Skip to main content
PLOS One logoLink to PLOS One
. 2016 Aug 12;11(8):e0157949. doi: 10.1371/journal.pone.0157949

Prevalence of pfhrp2 and/or pfhrp3 Gene Deletion in Plasmodium falciparum Population in Eight Highly Endemic States in India

Praveen Kumar Bharti 1, Himanshu Singh Chandel 1, Amreen Ahmad 1, Sri Krishna 1, Venkatachalam Udhayakumar 2, Neeru Singh 1,*
Editor: Georges Snounou3
PMCID: PMC4982695  PMID: 27518538

Abstract

Background

Plasmodium falciparum encoded histidine rich protein (HRP2) based malaria rapid diagnostic tests (RDTs) are used in India. Deletion of pfhrp2 and pfhrp3 genes contributes to false negative test results, and large numbers of such deletions have been reported from South America, highlighting the importance of surveillance to detect such deletions.

Methods

This is the first prospective field study carried out at 16 sites located in eight endemic states of India to assess the performance of PfHRP2 based RDT kits used in the national malaria control programme. In this study, microscopically confirmed P. falciparum but RDT negative samples were assessed for presence of pfhrp2, pfhrp3, and their flanking genes using PCR.

Results

Among 1521 microscopically positive P. falciparum samples screened, 50 were negative by HRP2 based RDT test. Molecular testing was carried out using these 50 RDT negative samples by assuming that 1471 RDT positive samples carried pfhrp2 gene. It was found that 2.4% (36/1521) and 1.8% (27/1521) of samples were negative for pfhrp2 and pfhrp3 genes, respectively. However, the frequency of pfhrp2 deletions varied between the sites ranging from 0–25% (2.4, 95% CI; 1.6–3.3). The frequency of both pfhrp2 and pfhrp3 gene deletion varied from 0–8% (1.6, 95% CI; 1.0–2.4).

Conclusion

This study provides evidence for low level presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in different endemic regions of India, and periodic surveillance is warranted for reliable use of PfHRP2 based RDTs.

Introduction

Malaria is a major public health problem in India, which has the highest number of malaria cases outside of Africa. Malaria prevalence in India varies between states and eight out of 35 states and union territories are contributing to 80% of total malaria cases, 85% Plasmodium falciparum, and 70% of deaths due to malaria in the country [1]. P. falciparum infection can become a life threatening disease, if not diagnosed early and treated [2].The introduction of malaria Rapid Diagnostic Tests (RDTs) has made it possible to obtain diagnostic results quickly and provide treatment in a timely manner. The availability of RDTs and the scale of their use in India have rapidly increased in recent years [3] along with the global increase in their use from 46 million in 2008 to 319 million in 2013 [4]. Most of the commercially available RDTs detect histidine-rich protein 2 (HRP2) which is produced during the asexual blood stage of P. falciparum but not by other species of malaria parasites making PfHRP2 based RDT species specific [5]. Some PfHRP2 based RDTs can cross react with HRP3 encoded by pfhrp3 gene due to shared antigenic epitopes between these proteins [6]. Pfhrp2 and pfhrp3 are structural homologue and their respective genes are located on chromosome 8 and chromosome 13 [7]. The plasma level of PfHRP2 has been shown to be a surrogate marker for the severity of P. falciparum malaria in some studies [8] as it can indirectly reflect the parasite load of sequestered parasites [9]. It may also be used as marker to differentiate between uncomplicated and severe malaria [10].

We have evaluated various brands of RDTs in various epidemiological settings in India with differing results in the past [11, 12]. The sensitivity of various RDTs ranged from 76% to 98% [3]. One major concern with RDT performance is the presence of false negative results which can lead to misdiagnosis and failure to treat. Several factors can contribute to false negative test results such as low parasite densities [3], incorrect interpretation of RDT results, prozone effect [13], or pfhrp2 gene deletion [14]. The first evidence for large scale pfhrp2 and pfhrp3 gene deletion came from Peru [15] and was further substantiated by other researchers [7, 14, 16, 17]. Such a large scale deletion of pfhrp2 has been found only in different parts of South America. Studies conducted in Africa and Asia showed pfhrp2 deletion in a small number of parasite isolates [1821]. We do not know if the false negative result in various RDT evaluation studies we conducted were at least partially due to pfhrp2 negative strains. There is very limited information about the extent of pfhrp2 and pfhrp3 gene deletion in P. falciparum parasites in South Asia. A small previous study conducted in Chhattisgarh state, India, revealed two out of 48 samples showed pfhrp2 deletion [18]. It is important to monitor pfhrp2 negative parasites present in P. falciparum populations, because in India, RDTs are used in the national malaria programme to diagnose malaria for case management in regions where microscopic diagnosis is not available. Therefore, the main objective of this study was to determine whether there is further evidence to confirm the presence of pfhrp2 and pfhrp3 deleted P. falciparum parasites in eight highly endemic states in India.

Material and Methods

We conducted a prospective study to determine the prevalence of pfhrp2 and pfhrp3 gene deletion in P. falciparum positive samples confirmed by microscopy. Samples were collected from 16 sites in eight malaria endemic states in India (Fig 1); two sites were selected from each state one having high malaria endemicity (Annual Parasite Incident > 5) and other one having low malaria endemicity (Annual Parasite Incident <2).

Fig 1. Map showing the study sites from eight malaria endemic states of India.

Fig 1

Each state has two study sites.

