Role of Arabidopsis NHL family in ABA and stress response

ABSTRACT

Based on their sequence homology to Arabidopsis NDR1 and tobacco (Nicotiana tabacum) HIN1, 45 NHL (NDR1/HIN1-like) family genes are found in Arabidopsis genome. Recently, we reported that overexpression of NHL6, a member of NHL family, modulated seed germination under abiotic stresses through affecting ABA biosynthesis and signaling. We also carried out qPCR and investigated the expression of the other 8 member genes (NHL7a, 16, 17, 21, 25, 26, 41, 43) whose transcriptional data are publicly unavailable, and found that expression of NHL17 was induced more than 2 folds in ABA treated seedlings. Furthermore, in addition to the plasma membrane localization, YFP-NHL6 fusion protein was also observed in the cytosol (as dots) or on the membrane of small vacuoles or vesicles. As a member of the pathogen infection related genes, expression of NHL6 was significantly induced by salicylic acid and NHL6s are evolutionarily conserved among different plant species. A working model of NHL6 in ABA response was proposed.

Abbreviations

ABA

abscisic acid

SA

salicylic acid

NDR1

nonrace-specific disease resistance 1

HIN1

harpin-induced 1

NHL

NDR1/HIN1-like

LEA

late embryogenesis abundant

PYR/PYL

pyrabactin resistance/PYR like

RCAR

regulatory component of ABA receptors

qPCR

quantitative polymerase chain reaction

PR1

pathogenesis-related protein 1

SnRK2

SNF1-related protein kinase 2

PP2C

protein phosphatase 2C

ABRE

ABA-reponsive elements

AREB

ABRE-binding

ABF

ABRE-binding factor

NCED

9-cis-epoxycarotenoid dioxygenase

AAO

ABA aldehyde oxidase

During their whole life cycles, plants are threatened by different kinds of biotic or abiotic stresses. Transcriptional and post transcriptional regulations including gene expression and physiological dynamics are utilized to counteract these unfavorable environmental factors.^1-3 The importance of plant hormone abscisic acid (ABA) in stress response and seed germination has been broadly studied,^4-6 as advanced by the discovery of its receptors PYR/PRL or RCARs.^7,8 Recently, we showed that a conventional pathogen infection related NHL (NDR1/HIN1-like) family gene NHL6 modified Arabidopsis seed germination and early seedling growth under abiotic stress conditions, through altering ABA biosynthesis and sensitivity in transgenic plants.⁹ Interestingly, when we examined the transcriptional expression of the 45 NHL family genes in senescent leaves, a good tissue for mimicking dehydration, NHL6 was found to be the most highly expressed and induced by ABA at the same time. Characteristics of NHL6 in dehydration and ABA response convinced us to study further the function of NHL6, and its roles in ABA-mediated seed germination and early seedling growth.

Based on the data published by Goda and co-workers,¹⁰ 4 of the 45 Arabidopsis NHL genes, NHL1, NHL4, NHL6 and NHL39 were induced to more than 2 folds by ABA. However, no data are available for the rest 8 NHL genes: NHL7a, NHL16, NHL17, NHL21, NHL25, NHL26, NHL41 and NHL43 in regard to ABA induced response. To better and comprehensively understand their roles in response to ABA, qPCR was performed using 7-day-old seedlings.¹¹ NHL17 was found to be significantly induced by ABA (Table 1). Bioinformatic analyses indicated that a conserved LEA-14 like domain exists in most of the ABA-responsive NHL members,¹² with transmembrane domains of each protein except NHL29 (Table 1).^13,14 Furthermore, LEA proteins are closely correlated with land plants' ability to acquire dehydration tolerance.¹⁵ Our results as well as the published microarray data of NHL family genes will add more evidence of this family in ABA and abiotic stress responses.

Table 1.

Characteristics of selected NHL members and their ABA induced expression.

Locus	Name	ABAa	CDS (bp)	Length (aa)	MW (kD)	TMsb	Interproc
At1g54540	NHL4	14.26	720	239	26.38	1	LEA-14
At1g17550	NHL29	5.82	1536	511	56.06	0	PP2C-like
At1g65690	NHL6	3.61	759	252	28.57	1	LEA-14
AT3G11660	NHL1	2.72	630	209	23.66	1	LEA-14
At3g54200	NHL39	2.68	708	235	25.78	1	LEA-14
At3g44220	NHL17	2.5	621	206	23.25	1	LEA-14
At5g56050	NHL43	1.18	852	283	32.26	1	Low complexity
At5g36970	NHL25	1.18	747	248	27.96	1	LEA-14
At3g24600	NHL41	0.91	1251	506	55.18	3	LEA-14
At3g20610	NHL16	0.9	669	222	25.73	2	Low complexity
At5g53730	NHL26	0.51	642	213	23.91	1	LEA-14
At1g08140	NHL7a	0.16	2457	818	93.39	10	Cation/H+ exchanger
At4g05220	NHL21	0.07	681	226	26.04	1	LEA-14

Dates are acquired from TAIR. (a) Expression of NHL family genes in ABA treated seedlings by Goda et al., 2008. Rows in gray background were generated from our qPCR result. (b) Number of TMs (transmembrane domains) predicted by TMHMM. (c) Conserved domains in NHL proteins are predicted by Inetrpro (https://www.ebi.ac.uk/interpro/). Primers used for qPCR: NHL7a (forward: 5′-AGCTGCCTACACCCTCTTGA-3′; reverse: 5′-GGGAATCTTGTGATGGGCTA-3′);

NHL16 (forward: 5′-GACACGAGAAGAAGGCCAAG-3′; reverse: 5′-CCCATCCTCTTTGTCCTTGA-3′);

