Abstract
The maintenance of high-copy number plasmids within bacteria had been commonly thought to result from free diffusion and random segregation. Recent microscopy experiments, however, observed high-copy number plasmids clustering into discrete foci, which seemed to contradict this model, and hinted at an undiscovered active mechanism, as often found in low-copy number plasmids. We recently investigated the cellular organization of a ColE1-derivative plasmid in Escherichia coli bacteria using quantitative superresolved microscopy based on single-molecule localization in combination with single-molecule fluorescence in situ hybridization (smFISH). We observed that many of the plasmids aggregated into large clusters, although most of the plasmids were randomly distributed throughout the bacteria, minus an excluded volume about the chromosomal DNA. Our results indicate that neither of the previous models completely encompasses the behavior of high-copy number plasmids. We also found many plasmids within the chromosomal volume, providing further evidence that the nucleoid does not fully exclude DNA and RNA.
Introduction
Plasmids, which are self-replicating, mobile pieces of extrachromosomal DNA, can play a crucial role in bacterial metabolism (1, 2), pathogenesis (3, 4), and evolution (5), and are commonly engineered for recombinant protein synthesis and industrial fermentation (6). On one hand, plasmids often encode deleterious genes whose dissemination through bacterial populations can produce strains that are, for example, more resistant to antibiotics and more virulent (3, 4, 5). On the other hand, the loss of plasmids, such as for large-scale protein synthesis by recombinant gene expression, has been identified as a key factor limiting yield (6). Deterring the persistence of harmful and enhancing the retention of beneficial plasmids requires a better understanding of the fundamental mechanisms behind plasmid maintenance.
Because plasmids are responsible for their own survival within a bacterial population, those at low-copy numbers have developed a range of active partitioning systems to ensure their inheritance by dividing cells (7, 8, 9, 10, 11, 12). Plasmids such as the F and R1 plasmids can be maintained at as few as 1–2 copies per cell by such mechanisms (7). For instance, R1 plasmids make use of the parMRC system, which relies upon the growth and depolymerization of actinlike filaments that physically push the plasmids to opposite poles of the cell (8, 11).
High-copy number (hcn) plasmids, however, have attracted much less inquiry. Hcn plasmids may be roughly defined as having copy numbers nc > 15, but may exist at great excess. For example, the ColE1 plasmid derivatives used in recombinant gene expression can attain a copy number on the order of nc = 200–300 (13). A commonly accepted model for hcn plasmid maintenance, the random distribution model, simply assumes that plasmids freely diffuse throughout the cytoplasm before cell division and randomly segregate during cell division. For complete random segregation between cells, the probability of generating a daughter cell without a plasmid, given n plasmids at each round of cell division, is p0 = 2(1–n). Hence, for hcn plasmids, where the copy number is >15, this probability becomes vanishingly small so cells are able to stably maintain the plasmids within their population for generations without needing to encode more complicated, active mechanisms (14).
Recent experiments, however, seem to invalidate the random distribution model. Several groups have observed that hcn plasmids actually tend to localize to the cell poles as large clusters (15, 16). This preferential localization can be attributed, perhaps, to displacement of the plasmids by the nucleoid, which is thought to fully occupy the central volume of a bacterium (17). These observations of discrete, multifocal clusters are reminiscent of active segregation mechanisms leading some to speculate upon the existence of active mechanisms for hcn plasmids (18). Because the hypothetical genes for segregating hcn plasmids do not appear in the plasmid DNA, as would the genes for active mechanisms found in low-copy number plasmids, this mechanism would have to be hard-wired into the bacterial chromosome.
We have been studying the spatial organization of the high-copy number pBluescript plasmid, which harbors a ColE1-derivative origin of replication, by combining quantitative localization microscopy with DNA single-molecule fluorescence in situ hybridization (smFISH). Our experiments suggest that this plasmid employs a mixed strategy of both randomly distributing its plasmids and clustering a subpopulation into aggregates. The joint population (both free and clustered) appears to be randomly distributed throughout the cell volume, minus an excluded volume containing the chromosomal DNA. Furthermore, we find that the excluded volume of the nucleoid appears amorphous as many of the plasmids were detected throughout the central volume of the cell, revealing pathways by which RNA and DNA may traverse the cell and interact with the chromosomal DNA.
Materials and Methods
Bacteria growth, fixation, and permeabilization
Escherichia coli bacteria strain Stbl3 (Invitrogen, Carlsbad, CA) transformed with plasmids Lac-I-SceI-Tet was chosen for this study. The plasmid Lac-I-SceI-Tet, a gift from Tom Misteli (Addgene plasmid No. 17655), contains an array of 256 LacO repeats and 96 TetO repeats (∼ 14 kb) cloned onto a high-copy number plasmid, pBluescript, a ColE1 derivative (19). The large array of operator repeats was utilized to facilitate smFISH and enhance target signal (see below). Preservation of the LacO array was verified by gel electrophoresis after restriction enzyme digestion of the plasmid (19). Large inserts containing multiple sequence repeats are known to significantly reduce plasmid copy number (20). With this consideration in mind, we chose a ColE1-derivative plasmid with an artificially high-copy number (pBluescript, quoted >300 copies). Due to the presence of the insert, however, the actual copy number of the plasmid, measured through quantitative PCR, was confirmed to be in the range of more naturally occurring hcn plasmids (∼40 copies).
Bacteria were grown, fixed, and permeabilized based on published protocols (15, 21, 22, 23). Briefly, E. coli bacteria (Stbl3/Lac-I-SceI-Tet and DH5α/pZA31luc) were grown overnight at 30°C in defined M9 minimal medium (24), supplemented with 1% glucose, 0.1% casamino acids, 0.01% thiamine, and appropriate antibiotics. On the second day, the overnight culture was diluted by 50–100 times into fresh medium so that the OD600 was 0.05. The fresh cultures were again grown at 30°C. When the OD600 reached 0.2–0.4, cells were fixed by adding 37% formaldehyde directly to the cultures up to a final concentration of 3.7%. This was followed by incubation at room temperature for 30 min with an orbital shaker. Fixed cells were then harvested by centrifugation at 1000g for 15 min at room temperature, followed by removal of the supernatant. Cell pellets were then washed twice with 1× PBS by repeated centrifugation (1000g for 10 min). Cells were first resuspended in water, and then 100% ethanol was added for cell-permeabilization up to a final concentration of 70% ethanol. The cells were incubated at room temperature for 2 h and then stored at 4°C overnight.