Positive P. falciparum samples were collected from July to December 2014 simultaneously from all sites during the rainy season and coinciding with the main transmission season [22]. These States are Odisha (OD), Chhattisgarh (CG), Jharkhand (JH), Madhya Pradesh (MP), Maharashtra (MH), Rajasthan (RJ), Gujarat (GJ), and Tripura (TR). Two community health centres (CHCs) representing a high endemic and low endemic regions were chosen from each State. During the study, we screened all febrile patients who attended the CHC hospital requiring malaria diagnosis. The patients were enrolled under the study after obtaining written informed consent from patients or their guardians. The blood smears were stained with JSB [23] and examined under the microscope. Those found positive were treated as per existing National Vector Borne Disease Control Programme (NVBDCP) policy [22]. The inclusion criteria for sample collection included positive identification of P. falciparum mono-infection by microscopy in the blood smears of symptomatic patients over the age of 5 year. Pregnant women were excluded from the study. 1-2ml venous blood samples were collected in heparin coated vacutainer and after plasma separation samples were stored under freezing conditions for further molecular studies. The blood smears were examined independently by two microscopists and if there was a discrepancy in the result, a third expert microscopist read the slide and confirmed the results. Parasite densities were calculated according to the standard technique (Parasites/μL = no. of asexual parasites X 8000/no. of WBC counted).

To test our working hypothesis that low level of pfhrp2 deleted parasites may be widely present in different endemic states of India, we carried out the following sample size calculation. In a previous study conducted in the Chhattisgarh State of India 4% pfhrp2 gene deletion was reported [18]. Therefore, to estimate the prevalence of P. falciparum infected individuals carrying pfhrp2 deleted parasites with 95% level of confidence and 25% relative precision, assuming a 4% pfhrp2 gene deletion rate, an overall sample size of 1536 P. falciparum cases were required.

The prevalence of pfhrp2, pfhrp3, and flanking gene deletion was determined by dividing the number of isolates by the total number of enrolled P. falciparum subjects. The study was approved by ethics committee of National Institute for Research in Tribal Health (ICMR). Written informed consent was signed by participants and their parents/guardians if they were minors.

Rapid diagnostic test

Bivalent malaria RDT was performed immediately from collected blood samples as per manufacturer’s protocol by taking 5 μL of whole blood with the help of circular loop provided by the manufacturer {SD Bioline Malaria Antigen P.f./P.v. (05FK80I-40), Bio Standard Diagnostics Pvt. Ltd., India}. The results were interpreted within the specified reading time of the manufacture’s protocol (15–30 minutes). RDT was also repeated for samples which gave negative results.

DNA extraction

Genomic DNA was extracted from 200 μL of whole blood using QIAamp DNA blood mini Kit (Qiagen, Germany) as per the manufacturer’s protocol and stored at –20°C for further molecular biology studies.

Species specific PCR

Presence of P. falciparum infection in all the samples was further confirmed by PCR using 18S ribosomal RNA (rRNA) gene amplification. Species specific nested PCR was performed [24] and detailed protocol was described earlier [25]. To check the quality of isolated genomic DNA, PCR amplification of two more genes, P. falciparum merozoite surface protein 1 (pfmsp1), and P. falciparum merozoite surface protein 2 (pfmsp2), was performed using specific primers [26]. In brief, for primary PCR 5μL of genomic DNA was taken as template and for nested PCR 2μL of 1:10 diluted primary PCR product was taken as template. Primer sequences and PCR cycling conditions were used as given in Table 1. PCR reaction was performed in a 25μL reaction mixture containing 10X buffer, 1mM MgCl2, 0.2mM each dNTP, 0.4μM each primer, and 0.2 units of Taq polymerase (Invitrogen, life technologies) with initial denaturation at 95°C for 5 min, and final extension at 72°C for 8 min. All the PCR products were analyzed in 1.2% agarose gel and image was captured under GelDoc-It2 imager.