NHL17 (forward: 5′-ATCTTACCGCAACCAACAGG-3′; reverse: 5′-CACGTTCCCACTTTCCATCT-3′);

NHL21 (forward: 5′-CTAAACCCGTTTTTCCAGCA-3′; reverse: 5′-GATCAACCCGTCTCTTCCAA-3′);

NHL25 (forward: 5′-TCCGAGGGAGAAGAAAGGAT-3′; reverse: 5′-TTTCTCGTTGGGATTTTTCG-3′);

NHL26 (forward: 5′-GTTGCCCAGTCCTTTGGTTA-3′; reverse: 5′-TGTTCATTCCAAAAGCCACA-3′);

NHL41 (forward: 5′-TATGTATTGGCCGGAGAAGC-3′; reverse: 5′-AACGCTCTTAACGGAGACGA-3′);

NHL43 (forward: 5′-GAAACACCACCATGGGAAAC-3′; reverse: 5′-TCCGGCTTGTTCTTAGCTGT-3′).

Many ABA signal components such as receptor-like kinase GHR1 (guard cell hydrogen peroxide-resistant 1), calcium sensor CBL9 (calcineurin B-Like 9) and GPCR (G-protein coupled receptor) type G-protein are plasma membrane localized.^17-19 In addition to its co-localization with the plasma membrane tethered AtTLP family protein AtTLP11,^9,16 YFP-NHL6 fusion proteins were also observed in the cytosol and on the membrane of small vacuole or vesicles, when transiently expressed in tobacco leaf epidermal cells (Fig. 1A). This suggests that NHL6 may modulate ABA biosynthesis and signaling on the plasma membrane, or probably through protein trafficking and sorting.²⁰ The self interaction of NHL6 also implies that NHL6 might hetero-dimerize with other NHL family proteins, as supported by the observation that NHLs are highly conserved.^21,22 Therefore, it would be interesting to study the relationship between NHL6 and other NHL family members in Arabidopsis seed germination or ABA response. Biochemical and genetic assays will help us to figure out whether they are working counteractively or collaboratively.

Figure 1.

Subcellular localization of YFP-NHL6 and salicylic acid induced expression of NHL6. (A) Subcellular localization of YFP-NHL6 in tobacco leaf epidermal cells. Two small vesicles are indicated by red arrows. Empty YFP vector is used as a control. Bar = 50 μm. (B) cDNA derived from the rosette leaves of 4-week-old Arabidopsis plants treated with 100 µM SA for 12 hours was used as template. qPCR primers for NHL6: forward primer-5′ AACCGTACAATTGTCCACACTCAGG 3′; reverse primer-5′ TTCAGCTCCTTGTCGGTGGTGTT 3′. PR1 (Forward primer-5′AGGCACGAGGAGCGGTAGG3′; reverse primer-5′CTTTGGCACATCCGAGTCTCAC3′) and ACTIN2 (Forward primer-5′GGAAGGATCTGTACGGTAAC3′; reverse primer-5′GGACCTGCCTCATCATACT3′) were employed as positive and native controls, respectively.

Besides the crucial role in abiotic stress response, ABA is essential for plant resistance to pathogens.^23-26 As a member of the pathogen related NHL family genes,^21,27,28 NHL6 might function in disease response, too. We examined the expression level of NHL6 in the rosette leaves of wild type Arabidopsis plants and found that, same as PR1, NHL6 was also highly induced by SA (salicylic acid) (Fig. 1B). Since NHL6 could trigger ABA biosynthesis under abiotic stress condition,⁹ it is tempting to speculate that NHL6 may also play a role in disease response, probably through regulating ABA biosynthesis and/or signaling. Conserved motifs in homologous proteins of Arabidopsis NHL6 are discovered among different plant species (Fig. 2), implying the functional conservation of NHL6 in ABA and SA response.

Figure 2.

Protein sequence alignment of PtNHL6 (poplar, XP_002318799.1), VvNHL6 (Vitis, XP_002263732.1), MtNHL6 (Medicago, XP_003616105.1), AtNHL6 (Arabidopsis, NP_003022.3), ZmNHL6 (maize, DAA49515.1) and OsNHL6 (rice, NP_001054263.1). The conserved NHL motifs such as motif 1 (LILWLILRPXKPKFXVQDATV), motif2 (NPNKRIGIYYD) and motif 3 (PFYQGHKN) are indicated in black lines above the sequences.

A proposed working model of NHL6 in ABA and stress response is drawn based on our current research (Fig. 3). Further study on the possible target(s) that interact(s) with NHL6 will offer more information for the understanding of its molecular function(s) in biotic and abiotic stresses.

Figure 3.

A proposed working model of NHL6. ABA biosynthesis is induced by salt and mannitol. Upon the binding of ABA to its co-receptors PYR/PRL/RCARs-PP2Cs, the phospatase activity of PP2Cs is inhibited. When the kinase activity of SnRK2s is released from PP2Cs, they phosphorylate and activate AREBs and ABF3. Then, activated AREBs and ABF3 bind to the cis-element ABRE in the promoter of NHL6 and induce its transcription. The internalization of homo-dimerized NHL6 from plasma membrane to the cytosol may also be triggered by salt, mannitol and ABA, to induce endogenous ABA accumulation through up-regulating the expression of ABA biosynthesis genes NCED3, ABA3, AAO2 and AAO3.

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Funding

This work has been supported by the following grants: the National Natural Science Foundation of China (31371228, 31370670); the National Mega Project of GMO Crops (2014ZX0800942B); and the Strategic Priority Research Program of the Chinese Academy of Sciences XDA08030108.