We note that the same protocols for fixation and permeabilization of cells have been effectively utilized with RNA smFISH for imaging of RNA in bacteria (21, 22, 23). It has also been shown that both fixed cells (labeled by DNA FISH) and live cells (employing fluorescently tagged transcription factors) yielded discrete clusters of hcn plasmids, which agreed with what we observed with conventional microscopy (see Fig. 2, B and E) (15). These observations indicate that the fixation and permeabilization should have little effect on the intracellular organization of the plasmid DNA.
Figure 2.
Conventional and superresolved fluorescence images of FISH-labeled plasmids in E. coli. (A) Immobilized bacteria were viewed under bright field illumination. (B) Conventional fluorescence microscopy showed smFISH-labeled plasmids as fluorescent foci on top of a weak fluorescent background. (C) The same bacteria were imaged by localization microscopy. (D–F) The magenta area in (A–C) is shown enlarged. Green and orange arrows indicate fluorescent foci (E), or clusters of localizations (F). (G and H) The localization precision for the superresolved reconstruction was estimated based on Mortensen et al. (35). We achieved an average precision of ≈10 nm for both and . To see this figure in color, go online.
Quantitative PCR
Bacteria (Stbl3/Lac-I-SceI-Tet) were grown overnight at 30°C in defined M9 minimal medium (24), supplemented with 1% glucose, 0.1% casamino acids, 0.01% thiamine, and appropriate antibiotics. On the second day, the overnight culture was diluted by 50–100 times into fresh medium so that the OD600 was 0.05. The fresh cultures were again grown at 30°C. When the OD600 reached 0.1–0.2, 200 μL of the culture was collected, heated at 94°C for 10 min, and then frozen at −20°C to disrupt the cells (17, 25).
A standard curve for absolute quantification was generated using purified plasmids (Lac-I-SceI-Tet) from mini-prep. The plasmids were diluted over five orders-of-magnitude in a 10-fold dilution series to generate a standard curve of copy number versus threshold cycle value (Ct). Primers were designed using the PrimerQuest tool from Integrated DNA Technologies (Coralsville, IA), and were complementary to the ColE1 origin of the pBluescript plasmids (QPCR_T1_Fwd: AAAGGCCAGGAACCGTAAA; QPCR_T1_Rev: CTACAGCGTGAGCTATGAGAAA).
The standards or the cell samples were mixed with the primers and qPCR master mix (SensiFAST SYBR Lo-ROX Kit; Bioline USA, Taunton, MA). Amplification and measurements were then done on a model No. Mx3005P qPCR machine (Agilent Technologies, Santa Clara, CA) with 40 cycles of 95°C for 5 s, 60°C for 22 s, and 72°C for 20 s. The standards and the unknown cell samples were measured simultaneously on the same plate. Analyses were performed with MxPro qPCR software (Agilent Technologies, Santa Clara, CA). Together with the OD600 of the cells, the copy number of plasmids per cell was computed and found to be nc ∼ 40 (Fig. S1 in the Supporting Material).
DNA smFISH
Assembly of DNA probes
Short DNA probes (20 bases: TGG AAT TGT GAG CGG ATA AC) were ordered from Integrated DNA Technologies. The sequence was chosen to target a series of 256 LacO repeats cloned onto pBluescript (19). The operator repeats were utilized to enhance the number of hybridized/bound probes and therefore signal/noise, a strategy that has been adopted widely (15, 17).
Amine modifications were added to the 3′ ends of the probes for labeling with ATTO-532 NHS ester (Sigma-Aldrich, St. Louis, MO) fluorescent dyes. The dyes were first dissolved in DMSO to a final concentration of 5 mg/mL (or 4.6 mM) and then mixed with DNA probes at a dye:probe ratio of 25:1 molar. To the reaction volume, fresh 1 M sodium bicarbonate solution (pH = 8.5) was added such that its final concentration was 0.1 M. The concentration of DNA probes was 50–60 μM in the labeling reaction, which was incubated in the dark at 37°C overnight with orbital shaking at 275 rpm. Labeled probes were purified from unconjugated free dyes by ethanol precipitation three times and then dissolved in water to a final concentration of 50 μM. We measured a labeling efficiency of ∼80% by quantifying the stoichiometry between the dyes and the DNA of the purified labeled probes by photometry.
Essential to the success of smFISH experiments is that the DNA probe solution is free of unconjugated dyes, which will give rise to false-positive signals. We estimated the purity of labeled probes by running a 12% polyacrylamide gel and then reading the fluorescent signal from ATTO-532 dyes, shown in Fig. S2. The probes used in our smFISH experiments displayed >95% purity from free dyes. We note that multiple rounds of ethanol precipitation were required: a mixture of labeled probes (∼40%) and unconjugated dyes was observed with only one round of purification.
In situ hybridization assay
DNA FISH probes were utilized for in situ hybridization to label the plasmids of interest in fixed, permeabilized bacteria. The hybridization procedure was based on a published protocol for RNA smFISH (22, 23), but with several modifications. Briefly, 100 μL of fixed and permeabilized cells in 70% ethanol were washed twice with a 40% formamide wash solution (40% FWS: 40% formamide in 2× SSC) by repeated centrifugation (1000g for 10 minutes) and resuspension (in 200 μL 40% FWS). After the second wash, the cell pellets were resuspended in 50 μL of 40% hybridization solution with probes (40% HSP: 1 μM-labeled probes in 2× SSC with 40% formamide and 1 mg/mL salmon sperm DNA). Hybridization reactions were initiated by heating the samples to 95°C for 5 min and slowly ramping down to 30°C (in 1–2 h), and were then incubated in the dark at 30°C overnight. On the second day, the cells were washed three times with 40% FWS. For each wash, the cells were resuspended in 200 μL 40% FWS, incubated in the dark at 30°C for 30 min, and pelleted. After the last wash, the cell pellets were directly resuspended in 50 μL 2× SSC and stored at 4°C before imaging.