Table 1. Details of primers and PCR conditions.
S.No. Gene Primer Sequence (5’➔3’); Forward (F) and Reverse (R) PCR Product length PCR Programme No of Cycle
Denaturation Annealing Elongation
Temp Time Temp Time Temp Time
1 MSP1 (Primary) F: CACAATGTGTAACACATGAAAG 646 bp 94°C 1 Min 55°C 1 Min 72°C 1 Min 35
R: AGTACGTCTAATTCATTTGCAC
MSP1 (Nested) F: TAGAAGCTTTAGAAGATGCAG 555 bp 94°C 1 Min 53°C 1 Min 72°C 1 Min 25
R: GACAATAATCATTAGCACATAC
2 MSP2 (Primary) F: ATGAAGGTAATTAAAACATTGTC 760 bp 94°C 1 Min 53°C 1 Min 72°C 1 Min 35
R: TTATTGAAGCAATATTACTAGAG
MSP2 (Nested) F: AGCAACACATTCATAAACAATG 634 bp 94°C 1 Min 54°C 1 Min 72°C 1 Min 25
R: CACAGTTTTCTTTGTTACCATC
3 PF3D7_0831900 (MAL7P1.230) (Primary) F: GATATCATTAGAAAACAAGAGCTTAG 405 bp 94°C 1 Min 63°C 1 Min 72°C 1 Min 35
R: TATCCAATCCTTCCTTTGCAACACC
PF3D7_0831900 (MAL7P1.230) (Nested) F: TATGAACGCAATTTAAGTGAGGCAG 356 bp 94°C 1 Min 65°C 1 Min 72°C 1 Min 25
R: TATCCAATCCTTCCTTTGCAACACC
4 PfHRP2-2 F: CAAAAGGACTTAATTTAAATAAGAG 814 bp 94°C 1 Min 55°C 1 Min 72°C 1 Min 35
R: AATAAATTTAATGGCGTAGGCA
5 PfHRP2-12 (Primary) F: GGTTTCCTTCTCAAAAAATAAAG 307 bp 94°C 1 Min 58°C 1 Min 72°C 1 Min 35
R: TCTACATGTGCTTGAGTTTCG
PfHRP2-12 (Nested) F: GTATTATCCGCTGCCGTTTTTGCC 222 bp 94°C 1 Min 63°C 1 Min 72°C 1 Min 25
R: CTACACAAGTTATTATTAAATGCGGAA
6 PF3D7_0831700 (MAL7P1.228) (Primary) F:AGACAAGCTACCAAAGATGCAGGTG 200 bp 94°C 1 Min 60°C 1 Min 72°C 1 Min 35
R: TAAATGTGTATCTCCTGAGGTAGC
PF3D7_0831700 (MAL7P1.228) (Nested) F: CCATTGCTGGTTTAAATGTTTTAAG 197 bp 94°C 1 Min 63°C 1 Min 72°C 1 Min 25
R: TAAATGTGTATCTCCTGAGGTAGC
7 PF3D7_1372100(MAL13P1.485) (Primary) F: TTGAGTGCAATGATGAGTGGAG 287 bp 94°C 1 Min 60°C 1 Min 72°C 1 Min 35
R: AAATCATTTCCTTTTACACTAGTGC
PF3D7_1372100(MAL13P1.485) (Nested) F: GTTACTACATTAGTGATGCATTC 266 bp 94°C 1 Min 59°C 1 Min 72°C 1 Min 25
R: AAATCATTTCCTTTTACACTAGTGC
8 PfHRP3-2 F: AATGCAAAAGGACTTAATTC 719 bp 94°C 1 Min 55°C 1 Min 72°C 1 Min 35
R: TGGTGTAAGTGATGCGTAGT
9 PfHRP3-12 (Primary) F: GGTTTCCTTCTCAAAAAATAAAA 311 bp 94°C 1 Min 53°C 1 Min 72°C 1 Min 25
R: CCTGCATGTGCTTGACTTTA
PfHRP3-12 (Nested) F: ATATTATCGCTGCCGTTTTTGCT 226 bp 94°C 1 Min 62°C 1 Min 72°C 1 Min 30
R: CTAAACAAGTTATTGTTAAATTCGGAG
10 PF3D7_1372400 (MAL13P1.475) (Primary) F: TTCATGAGTAGATGTCCTAGGAG 260 bp 94°C 1 Min 55°C 1 Min 72°C 1 Min 35
R: TCGTACAATTCATCATACTCACC
PF3D7_1372400 (MAL13P1.475) (Nested) F: TTCATGAGTAGATGTCCTAGGAG 234 bp 94°C 1 Min 61°C 1 Min 72°C 1 Min 25
R: GGATGTTTCGACATTTTCGTCG

Detection of pfhrp2 and pfhrp3 genes

Samples showing amplification for all three genes (18S rRNA, msp1, msp2) were sequenced in the study. Samples which were microscopically and PCR positive for P. falciparum and negative by RDT were subjected to pfhrp2, pfhrp3, and flanking genes of pfhrp2 and pfhrp3 PCR amplification. PCR amplification of DNA fragments encompassing exon1, intron, exon2, and fragment encompassing exon2 of pfhrp2 and pfhrp3 genes was performed using specific primers for confirmation of deletion of these genes using previously described method [7, 27]. Primers and PCR cycling conditions used for amplification of these genes are given in Table 1.

Detection of genes flanking pfhrp2 and pfhrp3 by PCR

PCR was also performed for flanking genes, pfhrp2 upstream (PF3D7_0831900), pfhrp2 downstream (PF3D7_0831700), and pfhrp3 upstream (PF3D7_1372100), pfhrp3 downstream (PF3D7_1372400) using specific primers for confirmation of deletion of these genes [7]. PCR cycling conditions used for amplification of these genes are given in Table 1. The composition of reaction mixture was the same as for amplification of pfhrp2 and pfhrp3 genes. Parasite strains of P. falciparum 3D7 and Dd2 were taken as positive and negative controls, respectively, for pfhrp2 because 3D7 is known to have all pfhrp2, pfhrp3, and flanking genes while Dd2 is lacking pfhrp2and its flanking genes [28]. Another P. falciparum strain, HB3 isolated from Honduras, was used as a negative control of pfhrp3 and its flanking genes because of absence of all these genes [29]. These controls were obtained from Malaria Branch at CDC, Atlanta USA.

All PCR products were separated and visualized on a 2% agarose gel. When there was a positive reaction, results was accepted without further repetition. When a negative test result was obtained, the amplification was repeated for confirmation. If the second result was concordant with the first, this was accepted as the final result. However, if the second result was discordant with the previous test result, the experiment was conducted for a third time. The two matching result out of these three were scored as the final result.

DNA sequencing of pfhrp2 and pfhrp3 gene

All the positive amplification of pfhrp2 and pfhrp3 genes (exon2) were sequenced from both directions by using forward and reverse primers of exon2. PCR products were purified by using spin columns (Real Biotech Corporation, Taiwan) according to manufacturer’s instructions and were used in a standard dye terminator (BigDye Terminator v3.1 Cycle Sequencing Kit) DNA sequencing on an Applied Biosystems 3130 XL sequencer.

Sequencing result analysis and translation

Sequencing results were analysed by using sequencing analysis software v5.2 (Applied Biosystems) and were assembled using CAP contig assembly programme of BioEdit sequence alignment editor. Nucleotide sequences were translated to amino acid sequences using ExPASy translate tool. Amino acid repeat sequences were identified and given numeric codes [27]. Nucleotide and amino acid sequences were submitted to the NCBI database.

Results

From the 16 study sites, a total of 22765 suspected malaria patients were screened for malaria by microscopy of which 2693 were positive for malaria (11.8%). Out of 2693 malaria subjects, 1999 were P. falciparum (74%), 645 P. vivax (24%), and 49 had mixed infections of P. falciparum and P. vivax (2%) as shown in Fig 2.

