Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Apr 6.
Published in final edited form as: J Agric Food Chem. 2016 Mar 28;64(13):2674–2681. doi: 10.1021/acs.jafc.6b00462

Arsenic Methylation in Arabidopsis thaliana Expressing an Algal Arsenite Methyltransferase Gene Increases Arsenic Phytotoxicity

Zhong Tang †, Yanling Lv †, Fei Chen †, Wenwen Zhang †, Barry P Rosen §, Fang-Jie Zhao †,Δ,*
PMCID: PMC4984539  NIHMSID: NIHMS808898  PMID: 26998776

Abstract

Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to As(III) in the medium, suggesting that DMA(V) is more phytotoxic than inorganic As. The study demonstrates a negative consequence of engineered As methylation in plants and points to a need for arsM genes with a strong ability to methylate As to volatile species.

Keywords: arsenic, arsenic methylation, arsenic speciation, As(III) S-adenosylmethyltransferase, phytotoxicity, Chlamydomonas reinhardtii, Arabidopsis thaliana

INTRODUCTION

Arsenic (As) is a nonessential and toxic metalloid. Arsenic in the environment comes from both geogenic and anthropogenic sources. Arsenic is released into the environment by human activities such as mining, smelting, burning of fossil fuels, and pesticide applications.1 It is ranked first in the Superfund List of Hazardous Substances by the U.S. Environmental Protection Agency (U.S. EPA) (http://www.atsdr.cdc.gov/cercla/07list.html). Excessive exposure to As can cause a number of health problems, such as skin and bladder cancers, diabetes, and cardiovascular diseases.2,3 Drinking water and food are the main sources of human As exposure.4,5 Rice is noticeable among the staple food items in containing relatively high concentrations of both total and inorganic As.1,6 It has been estimated that consumption of rice constitutes a large proportion (approximately 60%) of inorganic As ingestion for the populations in China and other Asian countries where rice is consumed as the primary source of caloric intake.7,8 Soil contamination with As can lead to further elevation of As accumulation in food crops such as rice.9,10 In some contaminated areas, crops can suffer from As toxicity, resulting in yield losses.11 Therefore, there is a need to develop strategies to clean up As-contaminated soil and to reduce As accumulation in food crops.

One potential strategy is to genetically engineer plants to enable them to methylate and volatilize As.12 Higher plants appear to be unable to methylate inorganic As to organic As species13,14 due to a lack of the genes responsible for As methylation.12 In contrast, some bacteria, fungi, algae, and animals are able to methylate As.15–19 Arsenic biomethylation in microbes is catalyzed by As(III) S-adenosylmethionine methyltransferase (ArsM), which is encoded by arsM genes.15 A number of microbial arsM genes have been functionally characterized.15,17,18,20–22 ArsM catalyzes sequential additions of methyl group to As(III), producing mono-, di-, and trimethyl arsenicals, with the end product trimethylarsine being volatile.15,22 When arsM is expressed in the As-sensitive strain of Escherichia coli, its resistance to As(III) is enhanced.15,17,18,20 Moreover, deletion of arsM from Pseudomonas alcaligenes results in a decreased As(III) resistance.20 These results suggest that As methylation is a detoxification mechanism in microorganisms.

The ability of ArsM to transform As species and produce volatile As may be used in bioremediation strategies. Recently, Chen et al.23 genetically engineered a strain of the soil bacterium Pseudomonas putida KT2440 with the arsM gene from Rhodopseudomonas palustris and showed that the modified bacterium could methylate and volatilize As from a contaminated soil. Huang et al.24 transferred the arsM gene from the thermophilic alga Cyanidioschyzon merolae to Bacillus subtilis and showed that the modified bacterium could methylate and volatilize As at high temperatures during composting of organic wastes. In a previous study, Meng et al.25 expressed the arsM gene from the soil bacterium R. palustris in rice and showed that the transgenic rice produced substantially more volatile As than the nontransgenic control plants. However, the overall efficiency of As methylation and volatilization was still very low.

In the present study, we hypothesized that genetically engineering plants with a eukaryotic arsM gene could produce a high efficiency of As methylation. To test this hypothesis, two ecotypes of Arabidopsis thaliana differing in As accumulation and distribution were used to construct transgenic plants with the arsM gene from the alga Chlamydomonas reinhardtii. We showed that the transgenic plants generated acquired a strong ability to methylate As(III) to DMA(V) but also became more sensitive to As toxicity.