DNA probe hybridization efficiency
To assess the hybridization efficiency, we performed in vitro hybridization experiments and measured the number of hybridized probes by single-molecule counting of photobleaching steps (26, 27, 28). Because the maximum capacity of the target plasmid was large (256 LacO repeats), detection and counting of photobleaching steps was impractical on the full construct (Fig. S3). Instead, a different plasmid (pZA31luc), with a maximum capacity of nine different probes, was used. The in vitro hybridization procedure was performed under the same conditions as the in situ smFISH experiments except that salmon sperm DNA was omitted in the hybridization buffer. With oxygen scavengers in the imaging buffer (13 mM protocatechuic acid (PCA) and 50 nM protocatechuate-3,4-dioxygenase (PCD)) in 1× PBS, without β-mercaptoethylamine (MEA) (29, 30), we monitored the fluorescence intensities of plasmids immobilized on a poly-L-lysine–coated coverslip and observed stairwise steps due to sequential photobleaching of the fluorescent probes hybridized to the plasmids. As shown in Fig. 1 A, this analysis yielded the number of hybridized probes, . Because unhybridized probes show the same number of photobleaching steps as plasmids with one bound probe, therefore biasing the counting for , we examined 145 plasmids with at least two hybridized probes, and the histogram followed the expected binomial distribution (Fig. 1 B). A least-squares fit gave an effective hybridization efficiency, p, of ∼15% (Fig. 1 B).
Figure 1.
Characterization of probe hybridization efficiency. (A) An intensity trace showing stepwise photobleaching, which yielded the number of FISH probes hybridized to a single plasmid. (B) The resulting distribution was assembled and fitted by a binomial distribution giving a hybridization efficiency of ∼15% (dark blue bars, experimental measurement; yellow bars, fitted data). To see this figure in color, go online.
The actual hybridization efficiency should be higher than the measured efficiency of 15% because of factors such as an imperfect probe labeling efficiency, resulting in unlabeled competitor DNA, and a non-100% survival rate of dyes (i.e., labeled, but photobleached before imaging). We speculate that the actual hybridization efficiency was between 20 and 30%, which is lower than in RNA FISH experiments (23). This reduced efficiency is expected for DNA FISH because the labeled probes must always compete with the denatured complement at a target site along the double-stranded DNA.
We should also note, the hybridization efficiency for the in situ FISH experiments could be lower than our in vitro results simply because it is much more crowded inside the bacteria than in a test tube, possibly hindering the diffusion of probes. Likewise, salmon sperm DNA was present during in situ hybridization to minimize nonspecificity, which also competes against the probes.
Localization microscopy
Ten microliters of labeled Stbl3 E. coli cells (≈0.1–10 pM) were immobilized on poly-L-lysine–treated coverslips and imaged by direct stochastic optical reconstruction microscopy (30, 31, 32). To induce stable photoswitching of the dyes at constant pH, the cells were immersed in the following imaging buffer: 50 mM MEA, 13 mM PCA, and 50 nM PCD in 1× PBS.
The microscope we used was home-built on an IX-81 inverted microscope (Olympus, Melville, NY) with a TIRF 60× N.A. = 1.49 oil-immersion objective (Olympus). The microscope and data acquisition were controlled by μManager (33). A 532-nm laser (GEM, 500mW; Laser Quantum, Santa Clara, CA) was used to excite ATTO-532 dyes, and a 405-nm laser (Coherent, OBIS, 30mW; Coherent Laser, Bloomfield, CT) was used to tune the reactivation of the dyes. Emissions from the dyes were collected by the objective and imaged on an electron-multiplying charge-coupled device camera ( iXion3; Andor Technology, South Windsor, CT). Before the camera, an additional telescope was inserted such that the total magnification reached 240×, and the effective pixel size of acquired images was 67 nm.
The resulting movies (20 fps, 20,000 frames) were analyzed with custom-built localization software. The localizations that appear in adjacent frames and within 10 nm to each other were regrouped as a single molecule as done in Coltharp et al. (34). The spots that were too dim, too wide, or too narrow, were rejected; while the spots that survived the criteria gave the localizations of the dyes and the widths of the localizations . Fit results for the remaining spots were used to estimate the photon number N, and the localization precision was given as (35), where ; a is the pixel size (67 nm in our experiments) and b is the standard deviation of the background. The localizations were further corrected for drift using a mean cross-correlation algorithm (36, 37), and then used for generating reconstructed images.
Analysis of spatial distributions
Localizations, , were manually associated with individual bacteria. If two or more bacteria were connected, the bacteria were not included in the analysis. In addition, to eliminate the possibility of treating multiple bacteria as single cells, and to lower the chance of having multiple chromosomes in a single cell, we limited our analysis to cells with lengths ≤3 μm. For each accepted bacterium, a new Cartesian coordinate system was set up such that the origin was the center-of-mass of all localizations in that cell, and that the x axis (long axis) was parallel to the vector connecting the two poles of the bacterium. The original localizations in each cell were then transformed (by translation and rotation ) into the new coordinate system, , as follows:
| (1) |
To perform a statistical analysis, bacteria of different lengths and widths were normalized, with , , while keeping the origins of the bacteria unchanged. The majority of localizations fell into the range of . A discretized probability of encountering a plasmid in a bin (or segment) along the long axis of a bacterium was then computed as , where is a Heaviside step function and N is the total number of localizations. Similarly, the probability was computed for the short axis of the cell, . With the normalized cell-length and cell-width, we averaged the probability map over different bacteria (n = 19 with cell lengths ≤3 μm). The two-dimensional (2D) probability map, , was similarly computed, but smoothed with a moving window (window size = three bins in each direction). In addition, to eliminate possible artifacts due to nonperfect symmetry in localizations, we also calculated the probability as a function of the absolute value of the localizations, .
Furthermore, we assessed the radial and angular distributions of the localizations. The angles of localizations, θ, defined between 0 and 2π (counterclockwise), were computed from the Cartesian coordinates of the localizations before cell-rescaling or normalization. The angular distribution was then calculated by . For the radial distribution, the cells were rescaled, and the radius was computed by . In addition, the probability was normalized by the area, , where .
Clustering analysis
We quantified the spatial clustering of the localizations using density-based spatial clustering of applications with noise (DBSCAN) (38, 39) and ordering points to identify the clustering structure (OPTICS) (40, 41). A radius (eps), and a threshold on the number of localizations (i.e., minPts, the minimum number of points within a radius eps for a point to be counted as a core point of a cluster), parameterize the cluster search. Based on reachability plots from OPTICS (40, 41), we chose minPts = 30 and eps = 15 nm in the clustering analysis of the localizations.
