seedling growth.

Figure 3.

Growth of seedlings after germination treated with (A) distilled water (control), (B) 1 mM diphenyleneiodonium (DPI), or (C) 1 mM DPI + 100 mM H₂O₂ for 7 d. Scale bars are 10 mm. (D) Dry weight. (E) Shoot and root lengths. Values labeled with the same letter do not differ significantly (P < 0.01, Tukey's test). Values are means ± SD of 5 replications.

Materials and methods

Hordeum vulgare L. ‘Himalaya’ grown at Kyushu University was harvested on 5 June 2010. The grains were stored dry at 4°C until the experiment began. According to Ishibashi et al.,⁸ 20 seeds were placed on filter paper in a 9-cm Petri dish. Each dish received 6 mL of distilled water, 1 mM diphenyleneiodonium chloride (DPI, an NADPH oxidase inhibitor), and 1 mM DPI + 100 mM H₂O₂. The dishes were incubated in darkness at 22°C, and germinating seeds (with the radicle protruding through the seed coat) were counted daily for 5 d.

Total RNA was extracted from germinated embryos at 18 h by using the SDS/phenol/LiCl method. cDNA was synthesized and amplified as previously⁹ with the primer sequences shown in Table 1.

Table 1.

Nucleotide sequences of primers used for qantitative RT-PCR.

Gene	Accession number	Forward primer (5′–3′)	Reverse primer (5′–3′)
HvCPS1	AY551435	gaccgtattgagcattgtcagaag	ggaccaaacaaccaatccaacttg
HvKS1	AY551436	catgcaaggagctgttctggaaga	ggatcaaaggttcactgccgcttc
HvKO1	AY551434	cagctcaccagctacaagctagac	aaataaccaaggacaggcgaactc
HvKAO1	AY326277	ggatgatgatgatgaaaacggaga	cttgggcgccaatactattgatat
HvGA20ox1	AY551428	gctgcagtgcagggagtgagaaat	gcaaatcttgccatccatccatgc
HvGA3ox1	AY551430	tgactgacatctcctcatagatca	gataacaggtaactgaagcatgca
HvActin	AY145451	gccgtgctttccctctatg	gcttctccttgatgtccctta

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Funding

This work was supported by JSPS KAKENHI Grant Number 15K14639.