MATERIALS AND METHODS

Plasmid Construction and Plant Transformation

The CrarsM gene, encoding the As(III) S-adenosylmethionine methyltransferase from the eukaryotic green alga C. reinhardtii, was cloned from the plasmid pBAM1-CrarsM-gfp generated by Chen et al.26 The CrArsM gene was amplified by PCR using the forward primer P1 (5′-GAGGCGCGCCATGGTGGAGCCGGCTTCCA-3′), with an AscI site incorporated into the 5′ end, and the reverse primer P2 (5′-AGTTAATTAATCAGCAGCAGGCGCCGCCGG-3′), which introduces a PacI site at the 3′ end. After AscI and PacI digestion, the fragment was cloned into the AscI/PacI sites under the control of a double cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (nos) 3′ terminator in the pMDC32 vector. Details of this binary plant expression vector are described by Curtis and Grossniklaus.27 The structure of the CrarsM expression cassette is shown in the Supporting Information, Figure S1a. For in planta expression, the plasmid was transformed into Agrobacterium tumefaciens strain GV3101 and further used to transform the A. thaliana ecotypes Col-0 and Kr-0 (wild-type, WT) by the floral dip method.28 Kr-0 accumulates much more inorganic As in the shoots than Col-0 as a result of the loss-of-function mutation in the arsenate reductase HAC1.29 Transgenic lines were screened on ½ MS medium containing 50 μg mL−1 hygromycin. Hygromycin-resistant plants were then transplanted into soil pots and grown to maturity for production of seeds.

DNA Isolation and PCR Analysis

Total genomic DNA was extracted from the leaves of the T0 generation transgenic plants and nontransgenic controls using a cetyl triethylammonium bromide (CTAB) method.30 Transgenic lines were further screened by PCR analysis using genomic DNA as a template. The PCR program for the amplification of arsM gene was carried out under the following conditions: 5 min at 95 °C, 30 cycles of 30 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C, followed by 7 min at 72 °C, using a forward primer (5′-ATGCCCACTGACATGCAAGAC-3′) and a reverse primer (5′-TCACCCGCAGCAGCGCGCCG-3′).

RNA Isolation and RT-PCR Analysis

Total RNA was isolated from roots and shoots of the T2 generation Arabidopsis plants using Plant Total RNA Extraction Kit (BioTeke, Beijing, China) following the manufacturer's protocol. One microgram of total RNA was used to synthesize the first-strand cDNAs by using a HiScript first Strand cDNA Synthesis Kit (Vazyme) according to the manufacturer's protocol. The semiquantitative RT-PCR for the detection of CrarsM expression in transgenic plants was performed using a forward primer (5′-ATGCCCACTGACATGCAAGAC-3′) and a reverse primer (5′-TCACCCGCAGCAGCGCGCCG-3′). The PCR program for the amplification was carried out under the following conditions: 5 min at 95 °C, 26–30 cycles of 30 s at 94 °C, 30 s at 55 °C, and 60 s at 72 °C, followed by 7 min at 72 °C. The AtACTIN gene was used as the internal control in the semiquantitative RT-PCR and amplified using a forward (CTACGAGCAAGAGCTAGAGAC) primer and a reverse (GGATTCCAGGAGCTTCCATTC) primer. All PCR products were checked by electrophoresis and sequenced by Genscript (Nanjing, China) to confirm their identities. For further experiments, two independent transgenic lines each in the Col-0 or Kr-0 background with stable expression of the CrarsM gene were selected. Three biological and three technical replicates were used in all experiments.

Plant Culture and As Treatments

To investigate if transgenic A. thaliana plants expressing CrarsM can methylate As, hydroponic experiments were conducted by growing 3-week-old WT and transgenic plants in plastic boxes containing 3 L of 110 Hoagland nutrient solution with 10 μM As(III) for 24 h or with 10 and 25 μM As(III) for 3 days. Each plastic box contained 12 plants of WT and transgenic plants. Each As treatment was replicated in three boxes. The composition of the nutrient solution was as follows: 0.6 mM KNO3, 0.4 mM (NH4)2HPO4, 0.1 mM MgSO4, 0.4 mM Ca(NO3)2, 2 μM H3BO3, 0.06 μM CuSO4, 0.36 μM MnCl2, 0.1 μM ZnSO4, 0.04 μM NaMoO4, and 20 μM FeNaEDTA. The solution pH was buffered at 5.5 with 2 mM 2-(N-morpholino)ethanesulfonic acid (MES) (pH adjusted with KOH). The nutrient solution was renewed every 3 days. At the end of the experiment, roots were separated from shoots, rinsed with deionized water, and submerged in an ice-cold desorption solution (1 mM K2HPO4, 0.5 mM Ca(NO3)2, and 5 mM MES, pH 6.0) for 15 min with periodic shaking to remove apoplastic As.31 Samples were blotted dry, weighed, and ground in liquid nitrogen using a pestle and mortar. A phosphate buffer solution (PBS; 2 mM NaH2PO4 and 0.2 mM Na2-EDTA, pH 6.0) was added to the finely ground shoot and root samples, sonicated for 1 h, and then centrifuged at 10000g for 10 min at 4 °C; the supernatant was filtrred through a 0.2 μm filter membrane for As speciation analysis by HPLC-ICP-MS.

Arsenic Tolerance Assay

To test if the expression of CrarsM affects As tolerance in A. thaliana, seeds of transgenic and WT plants were surface sterilized with 8% NaClO for 10 min, washed three times with sterilized deionized water, and sown on ½ strength Murashige and Skoog (MS, HaiBo, China) medium solidified with 1% phytagel agar (Sigma-Aldrich, St. Louis, MO, USA) with As(III) (NaAsO2) concentrations of 0, 10, 20, and 30 μM (pH adjusted to 5.6 with 1 M KOH) in Petri plates. Each As concentration was replicated in four plates. Seeds on plates were stratified at 4 °C for 3 days to facilitate uniform germination. Seedlings were grown vertically on the plates in a 16/8 h day/night photoperiod at 22–25 °C for 20 days before root length and shoot biomass were measured.