Results and Discussion
Quantitative localization microscopy with DNA smFISH
We first confirmed the conventional microscopy results that fluorescent foci appear inside the bacteria (Fig. 2, B and E). This observation is consistent with the literature (15, 16, 17). In addition to the foci, a diffuse background was also present. We should note that a similar background was previously observed and commented upon when imaging other hcn plasmids (15). It turns out, however, that the result from conventional microscopy is incomplete. Our single-molecule localization microscopy, in combination with DNA smFISH, revealed that a significant number of the plasmids did not appear as clusters; rather, they constituted the diffuse fluorescent background observed by conventional microscopy (Fig. 2, C and F).
Superresolved images were reconstructed based on the localization tables extracted from each data set. We estimated the precision/uncertainty of localization to be ∼10 nm (Fig. 2, G and H). The corresponding resolution was ∼24 nm (full width at half-maximum), ∼10× higher than that of conventional fluorescence microscopy. The final superresolved images were produced by rendering each localization as a normalized Gaussian peak, , with a standard deviation of 10 nm. Note that each rendered Gaussian, , represents the probability of finding a probe at location under the assumption that each detected probe results in a single-localization event. Multiple localizations could arise either from a blink that lasts several consecutive frames or from repeated blinks of a single dye. The first issue was prevented by regrouping localizations that appeared in adjacent frames and within a certain radius to each other (34), as discussed in the Materials and Methods; and the second was minimized by our choice of dye (we measured ∼1.2 blinks, on average, from a single ATTO-532 (see Fig. S4)). Constructing probability maps of the probe locations results in areas of high intensity where the single-probe probabilities overlap, which allows us to quantitatively analyze the localization microscopy images.
To quantify the level of nonspecific labeling by the DNA FISH probes, we performed negative control experiments imaging E. coli cells without the target plasmids (DH5α/pZA31luc, pZA31luc was used for antibiotic selection of the bacteria, while DH5α was selected as a suitable host cell, as previously chosen in Pogliano et al. (15)), but still labeled with fluorescent probes. Reconstructions of the negative controls were significantly different than for the positive sample. When using the same color scale as in the positive samples (Fig. 3 A), the superresolved images were nearly blank (Fig. 3 C). Conversely, if we greatly reduced the color scale, we saw a very low number of nonspecifically labeled probes in the negative controls, which are shown as white dots in Fig. 3 D. For comparison, the positive sample is shown with the same color scale in Fig. 3 B. Nonspecific labeling was quantified by counting the number of localizations per cell. We observed, on average, 28.1 ± 3.5 (mean ± SE, n = 10 cells; Fig. 3 E) localizations per cell in the negative controls, indicating that nonspecific labeling contributed only 1.3% to the total number of localizations in the positive samples (2284 ± 304 localizations per cell, n = 30; Fig. 3 E). As a result, almost all (>98%) of the localizations shown in the superresolved images were from specific labeling of the plasmids by the DNA FISH probes.
Figure 3.
Specificity of FISH probe labeling in bacteria. (A and B) The same superresolved image of the bacterium in Fig. 2, D–F, is displayed at two different color scales. (C and D) Negative controls (i.e., bacteria without target plasmids) labeled with FISH probes to assess nonspecific labeling. An example negative control bacterium is shown at the same color scale as the positive sample in (A) and (B), respectively. Nonspecific labeling is virtually absent (C) unless the color scale is set very low (D). (E) Nonspecific labeling was estimated quantitatively by comparing the numbers of localizations per cell for the positive samples and negative controls (mean ± SE = 2284 ± 304 [n = 30] vs. 28.1 ± 3.5 [n = 10]). Nonspecific labeling accounted for 1.3% of the total localizations. The scale bar in the images is 1 μm. To see this figure in color, go online.
In the absence of nonspecific labeling, detecting a probe is equivalent to detecting a plasmid, so areas of high-probability correlate with increased plasmid number. But due to the stochastic nature of labeling the plasmids, as well as the extended region over which the labels may bind, it is difficult to directly count the number of plasmids at a given location within the bacteria from the localization reconstruction. However, on average, more plasmids are present at the locations where the intensities are higher in the superresolved images.
Spatial distribution of hcn plasmids
Random distribution of hcn plasmids
We found that the plasmids were primarily randomly distributed along both the long and short axes of the bacteria (defined in Fig. 4 A). This can be qualitatively seen in the superresolved images of Fig. 2, C and F. To quantify this observation, we projected all localizations in a single bacterium onto either one of the dimensions (x or y) and calculated the probability of finding localizations along that axis. To obtain statistics from multiple bacteria, we first rescaled/normalized the cell lengths and widths to . After rescaling, we found both the long and short axis distributions to be flat (Fig. 4, C and D; the error bars stand for mean ± SE). A 2D probability map was also built (Fig. 4 B), showing a roughly even surface, with a low density pocket at the center of the cell.
Figure 4.
The spatial distribution of localizations in bacteria. (A) The origin was defined as the center-of-mass of all localizations (blue dots) in a cell. The long and short axes were defined as shown, along with the angle θ. (B) The 2D probability map of localizations averaged over 19 bacteria. (C and D) The averaged probabilities of localizations (black solid lines; error bars: mean ± SE) along the long and short axes obtained from 19 cells (colored dashed lines), showing clear plateaus. (E) Probability of localizations as a function of the absolute value of position along the long axis. (F) Angular probability of localizations. (G) Radial probability of localizations. Distributions are presented for the data (○, purple) and, for comparison, a model of random localizations (△, olive). To see this figure in color, go online.
We then compared the measured distribution of plasmids in bacteria to the case of a completely random distribution by numerical simulations. For each bacterium, a simulated cell was generated with a shape, as shown in Fig. 4 A, matching the length, width, and number of localizations measured within the bacterium. However, the simulated localizations were randomly distributed, giving a constant probability along the x axis (long axis), , shown in Fig. 4 E. There was little difference between the experimental results along the long axis and the simulated random distribution. In addition, the angular distribution of plasmids, , was the same (within error) as that of a random distribution (Fig. 4 F). Therefore, the spatial distribution of the plasmids was, on average, random both longitudinally and angularly.
In addition, not surprisingly, we observed a difference in the radial probability of plasmids, , between the experimental data and our simulations of the random model, as shown in Fig. 4 G. Unlike the constant plateau for the random model, the plasmid probability measured from experiments started at a lower value, increased steadily to as much as 200% higher, and then dropped. This last result reflects the exclusion of plasmids from the center of the bacteria.