Fig 2. Flow chart showing Screening of malaria cases by microscopy, RDT and polymerase chain reaction (PCR) for pfhrp2 and pfhrp3 gene.

Fig 2

RDT Performance

Out of 1999 P. falciparum mono-infections, 1521 subjects were enrolled in the study and the rest either left the hospital before enrollment or refused to give consent for enrollment. Bivalent malaria RDT kit was performed among the enrolled patients and overall 3.3% (50/1521) of P. falciparum confirmed cases were found to be RDT negative (Table 2). Therefore, these 50 RDT negative samples were chosen for further molecular testing to detect if there is lack of pfhrp2, pfhrp3 or their flanking genes. The rest of 1471 specimens were assumed to be carrying a functional pfhrp2 gene as these specimens showed positive RDT results. The majority of RDT negative cases (2.6%) were from three states (40/1521), i.e. GJ, 11.3% (11/97), OD, 7.1% (19/267), and JH, 4.6% (10/216). The remaining 10 samples were from CG 1.4% (3/214), MH 1.7% (4/234), MP 0.9% (2/226), and TR 0.8% (1/127) while samples from RJ (n = 140) showed 100% matching results between RDT and the microscopy.

Table 2. Details of patients screening, positive, enrolled and RDT negative.

State CHC (Longitude, latitude and mean sea level) Screened Pos Pf Pf enrolled RDT negative n (%) 95% CI HRP2 Negative n (%) HRP3 Negative n (%) HRP2 & HRP3 Negative n (%)
Orissa Bandhugaon, District Koraput 758 349 311 229 18 (7.86) (4.7–12.1) 12 (5.2) 12 (5.2) 11 (4.8)
(82.72°E,18.82°N, 870 m)
Jagannathpur,District Rayagada 280 40 38 38 1 (2.63) (0.1–13.8) 0 (0.0) 0 (0.0) 0 (0.0)
(83.42°E, 19.17°N, 207 m)
Jharkhand Jaldega,District Simdega 949 191 146 118 4 (3.39) (0.9–8.5) 3 (2.5) 2 (1.7) 2 (1.7)
(84.52°E, 22.62°N, 418m)
Bano,District Simdega 2275 272 132 98 6 (6.12) (2.3–12.9) 2 (2.0) 1 (1.0) 0 (0.0)
(84.92°E, 22.62°N, 418 m)
Chhattisgarh Jagdalpur 4336 386 355 202 0 (0.00) (0.0–1.8)* 0 (0.0) 0 (0.0) 0 (0.0)
(82.03°E, 19.07°N, 552 m)
Baikunthpur 3116 23 16 12 3 (25.00) (5.5–57.2) 3 (25.0) 0 (0.0) 0 (0.0)
(82.55°E, 23.25°N, 556 m)
Madhya Pradesh Ranapur,District Jhabua 1503 310 153 125 0 (0.00) (0.0–2.9) * 0 (0.0) 0 (0.0) 0 (0.0)
(74.6°E 22.77°N 318 m)
Pushprajgarh,District Anuppur 1648 163 142 101 2 (1.98) (0.2–7.0) 2 (2.0) 2 (2.0) 2 (2.0)
(81.68°E, 23.1°N,505 m)
Maharshtra Malewada,District Gadchiroli 1163 121 116 114 3 (2.63) (0.5–7.5) 3 (2.6) 3 (2.6) 3 (2.6)
(80.0°E, 20.10°N, 217 m)
Darekasa,District Gondia 1113 135 126 120 1 (0.83) (0.0–4.6) 0 (0.0) 0 (0.0) 0 (0.0)
(80.19°E, 21.46°N, 300m)
Rajasthan Barabarda,District Pratapgarh 434 5 0 0 0 (0.00) 0 (0.0) 0 (0.0) 0 (0.0)
(74.8°E, 24.3°N, 580 m)
Bekaria,District Udaipur 678 215 158 140 0 (0.00) (0.0–2.6)* 0 (0.0) 0 (0.0) 0 (0.0)
(73.68°E, 24.58°N, 600 m)
Gujarat Devgadh Baria,District Dahod 2755 318 169 87 11 (12.64) (6.5–21.5) 10 (11.5) 7 (8.0) 7 (8.0)
(74°15′E, 22°52′N, 280 m)
Lavkar,District Valsad 461 15 10 10 0 (0.00) (0.0–30.8)* 0 (0.0) 0 (0.0) 0 (0.0)
(72.93°E, 20.61°N, 13 m)
Tripura Manu bazar,South Tripura 168 51 45 45 0 (0.00) (0.0–7.9)* 0 (0.0) 0 (0.0) 0 (0.0)
(91°29′E, 23°32′N, 26 m)
Santir bazar,South Tripura 1128 99 82 82 1 (1.22) (0.0–6.6) 1 (1.2) 0 (0.0) 0 (0.0)
(91°29′E, 23°32′N, 26 m)
Total 22765 2693 1999 1521 50 (3.29) (2.4–4.3) 36 (2.4) 27 (1.8) 25 (1.6)

* One-sided, 97.5% confidence interval; Pos: Positive for Malaria; Pf: Plasmodium falciparum

A nested PCR reaction that amplifies the 18S rRNA gene of five Plasmodium species (P. falciparum, P.vivax, P. malariae, P. ovale, and P. knowlesi) infecting humans and two polymorphic P. falciparum genes pfmsp1 and pfmsp2 was undertaken for confirmation of malaria parasite species, and quantity and quality of P. falciparum parasites DNA (Fig 3). Results of these experiments confirmed that all 50 samples were positive for P. falciparum (18SrRNA, pfmsp1 and pfmsp2 genes), with no evidence of contamination, or co-infection with another parasite species S1 Table. Population marker genes (pfmsp1 & pfmsp2) showed 18% (9/50) multiple allelic types among the RDT negative samples. Of these 9 cases, 6 were positive for pfhrp2 while only 3 cases were negative for pfhrp2. The peripheral parasite density was calculated from 1338 cases (46 from RDT negative and 1292 from RDT positive). Out of 46 RDT negative cases 22% (10/46) had parasite density <200/microliter, 30% (14/46) had parasite density between >200–500 /microliter and 48% (22/46) had parasite density >500/microliter. Three of these subjects had very high parasitemia (>5000 parasite/μL, >10,000 parasite/μL, and >20,000 parasite/μL).