Chemotrapping of Volatile As from Transgenic Arabidopsis Plants

Volatile arsenicals released from WT and transgenic A. thaliana plants were trapped using the method described by Meng et al.25 Silica gel tubes were prepared as follows: silica gel was immersed in 5% (v/v) HNO3 overnight, washed with deionized water, and then impregnated with 10% AgNO3 solution (w/v) in an aluminum foil-wrapped glass jar, and placed in an oven overnight or longer at 70 °C to remove H2O. Next, the AgNO3- impregnated silica gel was loaded into a 3 mL buret and held in by a small quantity of quartz wool at each end. The tube was covered with aluminum foil to avoid photodecomposition of silver nitrate. Three-week-old WT and transgenic plants grown hydroponically were transferred to a 1 L plastic beaker containing 110 Hoagland nutrient solution containing 10 μM As(III). Each plastic beaker contained seven plants and was placed inside a hermetical chamber (20 × 20 × 35 cm, length × width × height) made of poly(methyl methacrylate) with two tubules (0.5 cm diameter, 3 cm length) at the bottom and top, respectively, and a lid that could be removed from the top. The silica gel tube was connected to the top tubule, and an air pump (ACO-008; 2 W power) was connected to the bottom tubule to maintain an air flow toward to the silica gel tube. Two chemotrap controls were included with only the nutrient solution in the plastic beaker (no plants) to determine the background concentration of As in the assay. All of the chambers were placed in a phytotron with a 16/8 h day/night photoperiod at 22–25 °C. Collection of volatile As lasted for 7 days, during which the nutrient solution was changed every 3 days. After 7 days, the silica gel tubes were removed. Arsenic species trapped by the silica gel were eluted in 1% HNO3 using a microwave digestion system (CEM Microwave Technology Ltd., Matthews, NC, USA). The working program was as follows: 55 °C for 10 min, 75 °C for 10 min, and 95 °C for 30 min, with 5 min ramp time between each stage. The supernatant was filtered through a 0.22 μm filter, and 10% (v/v) H2O2 solution (final concentration) was added to oxidize As(III) to As(V) prior to As species analysis.

Chemotrapping of Volatile As from Algal cells

C. reinhardtii CC125 cells (obtained from Guangyu Biotechnology Co., Shanghai, China) were grown mixotrophically with shaking at 120 rpm in 250 mL flasks containing 150 mL of a Tris–acetate–phosphate (TAP) culture medium at 25 °C, under continuous illumination with 80 μmol photons m−2 s−1 from fluorescent tubes. Cells were grown to the midlogarithmic phase (A730 = 0.5, cell count of 1 × 106 cells mL−1), and the cell suspensions were diluted by 50-fold into 150 mL of TAP medium containing different concentration of As(III) (0, 1, 13, or 130 μM, each with three replicates) in 250 mL flasks. The flasks were placed on a rotary shaker for 5 days in the light. Volatile As species were trapped as described above. At the end of the experiment, the trapped volatile As was eluted and analyzed. In addition, aliquots of the culture medium were sampled and centrifuged at 12000g. The supernatants were filtered through a 0.22 μm filter membrane and 10% (v/v) H2O2 solution (final concentration) was added to oxidize As(III) to As(V) prior to As species analysis.

Arsenic Speciation Analysis

Arsenic speciation was determined by using ICP-MS (PerkinElmer NexION 300X, USA) hyphenated to high-performance liquid chromatography (HPLC) as described previously.20 Arsenic species were separated using an anion exchange column (Hamilton PRP X-100, 250 mm diameter). A solution containing 8.5 mM each of NH4H2PO4 and NH4NO3 (pH 6.0) was used as the mobile phase, which was pumped through the column isocratically at a flow rate of 1 mL min−1. Indium, prepared from a high-purity stock solution supplied from PerkinElmer (USA), was added to the postcolumn solution and measured by ICP-MS as the internal standard. ICP-MS was set up in the He gas collision mode to minimize polyatomic interferences on m/z 75 (As). Arsenic species in the samples were identified by comparing their retention times with those of the standards, including arsenite [As(III)], arsenate [As(V)], dimethylarsenate [DMAs(V)], monomethylarsonate [MAs(V)], and trimethylarsenic oxide [TMAs(V)O], and quantified by external calibration curves with peak areas.

Data Analysis

The significance of the treatment effects was assessed by analysis of variance (ANOVA), followed by comparisons between treatment means using the least significant difference (LSD) at the probability of P < 0.05. Statistical analyses were performed using SPSS18.0.