Preference of plasmids to the cellular periphery
The radial distribution, , indicated a donut-shape for the distribution of plasmids in bacteria (after the cells were normalized). This observation of a hollow distribution can also be seen in the superresolved fluorescent images (Fig. 2, C and F) and the 2D probability map (Fig. 4 B). The peripheries of the bacteria in the superresolved images were visually brighter than the central regions. Likewise, the center of the 2D probability map showed a centrally located dip in occupancy.
This hollow distribution was supported quantitatively by examining discrete slices along the long and short axes of the cells. For the analysis, we utilized the superresolved image reconstructions, as the intensities were proportional to the probability that a plasmid was present. Two examples of the superresolved images of the cells are shown in Fig. 5, A and D, where the intensity profiles for two slices along the short axis (purple and olive boxes) and one slice along the long axis (cyan line) were plotted in the second (purple and olive lines) and third (black line) rows. The pattern of double peaks was obvious, clearly illustrating that plasmids were preferentially distributed at the periphery of the bacteria.
Figure 5.
Steric exclusion of plasmids by chromosomal DNA. (A and D) Two example cells shown as superresolved images. Scale bars = 500 nm. (B and E) Intensity profiles of the purple and olive regions in (A) and (D) are drawn along the short axis of the bacteria in the corresponding colors. (C and F) Smoothed intensity profiles of the cyan lines in (A) and (D) (window = 30 pixels). To see this figure in color, go online.
The observation is likely due to steric exclusion by the chromosomal DNA comprising the nucleoid, as observed in Reyes-Lamothe et al. (17). However, we should highlight a few key differences between our results and those of previous studies. First, past observations claimed that the chromosomal DNA completely excluded plasmids from the central region of the bacteria if a single nucleoid existed (15, 16, 17). In contrast, our experiments showed that, although partially excluded by the chromosomal DNA, routes for the plasmids appeared both along the periphery and through the central region of individual bacteria, which could facilitate plasmid transport between the two poles. Our results imply that the excluded volume of the nucleoid is amorphous, consistent with recent observations that also employed superresolved microscopy (42, 43, 44). Because of the existence of these passages, the movement of the plasmids did not necessarily correlate with nucleoid reshaping before cell division as proposed in Reyes-Lamothe et al. (17) to explain the observed accumulation of plasmids at the middle of the bacteria before cell division. Rather, many plasmids appeared to regularly traverse the nucleoid-occupied volume.
NND distribution of localizations
Investigating the nearest-neighbor distance (NND) distribution of the localizations indicates a significant amount of clustering of the FISH probes. We calculated the NND between localizations in individual bacteria from the first order to the 45th order (Fig. 6). The first-NND distribution was peaked at 1–2 nm (black arrows). This peak was due to multiple localization events from a single dye, which blinked, on average, 1.2 times, as shown in Fig. S4. However, with increasing orders of the NND distribution, two distinctive peaks emerged, one of which was at ∼7–10 nm (orange arrows), while the other (purple arrows) overlapped with the peak of the NND distribution for a model of random localizations (olive arrows). The peak at ∼7–10 nm suggests that many of the localizations were clustered, given that the number of blinks of a single dye was low (∼1.2) and that the peak was stable from the fifth to the 45th order of the NND. This clustering is indicative of having multiple probes hybridized to a single plasmid. Higher order clustering of plasmids, however, is difficult to quantify from this analysis.
Figure 6.
NND distributions (1st–45th orders) of localizations (purple, n = 19 bacteria) were compared to those of spatially random localizations (olive) in bacteria. To see this figure in color, go online.
Clustering of plasmids in bacteria
In an attempt to identify clusters of plasmids, we analyzed the data with DBSCAN (38, 39) and OPTICS (40, 41). DBSCAN is a density-based algorithm that directly identifies clusters within the data. OPTICS, on the other hand, is an extension of DBSCAN that better accounts for density variations within the data. While it does not directly identify clusters, OPTICS can provide useful information about clustering structures within the data (40, 41). Both algorithms (DBSCAN and OPTICS) have previously been used to analyze superresolution microscopy data (23, 45, 46, 47).
DBSCAN requires two parameters: minPts and eps (38, 39). Because the clustering output by DBSCAN is sensitive to these parameters (Fig. S5), we first determined the appropriate parameters for the clustering analysis using OPTICS and the associated reachability plots (40, 41). A reachability plot visualizes density fluctuations within the data and yields the number of clusters that would be found using a global value of eps (as in DBSCAN) (41). Several reachability plots from an example cell (Fig. 2 F) are presented in Figs. S6 and S7. These plots show a complex substructure within our data, which is expected because there is a hierarchy of clustering by the localizations (i.e., clustering of localizations from single, blinking fluorophores; clustering of localizations from a single plasmid; and clustering of localizations from clusters of multiple plasmids). However, finer substructures in the reachability plots can be filtered out by increasing minPts, which allowed us to focus on the clustering of plasmids (Fig. S6).
We also explored the robustness of the parameters in OPTICS and DBSCAN employing the number of clusters in a cell , from the reachability plots, as an indicator. For a given value of eps, we examined as a function of minPts and observed that quickly decays to a stable value (Fig. S8). Fitting the curves to an exponential function yields a decay constant, λ, of approximately half of eps (λ = 7.2 when eps = 15). Therefore, OPTICS and DBSCAN are fairly robust when the parameter minPts is above ∼20–25, validating our choice of parameters (minPts, eps) = (15, 30) in the clustering analysis that follows.
A spatial analysis reveals that the clusters were found distributed throughout the bacteria. When plotting the center-of-mass of the clusters along the long and short axes of the bacteria, the clusters were found to be distributed fairly uniformly along both axes (Fig. 7, A and B). This result differs from recent experiments where hcn plasmids were found to solely aggregate at the bacterial poles (16, 17), although it does agree with one previous observation (15). It is of interest to note that a uniform distribution of plasmid-clusters was also observed for ColE1-derivative plasmids, but ones that contained additional active partitioning systems were not present in our experiments (sopABC or incC korB) (16).
Figure 7.
Clustering analysis of localizations. Localizations in each bacterial cell were sorted into clusters by DBSCAN (minPts = 30, eps = 15). (A and B) Center-of-mass distribution of the clusters along the long and short axes of the bacteria (27 cells). The clusters were found distributed fairly uniformly along both axes. (C–E) The spread/dispersion of the clusters, and (F) the distribution of the radius of gyration .