Fig 3. Molecular analysis of RDT negative P. falciparum samples.

Fig 3

Nested PCR amplification of genes; Upstream (MAL7P1.230) and downstream (MAL7P1.228) flanking genes of pfhrp2, pfhrp2 exon 1–2 (hrp2-12), pfhrp2 exon2 (hrp2-2), upstream (MAL13P1.475) and downstream (MAL13P1.485) flanking genes of pfhrp3, pfhrp3 exon 1–2 (hrp3-12), pfhrp3 exon2 (hrp3-2). Each gel picture shows 100bp marker on 1st well then amplified gene of samples with their positive and negative controls respectively.

pfhrp2, pfhrp3 and its flanking gene deletions

PCR amplification showed 2.4% samples (36/1521) were lacking the pfhrp2 gene. Most cases (1.8%) (27/1521) were from the three states i.e. GJ 10.3% (10/97), OD 4.5% (12/267) and JH 2.2% (5/216) (Table 2). The remaining nine samples were from CG 1.4% (3/214), MH 1.3% (3/234), MP 0.9% (2/226), and TR 0.8% (1/127). Only 27 samples showed absence of the pfhrp3 gene (1.7%) and both pfhrp2 and pfhrp3 genes were not found in 1.6% (25/1521) samples by PCR.

Gene deletion patterns of pfhrp2 and pfhrp3 genes

Nineteen different types of pfhrp2 and pfhrp3 gene deletion patterns were observed (Table 3). Out of 50 isolates, only seven isolate (14%) had all the pfhrp2 and pfhrp3, and their flanking genes, while 86% isolates had deletion of either pfhrp2 or pfhrp3, or their flanking genes. Further analysis revealed that 14% of isolates lacked all the genes including their flanking genes. Another 14% isolates showed complete lack of pfhrp2 and its flanking genes while positive for pfhrp3 and its flanking genes.

Table 3. Deletion pattern of pfhrp2 and pfhrp3 and there flanking regions.

PF3D7_0831900 (MAL7P1.230) PfHRP2 Exon1–2, PF3D7_0831800 PfHRP2 Exon-2, PF3D7_0831800 PF3D7_0831700 (MAL7P1.228) PF3D7_1372100, (MAL13P1.485) PfHRP3 Exon1–2, PF3D7_1372200 PfHRP3 Exon -2, PF3D7_1372200 PF3D7_1372400 (MAL13P1.475) Samples (%)
+ + + + + + + + 7 (14)
+ + + + + - - + 1 (2)
+ + + - + + + + 2 (4)
+ + - + + + + + 1 (1)
+ - - + + + + + 2 (2)
+ - - + + - - + 1 (1)
+ - - + - - - + 2 (2)
+ - - + - - - - 1 (1)
+ - - - - - - + 4 (8)
+ - - - + + + + 1 (2)
- - - - - - - - 7 (14)
- - - - - - - + 3 (6)
- - - - + - - + 1 (2)
- - - + + - - + 1 (2)
- + + - + - - + 1 (2)
- + + + + + + + 3 (6)
- - - + - - - + 3 (6)
- - - + - - - - 2 (4)
- - - - + + + + 7 (14)
Total samples 50

Variation in pfhrp2 and pfhrp3 genes

Exon2 of all 16 positive samples for pfhrp2 and 23 positive samples for pfhrp3 were sequenced. A total of 14 different amino acid repeats were identified from pfhrp2 gene and 8 different amino acid repeat from pfhrp3 gene (Table 4). Type 1 (AHHAHHVAD), type 2 (AHHAHHAAD), type 7 (AHHAAD), and type 12 (AHHAAAHHEAATH) repeats were observed in 100% of the isolates. Several other repeats occurred only in a few isolates. The sequences were submitted to the Gen Bank database (Gen Bank accession numbers KT 238913-KT 238939).

Table 4. Amino acids repeats along with codes observed in Plasmodium falciparum histidine rich protein 2 and 3.
Code Repeat sequences Antigens observed
HRP2 HRP3
1 AHHAHHVAD + +
2 AHHAHHAAD + -
3 AHHAHHAAY + -
4 AHH + +
5 AHHAHHASD + -
6 AHHATD + -
7 AHHAAD + +
8 AHHAAY + -
9 AAY + -
10 AHHAAAHHATD + -
11 AHN - -
12 AHHAAAHHEAATH + -
13 AHHASD + -
14 AHHAHHATD - -
15 AHHAHHAAN + +
16 AHHAAN - +
17 AHHDG - +
18 AHHDD - +
19 AHHAA + -
20 SHHDD - +
21 AHHAHHATY - -
22 AHHAHHAGD - -
23 ARHAAD - -
24 AHHTHHAAD - -

Discussion

This is first systematic study from India to document the prevalence of the pfhrp2 and pfhrp3 genes in natural P. falciparum populations in eight endemic states responsible for 80% of total malaria cases, 85% Plasmodium falciparum, and 70% death due to malaria in the country [1]. The study design involved identification of false RDT negative samples by microscopy and PCR amplification of pfhrp2 and pfhrp3 genes along with their upstream and downstream flanking genes in order to estimate the extent of deletion around pfhrp2 and pfhrp3. Recent studies of pfhrp2 gene deletion in natural P. falciparum population from Peru and other countries [14, 17, 19] have demonstrated the importance of molecular surveillance to detect these deletions as they could lead to false negative diagnoses when pfhrp2 based RDTs are used. We performed several sets of PCR experiments to confirm that P. falciparum specimens actually lack these genes. These experiments also ensured that the negative PCR reaction for pfhrp2 and pfhrp3 were not due to poor quality or insufficient parasite DNA.