RESULTS

Identification of Transgenic A. thaliana Plants

The gene encoding As(III) S-adenosylmethionine methyltransferase from C. reinhardtii (CrarsM) was expressed in two ecotypes of A. thaliana under the control of the CaMV 35S promoter (Supporting Information, Figure S1a). After hygromycin selection on MS basal medium, PCR was performed with DNA isolated from leaf tissues of the T0 generation. Six independent transgenic lines in the background of Col-0 or Kr-0 were confirmed by PCR analysis using gene-specific oligonucleotides (Supporting Information, Figure S1b); these were named CL1–CL6 and KL1–KL6, respectively. Three transgenic lines in each background were grown to the T2 generation. Semiquantitative RT-PCR analysis showed that CrarsM was highly expressed in both the leaves and roots of the transgenic A. thaliana plants (Supporting Information, Figure S1c). Sequencing DNA products obtained by PCR and RTPCR from the transgenic plants showed 100% sequence identity at the nucleotide level with the CrarsM gene. No CrarsM transcripts were detected in WT plants. The T3 generations of two lines each in the background of Col-0 (CL1 and CL2) or Kr-0 (KL1 and KL2) and their WT control plants were used for further experiments.

Arsenic Methylation in Transgenic A. thaliana Expressing CrarsM

To determine if transgenic A. thaliana plants expressing an algal As(III) methyltransferase gene (CrarsM) are able to methylate As, 3-week-old transgenic and WT plants were exposed to 10 μM As(III) for 24 h, and As speciation was quantified by using HPLC-ICP-MS. As(III) was the only As species detected in the shoots or roots of either Col-0 or Kr-0 WT plants (Figure 1). In contrast, DMA(V) was the predominant As species in the CrarsM transgenic plants in both the Col-0 and Kr-0 background (Figure 1a). DMA(V) accounted for 93–100 and 94–96% of the total As in the shoots of the transgenic plants in the Col-0 and Kr-0 background, respectively, with the remainder being As(III) (Figure 2a). DMA(V) was also detected in the roots of the transgenic plants (Figure 1b), but it accounted for only 1.0–2.0% of the total As (Figure 2b). Total As concentration in either roots or shoots did not differ significantly between WT and transgenic plants. No MMA(V) or As(V) was detected in the shoots and roots of the CrarsM transgenic A. thaliana and the nontransgenic control (Figure 1). Kr-0 WT plants accumulated much more As in the shoots than Col-0 plants, and this ecotypic difference was maintained in the transgenic plants even though most of the As(III) in shoots had been transformed to DMA(V) (Figure 2a). Because the difference in As accumulation between Kr-0 and Col-0 is manifest only when plant roots are exposed to As(V),29 some of the As(III) added to the medium might have been oxidized and taken up by roots as As(V), which would be reduced to As(III) inside plant cells. The results demonstrate that the transgenic A. thaliana plants expressing the CrarsM gene gained the ability to methylate As(III) to DMA(V) in vivo and efficiently.

Figure 1.

Figure 1

High-performance liquid chromatography–inductively coupled plasma mass spectrometry (HPLC-ICP-MS) chromatograms of arsenic speciation in the (a) shoots and (b) roots of transgenic A. thaliana expressing CrarsM. CPS, counts per second. The standards contain 15 μg L−1 of mixed arsenite (As(III)), dimethylarsenate (DMA(V)), monomethylarsenate (MMA(V)), and arsenate (As(V)). The control blank contains 1% HNO3 only.

Figure 2.

Figure 2

Arsenic speciation and concentrations in the (a) shoots and (b) roots of CrarsM transgenic A. thaliana and wild-type (WT) plants exposed to 10 μM As(III) for 24 h. Data are means ± SE (n = 3). Numbers above bars are the percentages of DMA(V) in the total As.

In a further experiment, plants were exposed to 10 or 25 μM As(III) for a longer period (3 days). Arsenic speciation in the roots and shoots was generally similar to those obtained in the first experiment, with DMA(V) being the predominant (71–94%) As species in the shoots and a minor (1.2–1.4%) As species in the roots of transgenic plants (Figure 3). In addition, small amounts of MMA(V) were detected in the shoots of the transgenic plants in the Kr-0 background, accounting for 2.6–3.6% of the total As in the shoot tissues. MMA(V) was not detected in the transgenic plants in the Col-0 background. In the 3 day exposure experiment, small amounts of As(V) were detected in both the shoots and roots of all the transgenic and nontransgenic plants (Figure 3), suggesting some oxidation of As(III) to As(V).

Figure 3.

Figure 3

Arsenic speciation and concentrations in the (a, c) shoots and (b, d) roots of CrarsM transgenic A. thaliana and wild-type (WT) plants exposed to 10 μM (a, b) and (c, d) 25 μM As(III) for 3 days. Data are means ± SE (n = 4).

Quantification of Volatile Arsenicals in CrarsM Transgenic A. thaliana

To quantify As volatilization, the transgenic plants expressing CrarsM and WT plants were grown in hydroponic culture amended with 10 μM As(III), and volatile arsenicals were collected for 7 days using AgNO3-impregnated silica gel tubes. A very small peak of TMAO, which is the product of TMA(III) oxidation by AgNO3 in the silica gel, was detected from the transgenic plants in the Col-0 background (Figure 4a). The amount of TMA(III) emitted, 0.25 ng of As per plant, was very small, accounting for about 0.01% of the total As in the transgenic plants (Figure 4b). No volatile As species were detected in the CrarsM transgenic plants in the Kr-0 background or in the nontransgenic control.

Figure 4.