The size of the clusters can be quantified by their mean radius of gyration = 35 nm, although the largest spread extended to >80 nm. An alternative parameterization of the cluster size is given by the standard deviation in x and y: nm and nm. The number of localizations per cluster has a mean of ∼340, and with a major peak ∼100 (Fig. S9). In addition, we found that, with (minPts, eps) = (30,15), at least one cluster was detected in 96% of all the cells, and the median number of clusters per cell was 4, indicating that it is common for the bacteria to have a mixture of clustered and unclustered populations.
We note that the detected clusters with (minPts, eps) = (30,15) are likely to be clusters of plasmids for the following two reasons. The first is that the distribution of with minPts = 30 deviates significantly from a continuous distribution observed with smaller minPts (e.g., minPts = 3), while the continuous distribution cannot account for the large foci population (Fig. S10). Secondly, the average number of localizations per cluster (∼340) significantly exceeds the average number of localizations per plasmid (∼46; see below for details).
While these large clusters had been previously identified (15, 16, 17), the number of plasmids in each foci was not quantified. Our results, based on single-molecule detection of the labeled probes, allowed us to roughly estimate the number of plasmids in typical foci. The idea is to count the number of localization events in the bright spots in the superresolved images (green and orange arrows in Fig. 2 F) that preserve the observed foci by conventional fluorescence microscopy (Fig. 2 E), and then use the count to estimate the number of plasmids in the cluster. A caveat to this analysis is that it relies on the number of acquired localizations, the uncertainty of which comes from many error sources—from both experiment (e.g., samples were not exhaustively photobleached) and analysis (e.g., the number of localizations varies with different thresholds and criteria for detecting and localizing single molecules).
Consider the bacterium in Fig. 2 F, enlarged in Fig. 8 A. We counted 827 localizations in the bright spot indicated by the green arrow. Based on the measured average number of blinks of ATTO-532, ∼1.2 (Fig. S4); the measured hybridization efficiency, ∼15%; and the maximum capacity of each plasmid for hybridized probes, 256; we estimate that each plasmid contributes ∼46 localization events, on average. This amounts to roughly 827/46 ≈ 18 plasmids in the foci. Similarly, we estimate that ∼310/46 ≈ 7 plasmids were present in the smaller foci indicated by the orange arrow in Fig. 8 A. We note that an estimation of the total plasmid copy number, from counts of the localization events (2284 ± 304)/46 ≈ 50 ± 7, is in surprisingly good agreement with independent bulk measurements by quantitative PCR (∼40). Given the mean number of localizations per cluster, the number of plasmids per cluster is ∼7 on average.
Figure 8.
Clustering of plasmids. (A) The bacterium in Fig. 2F is enlarged with two bright spots highlighted (green and orange arrows). Scale bar = 500 nm. The radii of the spots were manually determined as indicated by the green (r = 100 nm) and orange (r = 75 nm) circles. (B) Localizations inside the two bright spots were counted: 827 (purple) localizations inside the green circle, and 310 (blue) localizations inside the orange circle. (C) Probability distribution of the expected number of plasmids, in the large bright spot indicated by the green arrow in (A), assuming a hybridization efficiency of 15% (green) or 10% (purple). To see this figure in color, go online.
A more detailed approach, which yields the probability distribution for the expected number of plasmids in a foci given the number of measured localizations , can be attained by Bayesian inference: . Here is the effective number of fluorescent probes and we assume a flat prior (i.e., both and are uniform), which is equivalent to a maximum likelihood estimate. Because followed the binomial distribution, as observed in Fig. 1 B, we again estimate that it is most likely there were 18 plasmids clustered in the large foci indicated in Fig. 8 A (green arrow). Fig. 8 C showed the distribution of expected plasmid number, for the same cluster, for hybridization efficiencies of 15% and 10%. Note that our estimate provides a lower bound on the number of clustered plasmids for two reasons: first, due to the finite period for data acquisition, only a fraction of the fluorescent probes were localized; second, the in situ effective hybridization efficiency is expected to be lower than the measured in vitro value (see DNA Probe Hybridization Efficiency). At a hybridization efficiency of 10%, for example, the expected number of plasmids in the cluster was 27, as shown in Fig. 8 C.
Conclusion
To summarize, we investigated the spatial organization of a high-copy number ColE1-derivative plasmid in E. coli bacteria by quantitative localization microscopy in combination with DNA smFISH. We found that, while some plasmids did aggregate into large foci, the plasmids were, primarily, randomly distributed throughout the cell volume except in areas excluded by the chromosomal DNA. This result suggests that neither the previous random distribution model, nor the recent observations that hcn plasmids aggregate into discrete foci within bacteria, explains the range of behaviors utilized by hcn plasmids. Rather, our observations suggest that this plasmid displays a mixed distribution model of randomly diffusing plasmids and large clustered aggregates.
Randomly distributing a significant fraction of plasmids among a few large clusters should be an efficient enough mechanism to stably maintain the plasmid population over generations. This would alleviate the need to posit an undiscovered active mechanism unique to hcn plasmids, given the added cost and metabolic burden of both copying the plasmids to high-copy numbers and exogenously expressing genes for actively segregating the plasmids. Previous conventional microscopy experiments on hcn plasmids may have been unable to identify the fluorescence signal from plasmids that do not cluster into large foci. These additional plasmids, which here made up a majority of the population, may have been ignored as background when imaged in the presence of the high-intensity foci.
Of course, a natural question to ask is why should hcn plasmids employ such an organizational strategy; does it provide any additional benefits? One thought is that it could help the cell to reduce the level of cell-to-cell variability in plasmid copy number. Unfortunately, measuring this variability at a single-cell level has proven extremely difficult (48). However, these findings also imply a possible approach toward engineering the maintenance of hcn plasmids. For example, it might be possible, by adjusting the ratio of the random population to the clustering population, to prevent the persistence of harmful plasmids or enhance the retention of beneficial ones. Another thought is that the mixed distribution model of hcn plasmids in bacteria introduces a fitness benefit: the clustering population of plasmids enhances the efficiency of gene transcription (and/or translation), similar to transcription factories found in eukaryotic cells (49, 50). However, further experiments are needed to test this hypothesis.
Finally, our results provide further evidence that hcn plasmids are less constrained by the nucleoid than previously thought. Many of the plasmids were detected throughout the central volume of the cell, revealing pathways by which RNA and DNA may traverse the cell and interact with the chromosomal DNA. This result implies that the chromosomal DNA does not fully exclude plasmids and that the excluded volume of the nucleoid appears amorphous, which is consistent with recent observations using superresolved microscopy (42, 43, 44). It will be interesting to further explore the topological and morphological complexity of the bacterial chromosome by quantitative localization microscopy in the future.