Prior to this study, we did not know whether P. falciparum parasites with pfhrp2 deletion were found in the highly endemic states of GJ, OD, and JH. The results of this study confirm that pfhrp2 deletions occur in natural P. falciparum parasite populations in India in varying proportions in different highly endemic CHCs (0–25%) and states (0–11%). These results suggest that spontaneous pfhrp2 deletions occur under natural field conditions with intense transmission as recorded earlier [14, 17, 19]. Moreover, simultaneous infection with different P. falciparum parasites (multiple genotypes) is also recorded in 18% RDT negative samples. Thus the 36 pfhrp2 negative out of 50 RDT negative and blood smear positive specimens does not provide the correct estimate of the pfhrp2 negative frequency of P. falciparum. This is because one pfhrp2 positive parasite in a specimen with another pfhrp2 negative strain may produce a pfhrp2 positive test results [19].Thus the actual prevalence of pfhrp2 negative strains could be higher than the estimate reported in this study. In addition, we assumed all 1471 specimens from RDT and microscopy positive individuals were positive for pfhrp2 and pfhrp3 genes and therefore not included in the molecular analysis. Given that HRP2 and HRP3 proteins share common epitopes, it is possible that we may have under estimated prevalence of especially pfhrp3 genes since positive HRP2 RDT test result need not necessarily reveal whether pfhrp3 is present or not. However, the main goal of this study is to estimate the prevalence of pfhrp2 gene, which codes for HRP2 proteins captured by P. falciparum specific RDTs.

Although overall results suggested that the majority of persons with P. falciparum infections are positive using PfHRP2 based RDTs >97% and that PfHRP2 based RDTs are useful for diagnosis especially in regions where skilled microscopists are not available. However, it is of concern that false negative PfHRP2 based RDTs were obtained in some CHCs i.e. Bandhugaon in OD, Devgadh Baria in GJ, and Baikunthpur in CG and thus a negative test results with an RDT based on PfHRP2 (SD Biolines used in this study) does not exclude active infection with P. falciparum. Moreover, all these 3 CHC's are located in high endemic regions. Multiple infection (MOI) with P. falciparum strains was limited to 18% and these cases were mainly found in 4 states i.e. OD, JH, GJ and MH.

All samples lacking pfhrp2 were found in symptomatic patients and occurred at both high and low parasitemia as reported in Peru [16]. This is in contrast to an earlier finding which showed pfhrp2 gene deletions only in asymptomatic subjects with low parasitemia [19]. It has also been demonstrated that PfHRP3 is likely to compensate for absence of PfHRP2 in diagnosis due to cross-reaction of PfHRP2 with PfHRP3 antibodies [15, 20, 27]. However, in this study 25 subjects, out of 50 lacked both pfhrp2 and pfhrp3 genes. Moreover, the role of pfhrp3 in performance of HRP based diagnostic tests is not well defined [15].

Although among 50 RDT negative samples tested we found higher levels of pfhrp2 deletion than pfhrp3, we cannot generalize this for the whole country without further studies. However, it is worth pointing out that in some countries such as Suriname pfhrp2 deletion was more common than pfhrp3 [17]. In contrast, in some countries viz Colombia [14], Peru [15], and Honduras [7] pfhrp3 deletions are more prevalent than pfhrp2 deletion.

Three major factors can affect the sensitivity of the PfHRP2 based RDT i.e. parasite density, pfhrp2 polymorphisms, and pfhrp2 deletion. The parasite density cannot explain the failure of the detection by PfHRP2 based RDT as there were 48% subjects with high parasitemia showed RDT negative test results for P. falciparum (>500 parasite/μL). Another factor affecting the sensitivity of the PfHRP2 based RDT is failure of parasite to express the antigen or alteration in PfHRP2 protein sequence due to gene deletion, insertion, pattern of histidine repeats, and SNPs [20, 21, 30]. There were some isolates that were PCR positive for pfhrp2 gene (14/50) but showed false negative RDT test results. Although we do not know the reason for this false negative test result, it is possible that variation in composition of pfhrp2 sequence repeat as well as the number of repeat types could have influenced the test results. The amino acid composition of the PfHRP2 protein (organization of the repeats and position of repeats in the antigens) may have an impact on RDT sensitivity [27, 30]. Multiple patterns of deletion (Table 3) within the region of pfhrp2, pfhrp3, and its flanking genes was present in this study and these kinds of patterns have been reported previously [14]. This kind of multiple gene deletion patterns could be due to their physical location on the chromosomes [7].

The results suggest that the pfhrp2 and pfhrp3 deletion phenomenon is also found in India in varying proportions but at a lower proportion. This finding is valuable for laboratories and health policy makers as it showed that PfHRP2 based RDTs can be reliably used in most parts of India where this study was performed. However, even though the prevalence of pfhrp2/pfhrp3 negative parasites are low in most part of the country, the frequent migration or selection of pfhrp2 parasites could lead to their spread to other parts of the country as was the case for drug resistance parasites. Moreover, the patients with negative PfHRP2 based RDTs will not be treated for malaria and this could lead to selection of pfhrp2 negative parasites as NVBDCP policy is to use RDTs for malaria diagnosis and treatment in areas where it is not possible to provide results of microscopy within 24 hrs. If the parasites are undetected by these RDTs, the delay in treatment supports the development of sexual stages and their transmission to mosquitoes during a blood meal. The transmission of parasites undetected by PfHRP2 based RDT would continue, leading to faster selection and dissemination of these genotypes [20]. The frequency of these genotypes would then increase in coming years from these areas like GJ (Devgadh Baria CHC, district Dahod), OD (Bandhugaon CHC, district Koraput), CG (District hospital, district Korea). These districts are also known as highly malarious ones in their respective states.