Figure 4

Quantification of volatile arsenicals in the chemotraps from transgenic A. thaliana plants with 7 days of exposure to 10 μM As(III): (a) HPLC-ICP-MS chromatograms of volatile arsenicals trapped from the transgenic A. thaliana; (b) amount of volatile arsenicals per plant. Data are means ± SE (n = 3 for wild-type (Col-0), n = 7 for transgenic lines).

Arsenic Volatilization in C. reinhardtii

To investigate if the low As volatilization efficiency observed in the CrarsM transgenic plants of A. thaliana reflects the inherent catalytic ability of the CrArsM enzyme in C. reinhardtii, volatile As species produced by the algal cells grown with different levels of As(III) were collected for 5 days. The amounts of volatile arsenicals emitted by C. reinhardtii were very small, ranging from 3.4 to 5.5 ng per flask with no apparent increase with the increasing As(III) concentration from 1 to 130 μM in the culture medium (Figure 5a). The amounts of volatile arsenicals represented 0.02–0.03% of the total As(III) added to the medium. The form of volatile As was found to be dimethylarsine. Arsenic speciation was also determined in the culture medium. DMA(V) was detected in the 1 μM As(III) treatment solution, whereas TMAO was found in the 13 and 130 μM As(III) treatments (Figure 5b). The amount of methylated As in the medium increased with the increasing As(III) concentration, but the proportion remained relatively stable at 5.9–7.4% of the total As(III) added to the medium.

Figure 5.

Figure 5

Quantification of volatile arsenicals in the chemotraps from C. reinhardtii algal cells with 5 days of exposure to different levels of As(III): (a) volatile arsenicals trapped from C. reinhardtii; (b) methylated and arsenicals in the culture medium. Data are means ± SE (n = 3).

Heterologous Expression of CrarsM Increases Arsenic Toxicity in A. thaliana

Unexpectedly, expression of CrarsM in A. thaliana was found to sensitize the transgenic plants toward As(III) (Figure 6a). In the absence of As(III), transgenic plants and their WT grew similarly on agar plates, indicating that neither the insertion nor the expression of CrarsM was deleterious. In the presence of 10–30 μM As(III), both shoot biomass and root length were inhibited significantly more in the transgenic plants than the WT control (Figure 6b–e). For example, in the presence of As(III), plant biomass (fresh weight) of the Col-0 and Kr-0 WT was inhibited by 10 μM As(III) by 30 and 25%, respectively, whereas the corresponding transgenic lines were inhibited by 65–70 and 50–65%, respectively. Similarly, root elongation of the Col-0 and Kr-0 WT plants was inhibited by 10 μM As(III) by 28 and 20%, respectively, compared to 58–63 and 54–55% of inhibition in the corresponding transgenic lines.

Figure 6.

Figure 6

Increased arsenic toxicity in transgenic A. thaliana plants expressing CrarsM: (a) growth of A. thaliana wild-type (Col-0 and Kr-0) and two lines expressing CrarsM in the Col-0 background (lines CL1 and CL2) and Kr-0 background (lines KL1 and KL2); (b, c) fresh weight and (d, e) root length relative to the no-As control. Data are means ± SE from three independent assays. Different letters above the bars indicate significant differences between genotypes at P < 0.05 for each treatment using a one-way ANOVA test.

DISCUSSION

In the present study, we show that transgenic A. thaliana plants expressing the algal CrarsM gene driven by the CaMV 35S promoter can methylate As efficiently, converting most of the As in the shoot tissues into DMA(V) (Figures 1–3). In contrast, nontrangenic A. thaliana plants had no detectable methylated As species, consistent with previous reports that higher plants lack the As methylation ability.13,14 Previously, Meng et al.25 genetically engineered a bacterial arsM gene into rice using the CaMV 35S promoter. However, their transgenic rice plants were inefficient at As methylation, with methylated As species accounting for only about 0.2–0.9% of the total As in the shoots. The difference may be explained by the nature of the prokaryotic gene used in the study of Meng et al.,25 which may require codon optimization to achieve an efficient expression in higher plants. In contrast, the arsM gene used in our study was from a eukaryotic organism, and the transgene was highly expressed in the transgenic plants.

Despite the CrarsM transgene being highly expressed in both roots and shoots of A. thaliana, most of the methylated As was found to be in the shoot tissues (Figures 2 and 3). This distribution pattern was observed in the transgenic plants in both the Col-0 and Kr-0 backgrounds, which differ markedly in the distribution of As from roots to shoots. The high DMA(V) concentration in shoots could be explained by two possible reasons. First, the activity of the CrArsM enzyme could be higher in the shoots than in the roots of the transgenic plants due to a more abundant supply of methyl donor and/or reductant required for As methylation. Second, methylated As produced in roots could be transported to shoots. It is known that DMA(V) is highly effciently transported from roots to shoots in plants.32–34