Author Contributions
Y.W. and J.N.M. designed research; Y.W. and P.P. performed research; Y.W., J.N.M., and P.P. analyzed data; and Y.W. and J.N.M. wrote the article.
Acknowledgments
Bacteria strain (Stbl3/Lac-I-SceI-Tet) was a gift from Tom Misteli (Addgene plasmid No. 17655). We thank David McMillen for bacteria strain (DH5α/pZA31luc) and Uvaraj Uddayasankar for help with the FISH probe characterization.
This work was supported by the Human Frontier Science Program (grant No. LT000752/2014-C to Y.W.) and the Natural Sciences and Engineering Research Council of Canada (grant No. RGPIN 418251 to J.N.M. and P.P.).
Editor: David Rueda.
Footnotes
Ten figures are available at http://www.biophysj.org/biophysj/supplemental/S0006-3495(16)30480-5.
Contributor Information
Yong Wang, Email: yongwang@uark.edu.
Joshua N. Milstein, Email: josh.milstein@utoronto.ca.
Supporting Material
References
- 1.Diaz Ricci J.C., Hernández M.E. Plasmid effects on Escherichia coli metabolism. Crit. Rev. Biotechnol. 2000;20:79–108. doi: 10.1080/07388550008984167. [DOI] [PubMed] [Google Scholar]
- 2.Silva F., Queiroz J.A., Domingues F.C. Evaluating metabolic stress and plasmid stability in plasmid DNA production by Escherichia coli. Biotechnol. Adv. 2012;30:691–708. doi: 10.1016/j.biotechadv.2011.12.005. [DOI] [PubMed] [Google Scholar]
- 3.Coplin D.L. Plasmids and their role in the evolution of plant pathogenic bacteria. Annu. Rev. Phytopathol. 1989;27:187–212. [Google Scholar]
- 4.Vivian A., Murillo J., Jackson R.W. The roles of plasmids in phytopathogenic bacteria: mobile arsenals? Microbiology. 2001;147:763–780. doi: 10.1099/00221287-147-4-763. [DOI] [PubMed] [Google Scholar]
- 5.Thomas C.M., Nielsen K.M. Mechanisms of, and barriers to, horizontal gene transfer between bacteria. Nat. Rev. Microbiol. 2005;3:711–721. doi: 10.1038/nrmicro1234. [DOI] [PubMed] [Google Scholar]
- 6.Grabherr R., Bayer K. Impact of targeted vector design on Co/E1 plasmid replication. Trends Biotechnol. 2002;20:257–260. doi: 10.1016/s0167-7799(02)01950-9. [DOI] [PubMed] [Google Scholar]
- 7.Nordström K. Plasmid R1—replication and its control. Plasmid. 2006;55:1–26. doi: 10.1016/j.plasmid.2005.07.002. [DOI] [PubMed] [Google Scholar]
- 8.Salje J., Gayathri P., Löwe J. The ParMRC system: molecular mechanisms of plasmid segregation by actin-like filaments. Nat. Rev. Microbiol. 2010;8:683–692. doi: 10.1038/nrmicro2425. [DOI] [PubMed] [Google Scholar]
- 9.Thomas C.M. Paradigms of plasmid organization. Mol. Microbiol. 2000;37:485–491. doi: 10.1046/j.1365-2958.2000.02006.x. [DOI] [PubMed] [Google Scholar]
- 10.Watanabe E., Wachi M., Nagai K. ATPase activity of SopA, a protein essential for active partitioning of F plasmid. Mol. Gen. Genet. 1992;234:346–352. doi: 10.1007/BF00538693. [DOI] [PubMed] [Google Scholar]
- 11.Gerdes K., Howard M., Szardenings F. Pushing and pulling in prokaryotic DNA segregation. Cell. 2010;141:927–942. doi: 10.1016/j.cell.2010.05.033. [DOI] [PubMed] [Google Scholar]
- 12.Dmowski M., Jagura-Burdzy G. Active stable maintenance functions in low copy-number plasmids of Gram-positive bacteria. I. Partition systems. Pol. J. Microbiol. 2013;62:3–16. [PubMed] [Google Scholar]
- 13.Vieira J., Messing J. The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene. 1982;19:259–268. doi: 10.1016/0378-1119(82)90015-4. [DOI] [PubMed] [Google Scholar]
- 14.Summers D. Timing, self-control and a sense of direction are the secrets of multicopy plasmid stability. Mol. Microbiol. 1998;29:1137–1145. doi: 10.1046/j.1365-2958.1998.01012.x. [DOI] [PubMed] [Google Scholar]
- 15.Pogliano J., Ho T.Q., Helinski D.R. Multicopy plasmids are clustered and localized in Escherichia coli. Proc. Natl. Acad. Sci. USA. 2001;98:4486–4491. doi: 10.1073/pnas.081075798. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Yao S., Helinski D.R., Toukdarian A. Localization of the naturally occurring plasmid ColE1 at the cell pole. J. Bacteriol. 2007;189:1946–1953. doi: 10.1128/JB.01451-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Reyes-Lamothe R., Tran T., Tolmasky M.E. High-copy bacterial plasmids diffuse in the nucleoid-free space, replicate stochastically and are randomly partitioned at cell division. Nucleic Acids Res. 2014;42:1042–1051. doi: 10.1093/nar/gkt918. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Million-Weaver S., Camps M. Mechanisms of plasmid segregation: have multicopy plasmids been overlooked? Plasmid. 2014;75:27–36. doi: 10.1016/j.plasmid.2014.07.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Soutoglou E., Dorn J.F., Misteli T. Positional stability of single double-strand breaks in mammalian cells. Nat. Cell Biol. 2007;9:675–682. doi: 10.1038/ncb1591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Smith M.A., Bidochka M.J. Bacterial fitness and plasmid loss: the importance of culture conditions and plasmid size. Can. J. Microbiol. 1998;44:351–355. [PubMed] [Google Scholar]
- 21.So L.-H., Ghosh A., Golding I. General properties of transcriptional time series in Escherichia coli. Nat. Genet. 2011;43:554–560. doi: 10.1038/ng.821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Skinner S.O., Sepúlveda L.A., Golding I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nat. Protoc. 2013;8:1100–1113. doi: 10.1038/nprot.2013.066. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Fei J., Singh D., Ha T. RNA biochemistry. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 2015;347:1371–1374. doi: 10.1126/science.1258849. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Sambrook J., Russell D.W. 3rd Ed. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY: 2001. Molecular Cloning: A Laboratory Manual. [Google Scholar]
- 25.Skulj M., Okrslar V., Menart V. Improved determination of plasmid copy number using quantitative real-time PCR for monitoring fermentation processes. Microb. Cell Fact. 2008;7:6. doi: 10.1186/1475-2859-7-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ulbrich M.H., Isacoff E.Y. Subunit counting in membrane-bound proteins. Nat. Methods. 2007;4:319–321. doi: 10.1038/NMETH1024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Ji W., Xu P., Chen L. Functional stoichiometry of the unitary calcium-release-activated calcium channel. Proc. Natl. Acad. Sci. USA. 2008;105:13668–13673. doi: 10.1073/pnas.0806499105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Simonson P.D., Deberg H.A., Selvin P.R. Counting bungarotoxin binding sites of nicotinic acetylcholine receptors in mammalian cells with high signal/noise ratios. Biophys. J. 2010;99:L81–L83. doi: 10.1016/j.bpj.2010.08.076. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Aitken C.E., Marshall R.A., Puglisi J.D. An oxygen scavenging system for improvement of dye stability in single-molecule fluorescence experiments. Biophys. J. 2008;94:1826–1835. doi: 10.1529/biophysj.107.117689. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Heilemann M., van de Linde S., Sauer M. Subdiffraction-resolution fluorescence imaging with conventional fluorescent probes. Angew. Chem. Int. Ed. Engl. 2008;47:6172–6176. doi: 10.1002/anie.200802376. [DOI] [PubMed] [Google Scholar]
- 31.Heilemann M., van de Linde S., Sauer M. Super-resolution imaging with small organic fluorophores. Angew. Chem. Int. Ed. Engl. 2009;48:6903–6908. doi: 10.1002/anie.200902073. [DOI] [PubMed] [Google Scholar]
- 32.van de Linde S., Löschberger A., Sauer M. Direct stochastic optical reconstruction microscopy with standard fluorescent probes. Nat. Protoc. 2011;6:991–1009. doi: 10.1038/nprot.2011.336. [DOI] [PubMed] [Google Scholar]
- 33.Edelstein A., Amodaj N., Stuurman N. Current Protocols in Molecular Biology. John Wiley; Hoboken, NJ: 2010. Computer control of microscopes using Manager. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Coltharp C., Kessler R.P., Xiao J. Accurate construction of photoactivated localization microscopy (PALM) images for quantitative measurements. PLoS One. 2012;7:e51725. doi: 10.1371/journal.pone.0051725. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Mortensen K.I., Churchman L.S., Flyvbjerg H. Optimized localization analysis for single-molecule tracking and super-resolution microscopy. Nat. Methods. 2010;7:377–381. doi: 10.1038/nmeth.1447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Geisler C., Hotz T., Egner A. Drift estimation for single marker switching based imaging schemes. Opt. Express. 2012;20:7274–7289. doi: 10.1364/OE.20.007274. [DOI] [PubMed] [Google Scholar]
- 37.Wang Y., Schnitzbauer J., Huang B. Localization events-based sample drift correction for localization microscopy with redundant cross-correlation algorithm. Opt. Express. 2014;22:15982–15991. doi: 10.1364/OE.22.015982. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Ester, M., H. P. Kriegel, …, X. Xu. 1996. A density-based algorithm for discovering clusters in large spatial databases with noise. In Second International Conference on Knowledge Discovery and Data Mining. 226–231.
- 39.Daszykowski M., Walczak B., Massart D. Looking for natural patterns in data. Part 1. Density-based approach. Chemom. Intell. Lab. Syst. 2001;56:83–92. [Google Scholar]
- 40.Ankerst, M., M. M. Breunig, …, J. Sander. 1999. OPTICS: ordering points to identify the clustering structure. In SIGMOD ’99 Proceedings of the 1999 ACM SIGMOD International Conference on Management of Data. 28:49–60.
- 41.Daszykowski M., Walczak B., Massart D.L. Looking for natural patterns in analytical data. 2. Tracing local density with OPTICS. J. Chem. Inf. Comput. Sci. 2002;42:500–507. doi: 10.1021/ci010384s. [DOI] [PubMed] [Google Scholar]
- 42.Spahn C., Endesfelder U., Heilemann M. Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth. J. Struct. Biol. 2014;185:243–249. doi: 10.1016/j.jsb.2014.01.007. [DOI] [PubMed] [Google Scholar]
- 43.Bakshi S., Siryaporn A., Weisshaar J.C. Superresolution imaging of ribosomes and RNA polymerase in live Escherichia coli cells. Mol. Microbiol. 2012;85:21–38. doi: 10.1111/j.1365-2958.2012.08081.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Bakshi S., Dalrymple R.M., Weisshaar J.C. Partitioning of RNA polymerase activity in live Escherichia coli from analysis of single-molecule diffusive trajectories. Biophys. J. 2013;105:2676–2686. doi: 10.1016/j.bpj.2013.10.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Endesfelder U., Finan K., Heilemann M. Multiscale spatial organization of RNA polymerase in Escherichia coli. Biophys. J. 2013;105:172–181. doi: 10.1016/j.bpj.2013.05.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Nan X., Collisson E.A., Chu S. Single-molecule superresolution imaging allows quantitative analysis of RAF multimer formation and signaling. Proc. Natl. Acad. Sci. USA. 2013;110:18519–18524. doi: 10.1073/pnas.1318188110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Caetano F.A., Dirk B.S., Heit B. MIiSR: molecular interactions in super-resolution imaging enables the analysis of protein interactions, dynamics and formation of multi-protein structures. PLOS Comput. Biol. 2015;11:e1004634. doi: 10.1371/journal.pcbi.1004634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Tal S., Paulsson J. Evaluating quantitative methods for measuring plasmid copy numbers in single cells. Plasmid. 2012;67:167–173. doi: 10.1016/j.plasmid.2012.01.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Jackson D.A., Hassan A.B., Cook P.R. Visualization of focal sites of transcription within human nuclei. EMBO J. 1993;12:1059–1065. doi: 10.1002/j.1460-2075.1993.tb05747.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Hozák P., Hassan A.B., Cook P.R. Visualization of replication factories attached to nucleoskeleton. Cell. 1993;73:361–373. doi: 10.1016/0092-8674(93)90235-i. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