The strength of this study is that samples were collected from 16 sites in eight endemic states simultaneously during the main transmission season from different geographical regions of the country to understand the pattern of hrp2 and hrp3 gene deletions in the areas of different endemicity. Nevertheless, this study has some limitations. The samples were collected only during one season, thus the pattern of the distribution of pfhrp2 and pfhrp3 deletions are not known during other seasons of the year. Moreover the prevalence of pfhrp3 gene deletions estimated in this study may be an underestimate as RDT positive samples were not tested for pfhrp3 deletion. Another limitation of the study is the number of samples examined from the highly malarious state of Tripura as transmission start much earlier in May as compared to other states where main transmission season starts from July onwards with the onset of rains. A larger and more systematic collection in large parts of Gujarat, Odisha, Jharkhand, and Chhattisgarh will clarify the current prevalence and distribution of P. falciparum strains with pfhrp2 and pfhrp3 deletions in these states. Periodic evaluation of RDT performance and molecular surveillance will be required to ensure the reliable performance of RDTs and to monitor changes in the level of pfhrp2 deleted parasites in different parts of India.

Supporting Information

S1 Table. PCR amplification of different genes from RDT negative samples.

(DOCX)

Acknowledgments

The authors gratefully acknowledge the support of Dr. John Barnwell, CDC, Atlanta, USA for this study. Thanks are also due to Lucchi, Naomi W, Malaria Branch, CDC, Atlanta USA for helpful technical discussions. We thank all the study participants and their relatives for providing the informed consent. We thank all the staff of 16 sites particularly Medical Officers for their help and support.

Data Availability

Due to ethical restrictions regarding participant privacy, the data are available upon request. Requests for the data may be sent to Dr. Neeru Singh, Director, National Institute for Research in Tribal Health (NIRTH) (neeru.singh@gmail.com).

Funding Statement

This work was funded by Indian Council of Medical Research, India.