DMA(V) was found to be the main product of As methylation catalyzed by CrArsM in transgenic A. thaliana exposed to a range of As(III) concentrations (Figure 3). In comparison, C. reinhardtii produced DMA(V) when exposed to a low concentration of As(III) but TMAO when exposed to high concentrations of As(III) (Figure 5b). Whereas the efficiency of As methylation was very high in the transgenic A. thaliana plants, very little of volatile As was produced (Figure 4). Consistent with this observation, there were generally no significant differences between transgenic and nontransgenic plants in the total concentration of As in roots or shoots, suggesting small losses of As from the transgenic plants. Similarly, C. reinhardtii also produced very little volatile As (Figure 5a). The reason for the low As volatilization could be because the CrArsM enzyme expressed in A. thaliana was not efficient at catalyzing the final step of As methylation from nonvolatile DMA to volatile TMA. Even though C. reinhardtii was able to methylate As to TMA at a high As(III) exposure, most of the TMA appeared to be oxidized to the nonvolatile TMAO(V) and extruded to the culture medium. The efficiency of As methylation and volatilization varies widely among different microorganisms,19 possibly due to differences in the ArsM enzymes. In future studies, it may be possible to employ microbial arsM genes that have a more efficient As volatilization capacity to increase As volatilization in engineered plants.

Surprisingly, transgenic plants were more sensitive to As(III) in the medium than in WT plants (Figure 6). It is generally thought that pentavalent methylated As species are less toxic than inorganic As.35–37 However, this conclusion is largely based on experiments with animal cells.35–37 In higher plants, there is strong evidence that DMA(V) is more toxic than inorganic As because DMA(V) cannot be detoxified via the pathway of thiol complexation and subsequent vacuolar sequestration that is the main detoxification mechanism for inorganic As.38 Moreover, DMA(V) accumulates preferentially in shoots, causing oxidative stress to shoot tissues.38 DMA(V) has been used as a herbicide and defoliant owing to its phytotoxicity.39 It is possible that DMA(III), an intermediate of As methylation,40 exerts the toxicity to plants instead of DMA(V), because DMA(III) is known to be much more cytotoxic than DMA(V).36 DMA(III) is, however, unstable and may be oxidized to DMA(V) during extraction and analysis.41 In microorganisms, there is evidence that As methylation is indeed a detoxification mechanism.15,20,22,26 This is probably because microbes are able to get rid of methylated As products through volatilization or extrusion to the external medium. In contrast, DMA(V) produced in the shoots of the CrarsM transgenic plants likely stays trapped inside the cells.

The present study demonstrates a negative aspect of engineered As methylation in plants. In the future, it would be interesting to explore the possibility of engineering plants with arsM genes that are more efficient at producing volatile arsenicals as a way of decreasing As accumulation in plants.

Supplementary Material

Supplement

Acknowledgments

Funding

The study was funded by the National Natural Science Foundation of China (Grants 41330853, 31401936), the Fundamental Research Funds for the Central Universities (KYZ201521), the Innovative Research Team Development Plan of the Ministry of Education of China (Grant IRT1256), and the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Footnotes

Supporting Information

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/acs.jafc.6b00462.

Construction and identification of transgenic Arabidopsis thaliana plants expressing CrarsM (PDF)

The authors declare no competing financial interest.

REFERENCES

  • 1.Zhao FJ, McGrath SP, Meharg AA. Arsenic as a food-chain contaminant: mechanisms of plant uptake and metabolism and mitigation strategies. Annu. Rev. Plant Biol. 2010;61:535–559. doi: 10.1146/annurev-arplant-042809-112152. [DOI] [PubMed] [Google Scholar]
  • 2.Tchounwou PB, Centeno JA, Patlolla AK. Arsenic toxicity, mutagenesis, and carcinogenesis a health risk assessment and management approach. Mol. Cell. Biochem. 2004;255:47–55. doi: 10.1023/b:mcbi.0000007260.32981.b9. [DOI] [PubMed] [Google Scholar]
  • 3.Hettick BE, Canas-Carrell JE, French AD, Klein DM. Arsenic: a review of the element's toxicity, plant interactions, and potential methods of remediation. J. Agric. Food Chem. 2015;63:7097–7107. doi: 10.1021/acs.jafc.5b02487. [DOI] [PubMed] [Google Scholar]
  • 4.Flanagan SV, Johnston RB, Zheng Y. Arsenic in tube well water in Bangladesh: health and economic impacts and implications for arsenic mitigation. Bull. W.H.O. 2012;90:839–846. doi: 10.2471/BLT.11.101253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kile ML, Houseman EA, Breton CV, Smith T, Quamruzzaman O, Rahman M, Mahiuddin G, Christiani DC. Dietary arsenic exposure in Bangladesh. Environ. Health Perspect. 2007;115:889–893. doi: 10.1289/ehp.9462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Meharg AA, Williams PN, Adomako E, Lawgali YY, Deacon C, Villada A, Cambell RCJ, Sun G, Zhu YG, Feldmann J, Raab A, Zhao FJ, Islam R, Hossain S, Yanai J. Geographical variation in total and inorganic arsenic content of polished (white) rice. Environ. Sci. Technol. 2009;43:1612–1617. doi: 10.1021/es802612a. [DOI] [PubMed] [Google Scholar]
  • 7.Li G, Sun G-X, Williams PN, Nunes L, Zhu YG. Inorganic arsenic in Chinese food and its cancer risk. Environ. Int. 2011;37:1219–1225. doi: 10.1016/j.envint.2011.05.007. [DOI] [PubMed] [Google Scholar]
  • 8.Mondal D, Polya DA. Rice is a major exposure route for arsenic in Chakdaha block, Nadia district, West Bengal, India: a probabilistic risk assessment. Appl. Geochem. 2008;23:2987–2998. [Google Scholar]
  • 9.Meharg AA, Rahman M. Arsenic contamination of Bangladesh paddy field soils: Implications for rice contribution to arsenic consumption. Environ. Sci. Technol. 2003;37:229–234. doi: 10.1021/es0259842. [DOI] [PubMed] [Google Scholar]
  • 10.Zhu YG, Sun GX, Lei M, Teng M, Liu YX, Chen NC, Wang LH, Carey AM, Deacon C, Raab A, Meharg AA, Williams PN. High percentage inorganic arsenic content of mining impacted and nonimpacted Chinese rice. Environ. Sci. Technol. 2008;42:5008–5013. doi: 10.1021/es8001103. [DOI] [PubMed] [Google Scholar]
  • 11.Panaullah GM, Alam T, Hossain MB, Loeppert RH, Lauren JG, Meisner CA, Ahmed ZU, Duxbury JM. Arsenic toxicity to rice (Oryza sativa L.) in Bangladesh. Plant Soil. 2009;317:31–39. [Google Scholar]
  • 12.Ye J, Rensing C, Rosen BP, Zhu YG. Arsenic biomethylation by photosynthetic organisms. Trends Plant Sci. 2012;17:155–162. doi: 10.1016/j.tplants.2011.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Lomax C, Liu WJ, Wu L, Xue K, Xiong J, Zhou J, McGrath SP, Meharg AA, Miller AJ, Zhao FJ. Methylated arsenic species in plants originate from soil microorganisms. New Phytol. 2012;193:665–672. doi: 10.1111/j.1469-8137.2011.03956.x. [DOI] [PubMed] [Google Scholar]
  • 14.Zhao FJ, Zhu YG, Meharg AA. Methylated arsenic species in rice: geographical variation, origin, and uptake mechanisms. Environ. Sci. Technol. 2013;47:3957–3966. doi: 10.1021/es304295n. [DOI] [PubMed] [Google Scholar]
  • 15.Qin J, Rosen BP, Zhang Y, Wang GJ, Franke S, Rensing C. Arsenic detoxification and evolution of trimethylarsine gas by a microbial arsenite S-adenosylmethionine methyltransferase. Proc. Natl. Acad. Sci. U.S.A. 2006;103:2075–2080. doi: 10.1073/pnas.0506836103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Miyashita S, Fujiwara S, Tsuzuki M, Kaise T. Rapid biotransformation of arsenate into oxo-arsenosugars by a freshwater unicellular green alga, Chlamydomonas reinhardtii. Biosci. Biotechnol. Biochem. 2011;75:522–30. doi: 10.1271/bbb.100751. [DOI] [PubMed] [Google Scholar]
  • 17.Kuramata M, Sakakibara F, Kataoka R, Abe T, Asano M, Baba K, Takagi K, Ishikawa S. Arsenic biotransformation by Streptomyces sp isolated from rice rhizosphere. Environ. Microbiol. 2015;17:1897–1909. doi: 10.1111/1462-2920.12572. [DOI] [PubMed] [Google Scholar]
  • 18.Ye J, Chang Y, Yan Y, Xiong J, Xue XM, Yuan D, Sun GX, Zhu YG, Miao W. Identification and characterization of the arsenite methyltransferase from a protozoan, Tetrahymena pyriformis. Aquat. Toxicol. 2014;149:50–57. doi: 10.1016/j.aquatox.2014.01.028. [DOI] [PubMed] [Google Scholar]
  • 19.Bentley R, Chasteen TG. Microbial methylation of metalloids: arsenic, antimony, and bismuth. Microbiol. Mol. Biol. Rev. 2002;66:250–271. doi: 10.1128/MMBR.66.2.250-271.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang J, Cao TT, Tang Z, Shen QR, Rosen BP, Zhao FJ. Arsenic methylation and volatilization by arsenite S-adenosylmethionine methyltransferase in Pseudomonas alcaligenes NBRC14159. Appl. Environ. Microbiol. 2015;81:2852–2860. doi: 10.1128/AEM.03804-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yin XX, Chen J, Qin J, Sun GX, Rosen BP, Zhu YG. Biotransformation and volatilization of arsenic by three photosynthetic cyanobacteria. Plant Physiol. 2011;156:1631–1638. doi: 10.1104/pp.111.178947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Qin J, Lehr CR, Yuan CG, Le XC, McDermott TR, Rosen BP. Biotransformation of arsenic by a Yellowstone thermoacidophilic eukaryotic alga. Proc. Natl. Acad. Sci. U. S. A. 2009;106:5213–5217. doi: 10.1073/pnas.0900238106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Chen J, Sun GX, Wang XX, de Lorenzo V, Rosen BP, Zhu YG. Volatilization of arsenic from polluted soil by Pseudomonas putida engineered for expression of the arsM arsenic(III) S-adenosine methyltransferase gene. Environ. Sci. Technol. 2014;48:10337–10344. doi: 10.1021/es502230b. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Huang K, Chen C, Shen Q, Rosen BP, Zhao FJ. Genetically engineering Bacillus subtilis with a heat-resistant arsenite methyltransferase for bioremediation of arsenic-contaminated organic waste. Appl. Environ. Microbiol. 2015;81:6718–6724. doi: 10.1128/AEM.01535-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Meng XY, Qin J, Wang LH, Duan GL, Sun GX, Wu HL, Chu CC, Ling HQ, Rosen BP, Zhu YG. Arsenic biotransformation and volatilization in transgenic rice. New Phytol. 2011;191:49–56. doi: 10.1111/j.1469-8137.2011.03743.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chen J, Qin J, Zhu Y-G, de Lorenzo V, Rosen BP. Engineering the soil bacterium Pseudomonas putida for arsenic methylation. Appl. Environ. Microbiol. 2013;79:4493–4495. doi: 10.1128/AEM.01133-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Curtis MD, Grossniklaus U. A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol. 2003;133:462–469. doi: 10.1104/pp.103.027979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zhang XR, Henriques R, Lin SS, Niu QW, Chua NH. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 2006;1:641–646. doi: 10.1038/nprot.2006.97. [DOI] [PubMed] [Google Scholar]
  • 29.Chao DY, Chen Y, Chen JG, Shi SL, Chen ZR, Wang CC, Danku JM, Zhao FJ, Salt DE. Genome-wide association mapping identifies a new arsenate reductase enzyme critical for limiting arsenic accumulation in plants. PLoS Biol. 2014;12:e1002009. doi: 10.1371/journal.pbio.1002009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Murray MG, Thompson WF. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 1980;8:4321–5. doi: 10.1093/nar/8.19.4321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Xu XY, McGrath SP, Zhao FJ. Rapid reduction of arsenate in the medium mediated by plant roots. New Phytol. 2007;176:590–599. doi: 10.1111/j.1469-8137.2007.02195.x. [DOI] [PubMed] [Google Scholar]
  • 32.Raab A, Williams PN, Meharg A, Feldmann J. Uptake and translocation of inorganic and methylated arsenic species by plants. Environ. Chem. 2007;4:197–203. [Google Scholar]
  • 33.Li RY, Ago Y, Liu WJ, Mitani N, Feldmann J, McGrath SP, Ma JF, Zhao FJ. The rice aquaporin Lsi1 mediates uptake of methylated arsenic species. Plant Physiol. 2009;150:2071–2080. doi: 10.1104/pp.109.140350. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Ye WL, Wood BA, Stroud JL, Andralojc PJ, Raab A, McGrath SP, Feldmann J, Zhao FJ. Arsenic speciation in phloem and xylem exudates of castor bean. Plant Physiol. 2010;154:1505–1513. doi: 10.1104/pp.110.163261. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hirano S, Kobayashi Y, Cui X, Kanno S, Hayakawa T, Shraim A. The accumulation and toxicity of methylated arsenicals in endothelial cells: important roles of thiol compounds. Toxicol. Appl. Pharmacol. 2004;198:458–467. doi: 10.1016/j.taap.2003.10.023. [DOI] [PubMed] [Google Scholar]
  • 36.Styblo M, Del Razo LM, Vega L, Germolec DR, LeCluyse EL, Hamilton GA, Reed W, Wang C, Cullen WR, Thomas DJ. Comparative toxicity of trivalent and pentavalent inorganic and methylated arsenicals in rat and human cells. Arch. Toxicol. 2000;74:289–299. doi: 10.1007/s002040000134. [DOI] [PubMed] [Google Scholar]
  • 37.Dopp E, Hartmann LM, Florea AM, Rettenmeier AW, Hirner AV. Environmental distribution, analysis, and toxicity of organometal(loid) compounds. Crit. Rev. Toxicol. 2004;34:301–333. doi: 10.1080/10408440490270160. [DOI] [PubMed] [Google Scholar]
  • 38.Tang Z, Kang Y, Wang P, Zhao FJ. Phytotoxicity and detoxification mechanism differ among inorganic and methylated arsenic species in Arabidopsis thaliana. Plant Soil. 2016;401:243–257. [Google Scholar]
  • 39.Kenyon EM, Hughes MF. A concise review of the toxicity and carcinogenicity of dimethylarsinic acid. Toxicology. 2001;160:227–236. doi: 10.1016/s0300-483x(00)00458-3. [DOI] [PubMed] [Google Scholar]
  • 40.Dheeman DS, Packianathan C, Pillai JK, Rosen BP. Pathway of human AS3MT arsenic methylation. Chem. Res. Toxicol. 2014;27:1979–1989. doi: 10.1021/tx500313k. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Jiang GF, Lu XF, Gong Z, Cullen WR, Le XC. In Trivalent Arsenic Species: Analysis, Stability, and Interaction with a Protein. In: Chappell W, editor. 5th International Conference on Arsenic Exposure and Health Effects; San Diego, CA. July 14–18, 2002.2002. pp. 51–68. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplement

RESOURCES