References

  • 1.National Vector Borne Diseases Control programme, Malaria situation in India 2014. Available: http://www.nvbdcp.gov.in/Doc/mal-situation-Jan-16.pdf
  • 2.Jain V, Basak S, Bhandari S, Bharti PK, Thomas T, Singh MP, et al. Burden of complicated malaria in a densely forested Bastar region of Chhattisgarh State (Central India). PLoS One.2014;9: e115266 10.1371/journal.pone.0115266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Singh N, Bharti PK, Singh MP, Mishra S, Shukla MM, Sharma RK, et al. Comparative evaluation of bivalent malaria rapid diagnostic tests versus traditional methods in field with special reference to heat stability testing in Central India. PLoS One.2013;8:e58080 10.1371/journal.pone.0058080 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.World Health Organization, World Malaria Report 2014 [cited 2016Mar15]. Available: http://www.who.int/malaria/publications/world_malaria_report_2014/wmr-2014-no-profiles.pdf.
  • 5.Howard RJ, Uni S, Aikawa M, Aley SB, Leech JH, Lew AM, et al. Secretion of a malarial histidine-rich protein (Pf HRP II) from Plasmodium falciparum-infected erythrocytes. J Cell Biol. 1986;103:126977 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Lee N, Baker J, Andrews KT, Gatton ML, Bell D, Cheng Q, et al. Effect of sequence variation in Plasmodium falciparum histidine-rich protein 2 on binding of specific monoclonal antibodies: implications for rapid diagnostic tests for malaria. J ClinMicrobiol. 2006;44:2773–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Abdallah JF, Okoth SA, Fontecha GA, Torres RE, Banegas EI, Matute ML, et al. Prevalence of pfhrp2 and pfhrp3 gene deletions in Puerto Lempira, Honduras. Malar J. 2015;14:19 10.1186/s12936-014-0537-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Hendriksen IC, Mwanga-Amumpaire J, von Seidlein L, Mtove G, White LJ, Olaosebikan R,et al. Diagnosing severe falciparum malaria in parasitaemic African children: a prospective evaluation of plasma PfHRP2 measurement. PLoS Med. 2012;9:e1001297 10.1371/journal.pmed.1001297 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Ramutton T, Hendriksen IC, Mwanga-Amumpaire J, Mtove G, Olaosebikan R, Tshefu AK,et al. Sequence variation does not confound the measurement of plasma PfHRP2 concentration in African children presenting with severe malaria. Malar J. 2012;11:276 10.1186/1475-2875-11-276 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sinha I, Ekapirat N, Dondorp AM, Woodrow CJ. Use of a rapid test to assess plasma Plasmodium falciparum HRP2 and guide management of severe febrile illness. Malar J. 2015;14:362 10.1186/s12936-015-0900-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Singh N, Singh MP, Sharma VP. The use of a Dipstick Antigen Capture Assay for the Diagnosis of Plasmodium falciparum infection in a remote forested area of Central India. Am J Trop Med Hyg. 1997;56:188–91. [DOI] [PubMed] [Google Scholar]
  • 12.Singh N, Shukla MM, Shukla MK, Mehra RK, Sharma S, Bharti PK, et al. Field and laboratory comparative evaluation of rapid malaria diagnostic tests versus traditional and molecular techniques in India. Malar J. 2010;9:191 10.1186/1475-2875-9-191 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Luchavez J, Baker J, Alcantara S, Belizario V Jr, Cheng Q, McCarthy JS, et al. Laboratory demonstration of a prozone-like effect in HRP2-detecting malaria rapid diagnostic tests: implications for clinical management. Malar J. 2011;10:286 10.1186/1475-2875-10-286 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Murillo Solano C, Akinyi Okoth S, Abdallah JF, Pava Z, Dorado E, Incardona S, et al. Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites. PLoS One. 2015;10:e0131576 10.1371/journal.pone.0131576 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gamboa D, Ho MF, Bendezu J, Torres K, Chiodini PL, Barnwell JW, et al. A large proportion of P. falciparum isolates in the Amazon region of Peru lack pfhrp2 and pfhrp3: implications for malaria rapid diagnostic tests. PLoS One. 2010;5:e8091 10.1371/journal.pone.0008091 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Maltha J, Gamboa D, Bendezu J, Sanchez L, Cnops L, Gillet P, et al. Rapid diagnostic tests for malaria diagnosis in the Peruvian Amazon: impact of pfhrp2 gene deletions and cross-reactions. PLoS One. 2012;7:e43094 10.1371/journal.pone.0043094 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Akinyi Okoth S, Abdallah JF, Ceron N, Adhin MR, Chandrabose J, Krishnalall K, et al. Variation in Plasmodium falciparum Histidine-Rich Protein 2 (Pfhrp2) and Plasmodium falciparum Histidine-Rich Protein 3 (Pfhrp3) Gene Deletions in Guyana and Suriname. PLoS One. 2015;10:e0126805 10.1371/journal.pone.0126805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kumar N, Pande V, Bhatt RM, Shah NK, Mishra N, Srivastava B, et al. Genetic deletion of HRP2 and HRP3 in Indian Plasmodium falciparum population and false negative malaria rapid diagnostic test. Acta Trop. 2013;125:119–21. 10.1016/j.actatropica.2012.09.015 [DOI] [PubMed] [Google Scholar]
  • 19.Koita OA, Doumbo OK, Ouattara A, Tall LK, Konaré A, Diakité M, et al. False-negative rapid diagnostic tests for malaria and deletion of the histidine-rich repeat region of the hrp2 gene. Am J Trop Med Hyg. 2012;86:194–8. 10.4269/ajtmh.2012.10-0665 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wurtz N, Fall B, Bui K, Pascual A, Fall M, Camara C, et al. Pfhrp2 and pfhrp3 polymorphisms in Plasmodium falciparum isolates from Dakar, Senegal: impact on rapid malaria diagnostic tests. Malar J. 2013;12:34 10.1186/1475-2875-12-34 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Deme AB, Park DJ, Bei AK, Sarr O, Badiane AS, Gueye Pel H, et al. Analysis of pfhrp2 genetic diversity in Senegal and implications for use of rapid diagnostic tests. Malar J. 2014;13:34 10.1186/1475-2875-13-34 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Diagnosis and Treatment of Malaria 2013, National Vector Borne Diseases Control programme. Available: http://nvbdcp.gov.in/Doc/Diagnosis-Treatment-Malaria-2013.pdf.
  • 23.Singh J, Bhattacharji LM. Rapid staining of malaria parasites by a water soluble stain. Indian Med Gaz. 1944;79:102–4. [PMC free article] [PubMed] [Google Scholar]
  • 24.Snounou G, Viriyakosol S, Jarra W, Thaithong S, Brown KN. Identification of the four human malaria parasite species in field samples by the polymerase chain reaction and detection of a high prevalence of mixed infections. Mol Biochem Parasitol 1993;58:283–92. [DOI] [PubMed] [Google Scholar]
  • 25.Krishna S, Bharti PK, Chandel HS, Ahmad A, Kumar R, Singh PP, et al. Detection of Mixed Infections with Plasmodium spp. by PCR, India, 2014. Emerg Infect Dis. 2015;21:1853–7. 10.3201/eid2110.150678 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bharti PK, Alam MT, Boxer R, Shukla MM, Gautam SP, Sharma YD, et al. Therapeutic efficacy of chloroquine and sequence variation in pfcrt gene among patients with falciparum malaria in central India. Trop Med Int Health. 2010;15:33–40. 10.1111/j.1365-3156.2009.02425.x [DOI] [PubMed] [Google Scholar]
  • 27.Baker J, McCarthy J, Gatton M, Kyle DE, Belizario V, Luchavez J, et al. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 (PfHRP2) and its effect on the performance of PfHRP2-based rapid diagnostic tests. J Infect Dis. 2005;192:870–7. [DOI] [PubMed] [Google Scholar]
  • 28.Wellems TE, Walker JA, Panton LJ. Genetic mapping of the chloroquine-resistance locus on Plasmodium falciparum chromosome 7. Proc Natl Acad Sci USA. 1991;88:3382–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wellems TE, Walliker D, Smith CL, do Rosario VE, Maloy WL, Howard RJ, et al. A histidine-rich protein gene marks a linkage group favored strongly in a genetic cross of Plasmodium falciparum. Cell. 1987;49:633–42. [DOI] [PubMed] [Google Scholar]
  • 30.Baker J, Ho MF, Pelecanos A, Gatton M, Chen N, Abdullah S, et al. Global sequence variation in the histidine-rich proteins 2 and 3 of Plasmodium falciparum: implications for the performance of malaria rapid diagnostic tests. Malar J. 2010;9:129 10.1186/1475-2875-9-129 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Table. PCR amplification of different genes from RDT negative samples.

(DOCX)

Data Availability Statement

Due to ethical restrictions regarding participant privacy, the data are available upon request. Requests for the data may be sent to Dr. Neeru Singh, Director, National Institute for Research in Tribal Health (NIRTH) (neeru.singh@gmail.com).


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES