Skip to main content
NCBI home page
Journal of Virology logoLink to Journal of Virology
. 2016 Jul 27;90(16):7339–7349. doi: 10.1128/JVI.00837-16

Two Polypyrimidine Tracts in Intron 4 of the Major Immediate Early Gene Are Critical for Gene Expression Switching from IE1 to IE2 and for Replication of Human Cytomegalovirus

Wangheng Hou a, Lilith Torres b, Ruth Cruz-Cosme a, Fernando Arroyo b, Luis Irizarry b, Dalia Luciano a, Arturo Márquez a, Leslie L Rivera a, Antonio L Sala a, Min-hua Luo c, Qiyi Tang a,b,✉
Editor: J U Jungd
PMCID: PMC4984657  PMID: 27252533

ABSTRACT

The human cytomegalovirus (HCMV) major immediate early (MIE) gene is essential for viral replication. The most abundant products encoded by the MIE gene include IE1 and IE2. Genes of IE1 and IE2 share the MIE promoter (MIEP), the first 3 exons, and the first 2 introns. IE1 is expressed earlier than IE2 after CMV infection or MIE gene transfection. In this study, we identified 2 polypyrimidine (Py) tracts in intron 4 (between exons 4 and 5) that are responsible for transcriptional switching from IE1 to IE2. The first Py is important and the second one is essential for the splicing and expression of IE2. In searching for the mechanisms of MIE gene switching from IE1 to IE2, we found that the second Py was required for the IE2's fourth intron to bind to a splicing factor such as U2AF65, as determined by an RNA electrophoretic mobility shift assay and a chromatin immunoprecipitation (ChIP) assay, while the first Py enhanced the binding of U2AF65 with the intron. An HCMV BACmid with the second Py mutated failed to produce any virus, while the HCMV with the first Py mutated replicated with a defective phenotype. Furthermore, we designed a small RNA (scRNAPy) that is complementary to the intron RNA covering the two Pys. The scRNAPy interfered with the interaction of U2AF65 with the intron and repressed the IE2 expression. Therefore, our studies implied that IE2 gene splicing might be an anti-CMV target.

IMPORTANCE CMV is a ubiquitous herpesvirus and a significant cause of disease and death in the immunocompromised and elderly. Insights into its gene regulation will provide clues in designing anti-CMV strategies. The MIE gene is one of the earliest genes of CMV and is essential for CMV replication. It is known that the MIE gene needs to be spliced to produce more than two proteins; however, how MIE gene splicing is regulated remains elusive. In the present studies, we identified two Pys in intron 4 and found that the first Py is important and the second is required for the splicing and expression of IE2. We further investigated the mechanisms of gene switching from IE1 to IE2 and found that the two Pys are responsible for U2AF65's binding with intron 4. Therefore, the Pys in intron 4 are the cis elements that determine the fate of IE2 splicing. Furthermore, we found that a small RNA that is complementary to intron 4 repressed IE2 expression. Hence, we provide the first piece of evidence for a unique mechanism of MIE gene regulation at the splicing level.

INTRODUCTION

Human cytomegalovirus (HCMV) infects large populations in general and causes serious diseases in immunocompromised individuals (1–3). CMV replication in permissive host cells is a well-defined, sequential process consisting of the following: entry into cells, immediate early (IE) gene expression, early (E) gene expression, DNA replication, late (L) gene expression, and viral production (3). Major immediate early (MIE) genes are the most abundantly expressed viral genes at the IE stage of infection and give rise to several nuclear phosphoproteins, the most abundant of which are immediate early proteins 1 (IE1, which is also known as IE72) and 2 (IE2, which is also known as IE86) (4–14). Both IE1 and IE2 expressions are under the control of the same promoter, MIEP. The MIE gene consists of five exons and four introns; IE1 and IE2 share the first three exons and differ at the last one (which is exon 4 for IE1 and exon 5 for IE2). The first exon does not encode any amino acids but is related to initiation sequences (13, 14). The first intron (intron A) apparently participates in MIE gene regulation via interaction with NF1 and CTCF (15, 16).

However, IE1 and IE2 are clearly different in terms of their roles in interacting with host cells and regulating viral gene expression. IE2 is essential for early and late gene expression and viral replication (17, 18). IE2 negatively autoregulates the MIE promoter, activates the viral early and late promoters, and regulates cellular promoters (19). Because HCMV infects terminally differentiated cells that tend to be quiescent, IE2 promotes cell cycle progression from G0/G1 to G1/S and arrests cell cycle progression at the G1/S interface or at G2/M in order to take advantage of cellular DNA replication machinery (20–22). IE1 is important (but not required) for HCMV replication (23–25).

Although the MIE gene has been clearly demonstrated to produce several proteins by alternative splicing, it is not known how the alternative splicing is regulated to produce IE2, which activates progression in the replication cycle in the early stages. A recent study demonstrated that an isoform of IE1 that contains only exon 4 functioned in the maintenance of the viral genome for persistent infection (26). Interestingly, the IE1 isoform does not result from alternative splicing but from an alternative promoter (26). The questions of what processes shift alternative splicing from the proximal exon 4 to the distal exon 5 (exon skipping) and what maintains a balance between the IE1 and IE2 mRNAs have not yet been addressed, although they are highly relevant to issues associated with reactivation. We hypothesize that the quantitatively and kinetically differential expressions of IE1 and IE2 result from the regulation of MIE gene splicing, because we found that splicing inhibitors affected MIE gene expression and viral replication (27). The expression regulation of the MIE gene at the transcriptional level has been studied extensively (12, 28–31), but the details of HCMV gene-splicing regulation have been lacking. Our recent observation that polypyrimidine (Py) tract-binding protein (PTB) can significantly repress HCMV replication by interfering with MIE gene splicing (27) and the previous observation that HCMV infection causes a temporal change of PTB (32) have led to several questions: how is the MIE gene regulated at the splicing level, and why does IE1 expression differ from IE2 expression during infection and latency?

In the present studies, we identified 2 Pys in intron 4 and discovered that the Pys are important for gene skipping from IE1 to IE2 through mediation of the interaction of intron 4 with gene-splicing factors.

MATERIALS AND METHODS

Tissue culture and viruses.

The human embryonic diploid lung fibroblast cell line MRC-5 (ATCC CCL171) and HEK 293T (ATCC CRL11268) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 1% penicillin-streptomycin (33). HCMV strain AD169 was obtained from the ATCC.

Antibodies.

Rabbit antibodies against IE1 (exon 4) and IE2 (exon 5) were a gift from H. Zhu (New Jersey Medical School, Newark, NJ). The monoclonal antibody against IE1/2 (mAB810) was purchased from Sigma-Aldrich (Saint Louis, MO). Monoclonal antibodies against tubulin (4G1), HCMV pp28 (5C3), and U2AF65 (MC3) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Rabbit antibodies against U2AF65 (ab37530) and PTB (ab133734) were bought from Abcam (Cambridge, MA). Polyclonal antibody against UL37 x 1 was generated and stored in our laboratory. The rabbit antibody against HCMV UL112/113 was a gift from J. H. Ahn (Sungkyunkwan University School of Medicine, Suwon, South Korea).

Plasmids and transfection.

The plasmid pSVH, carrying the intact HCMV MIE gene, was a gift from R. Stenberg (34) and has been used in our laboratory previously (27). The plasmid expressing human U2AF65 was described in our previously reported studies (27). The transfection of plasmids and BACmids was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions. The AD169-derived HCMV bacterial artificial chromosome plasmid (BACmid) HB5 (35) was used to generate all HCMV mutants described in this study.

Molecular cloning.

There are 2 polypyrimidine (Py) tract DNA sequences in the intron between exon 4 and 5 (underlined): AAACGTGTCACGCCTGTGAAACCGTACTAAGTCTCCCGTGTCTTCTTATCACCATC. To mutate the Py based on the pSVH, we employed overlapping PCR cloning techniques to make (i) pSVHdPyA, which mutated the first Py from UCUCCC to UCAGCC; (ii) pSVHdPyB, which mutated the second Py from UCUUCUU to UCAAGUU; and (iii) pSVHdPyAB, which mutated both Pys. The primers used for overlapping PCR cloning are shown in Table 1.

TABLE 1.

Primers for overlapping PCR and RNA ChIP assays

Primer Sequence
SVH_ApaI 5′ GACGAGGGCCCTTCCTCCAAG 3′
PTBN4PyA_up 5′ CACCTGATGGTGATAAGAAGACACGGCTGACTTAGTACGGTTTC 3′
PTBN4PyA_dn 5′ GAAACCGTACTAAGTCAGCCGTGTCTTCTTATCACCATCAGGTG 3′
PTBN4PyB_up 5′ CACCTGATGGTGATAACTTGACACGGGAGACTTAGTACGGTTTC 3′
PTBN4PyB_dn 5′ GAAACCGTACTAAGTCTCCCGTGTCAAGTTATCACCATCAGGTG 3′
PTBN4PyAB_up 5′ CACCTGATGGTGATAACTTGACACGGCTGACTTAGTACGGTTTC 3′
PTBN4PyAB_dn 5′ GAAACCGTACTAAGTCAGCCGTGTCAAGTTATCACCATCAGGTG 3′
SVH_SmaI_reverse 5′ TAGCGGATGCCCCGGGGAG 3′
PyChIP_forward 5′ GUGUCACGCCUGUGAA 3′
PyChIP_reverse 5′ TTGTTAAGAGGGGCGCTGCT 3′
Open in a new tab

Purification and overexpression of recombinant human U2AF65 in Escherichia coli.

cDNAs of U2AF65 were cloned into pQE30 so that the U2AF65 protein was tagged with 6×His. The plasmids were then transformed into competent E. coli strain M15(pREP4) cells. His-tagged U2AF65 was overexpressed in E. coli M15(pREP4) cells and purified using Ni-nitrilotriacetic acid (Ni-NTA) Sepharose (Qiagen) in accordance with the supplier's recommendations.

RNA electrophoretic mobility shift assay (EMSA).

RNA fragments were labeled using T4 polynucleotide kinase (Roche) in the presence of [32P]ATP and purified using G-25 spin columns (GE Healthcare). The purified U2AF65 protein (150 ng) was incubated with the purified probes for 30 min at room temperature in a total volume of 25 μl buffer containing 100 μM ZnSO4, 10 mM Tris-Cl (pH 8.0), 60 mM KCl, 1 mM EDTA, 10 mM MgCl2, 0.05 μg/μl poly(dI-dC), 0.5 μg/μl bovine serum albumin, 0.05% NP-40, 35 mM beta-mercaptoethanol, RNasin, and 6% glycerol. The samples were then separated by electrophoresis on a native 5% polyacrylamide gel. The gels were dried and analyzed using a Typhoon PhosphorImager system.

BAC to make mutated HCMV.

We employed the bacterial artificial chromosome (BAC) technique to mutate the polypyrimidine (Py) tract in the intron between exons 4 and 5. Briefly, the BACmid pHB5 was transformed into E. coli SW102. A galK DNA fragment that was made from pgalK (36), the ends of which are homologous with the two ends of the Py in intron 4, was electroporated into strain SW102 harboring HB5 in order to replace intron 4 by homologous recombination, resulting in BACmid HB5intron4galK. Then the galK DNA was replaced with a synthesized intron 4 DNA fragment in which one or both Pys had been mutated, resulting in HB5dPyA, HB5dPyB, and HB5dPyAB. The revertant BACmids were produced from each BACmid using the same method—by replacing the mutated Py with wild-type (wt) Py. MRC-5 cells were transfected with these resultant BACmids to make the virus. HB5dPyA resulted in HCMVdPyA. The other two revertants (HB5dPyB and HB5dPyAB) failed to produce viruses, but all of the revertants are capable of producing viruses. The DNA of the complete MIE gene was sequenced and confirmed to be correct.

Immunoblot analysis.

Proteins were separated by sodium dodecyl sulfate–7.5% polyacrylamide gel electrophoresis (37) (10 to 20 μg loaded in each lane), transferred to nitrocellulose membranes (Amersham Inc., Piscataway, NJ), and blocked with 5% nonfat milk for 60 min at room temperature. Membranes were incubated overnight at 4°C with primary antibody, which process was followed by incubation with a horseradish peroxidase-coupled secondary antibody (Amersham) and detection with enhanced chemiluminescence (Pierce, Rockford, Ill.), both according to standard methods. Membranes were stripped using stripping buffer (100 mM β-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.8), washed with PBS–0.1% Tween 20, and used to detect additional proteins.

RNA isolation, treatment with DNase I (RNase free), reverse transcription-PCR (RT-PCR), and real-time RT-PCR.

In accordance with the instructions of the manufacturers, total RNA was isolated using Tri Reagent (Ambion, Inc., Austin, TX) and treated with DNase I (RNase free; Invitrogen catalog no. 18047-019). The DNase I was inactivated by the extraction of the RNA sample with phenol and chloroform. Reverse transcription was carried out using a kit (Invitrogen, Carlsbad, CA) and an oligo(dT)20 primer, according to the manufacturer's protocol. PCR was performed using two different forward primers and a reverse primer for pIE1 or pIE2. The forward primers were 5′-ATG TCC TGG CAG AAC-3′ (pShort; from the 3′ terminus of exon 3) or 5′-GAC GTT CCT GCA GAC-3′ (pLong; from the 5′ terminus of exon 3).

To quantitatively examine the mRNA level of IE1 and IE2 in HCMV-infected cells, real-time RT-PCR was undertaken using the QuantiTect SYBR green RT-PCR kit (Qiagen, Valencia, CA). A total of 1 μg of total RNA and 0.2 μM concentrations of sense and antisense primers were used in a final 25-μl master mix volume; primers included pShort or pLong, which can amplify only cDNA as it traverses two exons, exon 3 and exon 4 or exon 3 and exon 5, and reverse primer pIE1 or pIE2. A reverse transcription step of 20 min at 50°C was included before PCR. PCRs consisted of 50 cycles with the following optimal conditions: 94°C for 20 s, 50°C for 1 min, 72°C for 30 s, and an optimized collection data step of 80°C for 5 s. Fluorescence (captured at 80°C) was determined to be absent from the signal generated by primer dimers. All samples were run in triplicate; data were collected and recorded by the iCycler iQ software (Bio-Rad) and expressed as a function of the threshold cycle (CT), which represents the number of cycles at which the fluorescence intensity of the SYBR green dye is significantly greater than that of the background fluorescence. The CT is directly correlated to the log10 copy number of the RNA standards. RNA copies were extrapolated from standard curves (CT versus log10 copy number) representing at least a seven-point serial dilution of standard RNA (101 to 107 copies/μl). RNA standards were used as calibrators of the relative quantification of product generated in the exponential phase of the amplification curve for real-time RT-PCR. The results showed the correlation coefficient for the standard curve to be greater than 0.95. A melting-temperature curve analysis was obtained by measuring (after the amplification cycles) the fluorescence during a period of warming from 60°C to 95°C.

Viral DNA isolation from cells.

Viral DNA samples were isolated from infected cells using Hirt's method (38). The MRC-5 cells were infected with HCMV and lysed in Hirt buffer. The DNA-containing supernatant was mixed with 70% isopropanol, and the viral DNA was precipitated by centrifugation.

PFU assay.

To detect the viral growth curve, MRC-5 cells were infected with virus at a multiplicity of 0.1 PFU/cell. Medium and cells from infected cultures were collected at different days postinfection, and virus was obtained after the collected culture underwent three freeze-thaw cycles. Virus titers were determined on MRC-5 cells after analyzing the number of PFU. Student's t test was used to statistically analyze the difference between the two groups; a P value lower than 0.01 was used as the threshold for a significant difference.

RNA ChIP assay.

The chromatin immunoprecipitation (ChIP) assay was carried out, according to the manufacturer's manual, using an EZ ChIP kit purchased from Millipore (Temecula, CA). Briefly, HEK 293T cells were transfected with plasmid pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 24 h or they were infected with HCMVdPyA or its revertant for 16 h. The cells were cross-linked with 1% paraformaldehyde and then sonicated to shear the DNA/RNA. The RNA-protein complexes were pulled down by anti-PTB (ab133734) and anti-U2AF65 (ab37530) antibodies (made from rabbit) and normal rabbit IgG (used as a negative control). The cross-linked RNA-protein complexes were then washed with multiple buffers (provided with the EZ ChIP kit) and reversed by SDS at 95°C; the DNA was removed by DNase I digestion, and the RNA was purified through the provided column. Real-time RT-PCR was performed to examine the amount of RNA in each sample, using the primers shown in Table 1.

RESULTS

Identification of the Py that is responsible for transcriptional switching from IE1 to IE2.

We wanted to address the question of how the switch from IE1 to IE2 is regulated. At the end of exon 4 (Fig. 1A), there are stop codons and poly(A) signals that are for IE1 gene expression. We wondered whether the DNA sequence after the IE1 poly(A) signals could be important for the gene splicing of IE2. As shown in Fig. 1A, there are two Py sequences,UCUCCC (underlined and labeled A) and UCUUCUU (underlined and labeled B), between exons 4 and 5 and after the poly(A) signal of IE1. Using the pSVH plasmid, we made three different mutants: pSVHdPyA, in which UCUCCC is mutated to UCAGCC; pSVHdPyB, in which UCUUCUU is mutated to UCAAGUU; and pSVHdPyAB, in which both sequences A and B are mutated. After transfecting the plasmids into HEK 293T cells, we used Western blotting (Fig. 1B) and real-time RT-PCR (Fig. 1C) to examine the production of IE1 and IE2 at the protein level and the transcriptional level, respectively. We found that both pSVHdPyB and pSVHdPyAB failed to express IE2 at any appreciable level, although the expression of IE1 was not affected. Interestingly, pSVHdPyA expressed IE2 at a much lower level than pSVH did. These results suggest that (i) the second Py (Fig. 1A, sequence B) is required for the gene splicing to produce IE2 because its mutation (UCAAGUU) fails to express IE2 and (ii) the first Py (Fig. 1A, sequence A) is important for IE2 splicing and expression.

FIG 1.

FIG 1

Open in a new tab

Defining the polypyrimidine (Py) tract for splicing of exon 5. (A) RNA sequence between exons 4 and 5. AAUAAA (in red) is the poly(A) signal of IE1; there are two hypothesized Py sequences, UCUCCC (labeled A) and UCUUCUU (labeled B). gu, donor; ag, acceptor. (B) Western blot assay. HEK 293T cells were transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 24 h, and the whole-cell lysates were collected and subjected to SDS-PAGE to examine IE1/IE2 production using anti-IE1/2 antibody (mAB810). The relevant bands show IE1, SUMO-IE1, IE2, or SUMO-IE2, as indicated on the right side. (C) Real-time RT-PCR assay. HEK 293T cells were transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 20 h, and the total RNA was isolated. One microgram of total RNA was used for real-time PCR to examine IE1/IE2 production. The primers used were pShort and pIE1 for IE1 and pShort and pIE2 for IE2. The bar graph shows the mean ± standard deviation of results from three independent experiments. (D) Immunofluorescence assay (IFA). pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB was transfected into MRC-5 cells for 20 h, and the cells were fixed and permeabilized to stain for IE1 (green), IE2 (red), and DAPI (blue). The cell size is indicated by the bar scale. The results for pSVHdPyAB were the same as those for pSVHdPyB, so they are not shown here. HF, human fibroblast cell.

We also performed an immunofluorescence assay (IFA) to examine the production of IE1/2 from transfected MRC-5 cells. The MRC-5 cells were transfected with pSVHdPyA (Fig. 1D, upper panels), pSVH (middle panels), or pSVHdPyB (lower panels) for 20 h. The cells were then fixed with 1% paraformaldehyde and permeabilized with 0.2% Triton X-100. Finally, the cells were incubated with anti-IE1 antibody or anti-IE2 antibody to show the production of IE1 or IE2. The total cells were shown by DAPI (4′,6-diamidino-2-phenylindole) staining. All colors are merged in the first column of Fig. 1D. As shown in Fig. 1D, IE1 production appears not to be affected because it can be seen in the cells transfected with any plasmid. However, no IE2 production can be visualized in the cells transfected with pSVHdPyB.

The polypyrimidine (Py) tract mediates the interaction between intron and splicing factors.

Gene-splicing factor U2AF65 binds to an intron to control the splicing of the next exon (39). We wanted to know whether PyA or PyB mediates the interaction between intron 4 and U2AF65. To do so, we performed RNA EMSAs. We incubated the U2AF65 protein with the same amounts of radiolabeled RNA probes (Fig. 2A; probe sequences are shown in Table 2) and ran them in native PAGE gels as shown in Fig. 2A: RNA without PyA and PyB (dPyAB), RNA without PyB (dPyB), RNA without PyA (dPyA), and RNA with both PyA and PyB (wt). Comparing the bound probes to that in the wt (fourth lane), we found that U2AF65 failed to bind to the RNA probe in which PyB was mutated (first and second lanes) and that the binding became much weaker when PyA was mutated (third lane).

FIG 2.

FIG 2

Open in a new tab

Interaction of the polypyrimidine (Py) tract and splicing factors. (A) An EMSA was used to determine U2AF65 binding to RNA oligonucleotide probes containing both wild-type PyA and PyB (wt), mutated PyA (dPyA), mutated PyB (dPyB), or both mutations together (dPyAB). The positions of the free probe and the bound probe are indicated on the left. (B) RNA ChIP assay with HEK 293T cells transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB at 24 h posttransfection with antibodies specific to U2AF65, PTB, or control IgG. quantitative RT-PCR (qRT-PCR) was used to quantify ChIP efficiency with specific primers in the regions indicated. The bar graph represents the mean percentage of the input for each ChIP from three independent PCRs ± the standard deviation.

TABLE 2.

Oligonucleotide probes used in EMSA

Probea Sequenceb
wt 5′ CACGCCUGUGAAACCGUACUAAGUCUCCCGUGUCUUCUUAUCACCAUCAG 3′
dPyAB 5′ CACGCCUGUGAAACCGUACUAAGUCAGCCGUGUCAAGUUAUCACCAUCAG 3′
dPyB 5′ CACGCCUGUGAAACCGUACUAAGUCUCCCGUGUCAAGUUAUCACCAUCAG 3′
dPyA 5′ CACGCCUGUGAAACCGUACUAAGUCAGCCGUGUCUUCUUAUCACCAUCAG 3′
Open in a new tab
a

wt, RNA with both PyA and PyB; dPyAB, RNA without both PyA and PyB; dPyB, RNA without PyB; dPyA, RNA without PyA.

b

Underlining indicates the sequence of PyA or PyB.

We then wondered whether the Pys could affect U2AF-intron 4 binding in vivo. We performed an RNA ChIP assay to determine whether splicing regulators (U2AF65 and PTB) could interact with Py. HEK 293T cells were transfected with one of the four different plasmids (Fig. 2B) for 24 h, cross-linked with 1% paraformaldehyde, and, finally, sheared with a sonicator to break down the RNA. The RNA-protein complexes were pulled down using control IgG, anti-PTB, and anti-U2AF65 antibodies. After the columns were washed multiple times, the cross-linking was reversed with SDS at 95°C. The DNA was removed by DNase I digestion, and the RNA was purified through the column provided in the RNA ChIP kit. Real-time RT-PCR was performed to determine the amount of specific RNA in each sample assayed by ChIP, and the percentage of RNA was calculated by comparing it to the input RNA. The primers used for the RT-PCR are shown in Table 3. As can be seen, when PyB was mutated, the intron RNA lost the ability to bind to U2AF65 or PTB; when PyA was mutated, the intron RNA's binding to PTB or U2AF was significantly weaker than that of the wild type.

TABLE 3.

Primers for PCR

Primer Sequence
pShort 5′ ATG TCC TGG CAG AAC 3′
pIE1 5′ CAT CCT CCC ATC ATA TTA 3′
pIE2 5′ GGA TGC CCC GGG GAG AGG 3′
Open in a new tab

Therefore, we demonstrated that both Pys in intron 4 are important if either splicing factor is to bind to intron 4 to facilitate IE2 gene splicing. The second Py (PyB) is essential for the interaction of the splicing factors with intron, while the first Py (PyA) is important for their interaction.

PyA and PyB affect IE2 gene splicing.

We then performed an in vivo gene-splicing assay to determine whether PyA or PyB is important for IE2 gene splicing. First, we transfected plasmids (pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB) into HEK 293T cells for 20 h, isolated the total RNA, and treated the total RNA with DNase to remove any possibly contaminating plasmid DNA. Then, we performed RT-PCR using a specific reverse primer (pIE2) in exon 5 (Table 3) instead of oligo(dT) for reverse transcription (RT) so that both mRNA and pre-mRNA could be reverse transcribed (Fig. 3A). By doing so, we were able to amplify cDNA on both pre-mRNA (*) and mRNA (**) using a forward primer in exon 3 and a reverse primer (pIE2) in exon 5 (Table 3). We performed a PCR using the total RNA (DNase treated) as the template, and as shown in the middle panel of Fig. 3B, no DNA could be amplified, which excluded the contamination of the plasmid DNA in the total RNA. A PCR using plasmid DNA as the template amplified a DNA that was the same size as the pre-mRNA (Fig. 3B, right panel). As can be seen in Fig. 3B, left panel, RT-PCR resulted in two bands for the pSVH- and pSVHdPyA-transfected groups, which stand for the amplified DNA from pre-mRNA (*) and mRNA (**), respectively. The mRNA band was not detectable for the pSVHdPyB and pSVHdPyAB groups. It is also obvious that the mRNA band from the pSVHdPyA-transfected group is much weaker than that from the pSVH-transfected group. Together, these findings provide the first demonstration that PyB is required and PyA is important for IE2 splicing as well as efficient production of mRNA from abundant pre-mRNA.

FIG 3.

FIG 3

Open in a new tab

IE1/IE2 splicing assay. (A) Diagram showing the predicted sizes of IE2 mRNA or pre-mRNA and the primers (pShort and pIE2) used for the RT-PCR. (B) HEK 293T cells were transfected with pSVH, pSVHdPyA, pSVHdPyB, or pSVHdPyAB for 20 h, and the total RNA was isolated. One microgram of total RNA was used to perform an RT-PCR using the SuperScript III One-Step RT-PCR system with Platinum Taq DNA polymerase (Invitrogen catalog no. 12574018) according to the manufacturer's protocol. Controls included (i) that the total RNA was directly used as a template for PCR to exclude the possibility of contamination of plasmid DNA and (ii) that the plasmid DNA was used as a template for PCR to show the size of the DNA in the DNA vector.

PyB is essential and PyA is important for HCMV replication.

Finally, we introduced the mutations of the Pys into HCMV BACmids, resulting in BACmids HB5dPyA, HB5dPyB, and HB5dPyAB. First, we wondered whether the BACmid could express IE1/2 after transfection into MRC-5 cells. The MRC-5 cells were fixed at 20 h posttransfection, and IFA was performed to examine the IE1/2 production. As shown in Fig. 4A, only BACmid HCMVdPyA can produce both IE1 and IE2, while the other two BACmids can produce only IE1, not IE2. This result is consistent with that shown in Fig. 1 after transfection with the plasmids. Since the transfection rate of BACmid into MRC-5 cells was too low, we did not check the IE1 and IE2 levels with the Western blot assay. We then generated the revertant BACmids, HB5dPyARev, HB5dPyBRev, and HB5dPyABRev. Each BACmid was transfected into MRC-5 cells to make a virus. HB5dPyA was able to form an infectious virus (HCMVdPyA). The other two BACmids (HB5dPyB and HB5dPyAB) failed to produce any viruses. All the revertant BACmids were able to make viruses, and they replicated similarly to the wild type. Upon comparing the viral replication of HCMVdPyA with that of wild-type HCMV or its revertant, we found that HCMVdPyA has a defective phenotype for replication (Fig. 4B). The Western blot assay also showed that viral protein production is reduced when the first Py is mutated (Fig. 4C). As expected, the IE2 protein is produced much later in HCMVdPyA than in the revertant HCMV. Therefore, the first Py sequence is important for HCMV replication while the second Py is required for HCMV replication.

FIG 4.

FIG 4

Open in a new tab

Importance of Pys for viral replication. (A) The MRC-5 cells were fixed at 20 h posttransfection with the BACmid as indicated, and IFA assays were performed to examine IE1 (FITC) and IE2 (Texas Red) production. (B) The viral growth curve was determined by a PFU assay using MRC-5 cells with the infection at an MOI of 0.1. Each experiment was performed in triplicate. The numbers of infectious virus presented in the curve are the averages of results from three experiments. Data with error bars are means ± standard deviations. (C) Western blot assay to examine the viral protein production of HCMVdPyA or its revertant after infection in MRC-5 cells at an MOI of 0.5. MW, molecular weight in thousands. (D) Confirmation that PyA is important for IE2 production in a viral infection system. We infected human fibroblast cells (MRC-5) with HCMVdPyA or its revertant at an MOI of 0.5 for different times (hours), and the cells were fixed at 12 and 24 hpi for immunostaining using antibodies against IE1 (FITC) and IE2 (Texas Red). We counted IE1- and IE2-positive cells under a fluorescence microscope. Data with error bars are means ± standard deviations.

Figures 1 and 4A show that in the transfection system, PyA is important for IE2 production, but it is necessary to confirm the results in a viral infection system. We infected human fibroblast cells (MRC-5) with HCMVdPyA or its revertant for different numbers of hours, and the cells were fixed at 12 and 24 h postinfection (hpi) for immunostaining using antibodies against IE1 (FITC [fluorescein isothiocyanate]) and IE2 (Texas Red). We counted IE1- and IE2-positive cells under a fluorescence microscope. At 12 hpi, only 55 IE2-positive cells were seen in every 100 IE1-positive cells when cells were infected with HCMVdPyA, compared to the 87 IE2-positive cells that were seen in every 100 IE1-positive cells in the revertant virus infection (Fig. 4D). At 24 hpi, the IE2/IE1 ratio gets closer to 1 (74% for HCMVdPyA infection compared to 99% for its revertant infection). These results demonstrate that PyA is important for IE2 production in a viral infection system.

It is important to know whether the IE2 gene splicing is affected when PyA is mutated in the context of viral infection. For that purpose, we infected MRC-5 cells with HCMVdPyA and its revertant at a multiplicity of infection (MOI) of 0.1 for 16 h. The total RNA was isolated and treated with DNase I. As shown on the right of Fig. 5A, the PCR is negative when the total RNA is used as the template, which excluded the possibility of viral DNA contamination. The left side of Fig. 5A shows the RT-PCR products amplified from the mRNA (171-bp bands) or from pre-mRNA (1.7 kbp). It is clear that the IE2 splicing is stronger in the revertant infection than in HCMVdPyA infection because the mRNA band from the revertant infection is much stronger than that from the HCMVdPyA infection. Therefore, the mutation of PyA negatively affects the IE2 gene splicing.

FIG 5.

FIG 5

Open in a new tab

Importance of PyA for IE2 splicing, expression, and interaction of intron 4 with splicing factors. (A) IE2 splicing assay in the MRC-5 cells infected with HCMVdPyA or its revertant for 16 h at an MOI of 0.1. (B) RNA ChIP assay to determine the interaction of intron 4 with gene splicing factors (PTB and U2AF65) in the MRC-5 cells that were infected with HCMVdPyA or its revertant for 16 h at an MOI of 1. (C) Real time RT-PCR to determine the IE1/IE2 mRNA levels at different times after infection of MRC-5 with HCMVdPyA or its revertant at an MOI of 0.5.

We also performed an RNA ChIP assay to determine whether PyA plays a role in the interaction of splicing factors with intron 4. The MRC-5 cells were fixed after being infected with HCMVdPyA or its revertant for 16 h at an MOI of 1. RNA ChIP assays were performed as described above using anti-PTB or anti-U2AF65 antibodies. As shown in Fig. 5B, both PTB and U2AF65 interact with intron 4 of IE2 RNA in the cells that were infected with HCMVdPyA or its revertant. However, the interaction was reduced when PyA was mutated. These experimental results confirm that PyA enhances the interaction of splicing factors with intron 4.

The results shown in Fig. 4C demonstrate that mutation of PyA reduces viral gene expression at the translational level, but it is necessary to know if PyA affects IE1/IE2 gene expression at the mRNA level. We performed real-time RT-PCR to determine the IE1/IE2 mRNA levels at different times after infection of MRC-5 cells with HCMVdPyA or its revertant at an MOI of 0.5. As can be seen in Fig. 5C, the IE1 mRNA level for the HCMVdPyA-infected cells remained comparable to that of the revertant, but the IE2 mRNA level was significantly decreased in the PyA-mutated viral infection. Taken together, these results demonstrate that the PyA is not required for HCMV to replicate but is important to enhance the interaction of splicing factors with intron 4 and strengthen the viral gene expression and viral replication.

A small RNA fragment that is complementary to the PyAB-containing intron blocked the interaction of the intron with U2AF65 and inhibited IE2 gene expression.

The 3′ splice site elements are recognized by the cooperative binding of splicing factors to cognate RNA sequences (40). Specifically, the large and small subunits of U2AF (U2 snRNP auxiliary factor; U2AF65 and U2AF35) bind to the polypyrimidine (Py) tract and the downstream AG dinucleotide, respectively. U2AF65 interacts only with a single-stranded RNA, leading to accurate gene splicing, and does not interact with a double-stranded RNA (41). We hypothesize that a small RNA fragment that is complementary to the Py-containing RNA will form double-stranded RNA that will not bind U2AF65 and thus will abolish the interaction of U2AF65 and Py and lead to the inhibition of gene splicing. We tested our speculation with the IE2 gene model. First, we designed a small RNA (scRNAPy) that is complementary to the RNA probe that was shown to interact with U2AF65 (Fig. 2A and 6A). This scRNAPy and the probe RNA formed double-stranded RNA when they were mixed at a 1:1 molar ratio for 30 min at room temperature; the single-stranded RNA band and the double-stranded RNA band are shown in Fig. 6B. We performed an RNA gel shift assay in the absence or presence of the scRNAPy. As can be seen in Fig. 6C, when the scRNAPy was added to the probe-U2AF65 reaction system, the binding of the probe with U2AF65 was reduced, and the reduction of the probe-U2AF65 binding was associated with the amount of scRNAPy.

FIG 6.

FIG 6

Open in a new tab

Effects of a small cRNA (scRNA) on IE2 gene expression. (A) Sequences of single-stranded RNA (ssRNA) probe and the complementary scRNAPy. (B) Incubation of ssRNA probe with scRNAPy formed double-stranded RNA, indicated by a larger size than that of ssRNA or scRNAPy. (C) An EMSA was used to determine U2AF65 binding to RNA oligonucleotide probes in the absence or presence of scRNAPy. (D) Model of scRNAPy interference with IE2 gene splicing. scRNAPy forms double-stranded RNA (dsRNA) with the Py-containing intron to block U2AF65 interaction with Py. (E) An scRNA complementary to the Pys (scRNAPy; the RNA sequence is shown in panel A), an scRNA complementary to the upstream sequence of the Pys (scRNAupPy, GAG UAG GAU UAC AGA GUA UAA CAU AGA GUA UAA UAU AGA GUA UAC AAU AG), or a scrambled RNA (made from luciferase gene) and pSVH were cotransfected into HEK 293T cells for 24 h, and the whole-cell lysates were used to examine IE2 production using anti-IE2 antibody. Tubulin was used for a sample-loading control. (F) scRNAPy, scRNAupPy, or scrambled RNA and pSVH were cotransfected into HEK 293T cells for 20 h, and the total RNA was isolated. One microgram of total RNA was used for real-time RT-PCR to examine the IE2 mRNA level. The bar graph shows the mean ± standard deviation of results from three independent experiments.

If the interference of the scRNAPy with the binding of U2AF65 and the Py tract could occur in vivo, then the scRNAPy should be able to repress IE2 gene splicing, as depicted in Fig. 6D. To examine our hypothesis, we cotransfected HEK 293T cells with pSVH together with the scRNAPy or the scRNAPyup (an scRNA that is complementary to the upstream sequence of intron 4) or a scrambled RNA (made from luciferase cDNA) for 20 h. The whole-cell lysate samples were prepared for a Western blot assay to check the IE2 protein production; the total RNA samples were prepared for real-time PCR to examine the mRNA level of IE2. As can be seen in Fig. 6E and F, the scRNAPy significantly reduced IE2 expression at both the protein level and the transcriptional level. Our results imply that gene-splicing regulation might be a target for designing a strategy against CMV gene expression and replication: an scRNAPy, for example, can effectively interfere with IE2 gene splicing and expression.

DISCUSSION

HCMV, one of the most alarming pathogens extant, causes birth defects in newborns and serious diseases among immunocompromised individuals (1). It is known that HCMV infects large populations and may remain latent in several specific tissues after primary infection in healthy people (3). How the virus is reactivated, thereby to cause disease, is still unknown. Several viral and cellular factors have been identified as being associated with the persistence of HCMV and reactivation of its latency (42–44). However, the first de novo-expressed genes of HCMV after reactivation may include the MIE gene (3, 44). In particular, IE1×4 is found to be expressed during HCMV latency, while IE2 is absent (26). Therefore, the MIE gene may be critical for the switch from latency to lytic replication in HCMV. The MIE gene needs to be spliced to produce several proteins. Among those produced, IE1 and IE2 are the most abundant (13). Both the structure of the MIE gene and its splicing sites have been identified, but how gene splicing is regulated is still unknown. We previously demonstrated that cellular splicing regulators (PTB and U2AF65) were involved in MIE gene-splicing regulation and that MIE gene-splicing regulation is important for HCMV replication (27). The MIE gene is one of the few that need to be spliced. Unlike U2AF65, which binds to the Py tract only in introns (to define the splicing site), PTB can also bind Py in the exons that flank an intron, thus looping out the intron and inhibiting splicing (27, 45). Therefore, the order of exon 4 and exon 5 might have a biological effect on MIE gene expression if PTB can interact with both the introns and the exons of the MIE gene.

Gene splicing needs the interaction of the Py sequence and splicing regulators, in particular between Py and U2AF65 (46). U2AF65 recognizes the sequence and defines the splicing site. PTB inhibits gene splicing by competing with U2AF65 to bind with Py (27). PTB was demonstrated to be induced by HCMV infection and to colocalize with polyadenylation factor CstF-64 (28, 32). Besides PTB and U2AF, other factors involved in gene splicing include hRNP L, hRNP A1, and SC35 (also called splicing factor, arginine/serine-rich 2 [SRSF-2]), the last of which is required for the formation of the splicing compartment (SC) (47). Splicing specificity is determined by the formation of a spliceosome at the specific site of the cis element in pre-mRNA (especially Py) (39). In the present studies, we have been interested in answering the question of how MIE gene expression switches from IE1 to IE2. We believe that this gene switching must be linked to the sequences between exons 4 and 5. Within the sequences, there are two Pys, and our RNA ChIP assay results showed that U2AF65 and PTB interact with only the second Py. The gene mutation assays consistently showed that the second Py is essential for IE2 expression. Therefore, gene skipping from IE1 to IE2 is determined in great part by the interaction of splicing regulators with the second Py. Our trial of using an scRNAPy to interfere with the interaction of Py and U2AF65 was successful in vitro, and the scRNAPy reduced IE2 expression when it was cotransfected with the MIE-expressing plasmid. These results imply that the MIE gene-splicing factors might be a target in designing an anti-CMV strategy.

Interestingly, two closely arranged Pys are separated by only 3 nucleotides, GUG. Although the GUG is not important for the IE1/2 expression, both Pys are important. The first Py (PyA) is not essential for IE2 expression, but it affects the interaction of splicing factors with the intron and enhances IE2 expression. This was confirmed by the systems of transfection of plasmids, BACmids, and infection of viruses. Therefore, it is reasonable to believe that the gene-splicing regulation in intron 4 is more complicated than we previously thought. The question of how the PyA affects the binding of splicing factors with intron 4 needs to be answered.

In our previous studies, both IE1 and IE2 were shown to be related to nuclear domain 10 (ND10) and SC (48, 49). It is unknown whether these viral proteins are involved in gene-splicing regulation, whether any such actions are critical to viral function, or what mechanisms are involved. Gene splicing involves interactions among host cell splicing inhibitors and enhancers as well as cis-acting sites in pre-mRNA that combine to form catalytic spliceosomes (27, 39, 45, 47, 50–52). Our recent findings suggest that viral proteins may contribute to productive infection by aiding and/or suppressing spliceosome formation, but the roles and mechanisms of these actions are unknown.

In summary, two Pys have been identified in the intron between exons 4 and 5. The first Py (PyA) is important and the second Py (PyB) is required for the gene skipping from IE1 to IE2. Splicing factors (PTB and U2AF65) interact with the intron that contains PyB, and PyA enhances the interaction. The interaction of the Py sequence with U2AF65 may be important for the production of IE2 and for HCMV replication. In the future, we will explore whether the Pys are important in stabilizing the mRNA of IE2. It would also be very interesting to know whether the PTB and U2AF65 interact competitively with the Py-containing intron 4.

ACKNOWLEDGMENTS

We thank Andrew Boileau (Saba University School of Medicine) for his critical reading of the manuscript. We acknowledge the instrument support of the PSM Molecular Biology Core Laboratory. Finally, we are grateful to Bob Ritchie of the Ponce Health Sciences University Publications Office for his help with manuscript preparation.

This study was supported by an American Cancer Society grant (RSG-090289-01-MPC) (Q.T.) and NIH/NIAID grant SC1AI112785 (Q.T.) and by the National Institute on Minority Health and Health Disparities of the National Institutes of Health under award number G12MD007597.

REFERENCES

  • 1.Sweet C. 1999. The pathogenicity of cytomegalovirus. FEMS Microbiol Rev 23:457–482. doi: 10.1111/j.1574-6976.1999.tb00408.x. [DOI] [PubMed] [Google Scholar]
  • 2.Landolfo S, Gariglio M, Gribaudo G, Lembo D. 2003. The human cytomegalovirus. Pharmacol Ther 98:269–297. doi: 10.1016/S0163-7258(03)00034-2. [DOI] [PubMed] [Google Scholar]
  • 3.Mocarski ES Jr, Shenk T, Pass RF. 2006. Cytomegaloviruses, 5th ed Lippincott Williams &Wilkins, Philadelphia, PA. [Google Scholar]
  • 4.Tang Q, Li L, Maul GG. 2005. Mouse cytomegalovirus early M112/113 proteins control the repressive effect of IE3 on the major immediate-early promoter. J Virol 79:257–263. doi: 10.1128/JVI.79.1.257-263.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tang Q, Maul G. 2005. Immediate early interactions and epigenetic defense mechanisms, p 131–149. In Reddehase MJ. (ed), Cytomegaloviruses: molecular biology and immunology. Horizon Scientific Press, Hethersett, Norwich, United Kingdom. [Google Scholar]
  • 6.Hagemeier C, Walker SM, Sissons PJ, Sinclair JH. 1992. The 72K IE1 and 80K IE2 proteins of human cytomegalovirus independently trans-activate the c-fos, c-myc and hsp70 promoters via basal promoter elements. J Gen Virol 73:2385–2393. doi: 10.1099/0022-1317-73-9-2385. [DOI] [PubMed] [Google Scholar]
  • 7.Liu B, Hermiston TW, Stinski MF. 1991. A cis-acting element in the major immediate-early (IE) promoter of human cytomegalovirus is required for negative regulation by IE2. J Virol 65:897–903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Scully AL, Sommer MH, Schwartz R, Spector DH. 1995. The human cytomegalovirus IE2 86-kilodalton protein interacts with an early gene promoter via site-specific DNA binding and protein-protein associations. J Virol 69:6533–6540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Awasthi S, Isler JA, Alwine JC. 2004. Analysis of splice variants of the immediate-early 1 region of human cytomegalovirus. J Virol 78:8191–8200. doi: 10.1128/JVI.78.15.8191-8200.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sadanari H, Yamada R, Yamagoshi T, Ohnishi K, Matsubara K, Fukuda S, Tanaka J. 2000. The major immediate-early genes of human cytomegalovirus induce two novel proteins with molecular weights of 91 and 102 kilodaltons. Arch Virol 145:1257–1266. doi: 10.1007/s007050070125. [DOI] [PubMed] [Google Scholar]
  • 11.Ahn JH, Hayward GS. 1997. The major immediate-early proteins IE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells. J Virol 71:4599–4613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Meier JL, Stinski MF. 1997. Effect of a modulator deletion on transcription of the human cytomegalovirus major immediate-early genes in infected undifferentiated and differentiated cells. J Virol 71:1246–1255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Stenberg RM. 1996. The human cytomegalovirus major immediate-early gene. Intervirology 39:343–349. [DOI] [PubMed] [Google Scholar]
  • 14.Stenberg RM, Thomsen DR, Stinski MF. 1984. Structural analysis of the major immediate early gene of human cytomegalovirus. J Virol 49:190–199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Hennighausen L, Fleckenstein B. 1986. Nuclear factor 1 interacts with five DNA elements in the promoter region of the human cytomegalovirus major immediate early gene. EMBO J 5:1367–1371. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Martinez FP, Cruz R, Lu F, Plasschaert R, Deng Z, Rivera-Molina YA, Bartolomei MS, Lieberman PM, Tang Q. 16 April 2014. CTCF binding to the first intron of the major immediate-early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication. J Virol doi: 10.1128/JVI.00845-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Marchini A, Liu H, Zhu H. 2001. Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J Virol 75:1870–1878. doi: 10.1128/JVI.75.4.1870-1878.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sanders RL, Clark CL, Morello CS, Spector DH. 2008. Development of cell lines that provide tightly controlled temporal translation of the human cytomegalovirus IE2 proteins for complementation and functional analyses of growth-impaired and nonviable IE2 mutant viruses. J Virol 82:7059–7077. doi: 10.1128/JVI.00675-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Stinski MF, Petrik DT. 2008. Functional roles of the human cytomegalovirus essential IE86 protein. Curr Top Microbiol Immunol 325:133–152. [DOI] [PubMed] [Google Scholar]
  • 20.Wiebusch L, Asmar J, Uecker R, Hagemeier C. 2003. Human cytomegalovirus immediate-early protein 2 (IE2)-mediated activation of cyclin E is cell-cycle-independent and forces S-phase entry in IE2-arrested cells. J Gen Virol 84:51–60. doi: 10.1099/vir.0.18702-0. [DOI] [PubMed] [Google Scholar]
  • 21.Wiebusch L, Hagemeier C. 1999. Human cytomegalovirus 86-kilodalton IE2 protein blocks cell cycle progression in G1. J Virol 73:9274–9283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shlapobersky M, Sanders R, Clark C, Spector DH. 2006. Repression of HMGA2 gene expression by human cytomegalovirus involves the IE2 86-kilodalton protein and is necessary for efficient viral replication and inhibition of cyclin A transcription. J Virol 80:9951–9961. doi: 10.1128/JVI.01300-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cherrington JM, Mocarski ES. 1989. Human cytomegalovirus ie1 transactivates the alpha promoter-enhancer via an 18-base-pair repeat element. J Virol 63:1435–1440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Greaves RF, Mocarski ES. 1998. Defective growth correlates with reduced accumulation of a viral DNA replication protein after low-multiplicity infection by a human cytomegalovirus ie1 mutant. J Virol 72:366–379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Mocarski ES, Kemble GW, Lyle JM, Greaves RF. 1996. A deletion mutant in the human cytomegalovirus gene encoding IE1(491aa) is replication defective due to a failure in autoregulation. Proc Natl Acad Sci U S A 93:11321–11326. doi: 10.1073/pnas.93.21.11321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Tarrant-Elorza M, Rossetto CC, Pari GS. 2014. Maintenance and replication of the human cytomegalovirus genome during latency. Cell Host Microbe 16:43–54. doi: 10.1016/j.chom.2014.06.006. [DOI] [PubMed] [Google Scholar]
  • 27.Cosme RS, Yamamura Y, Tang Q. 2009. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus. J Virol 83:2839–2850. doi: 10.1128/JVI.02407-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Adair R, Liebisch GW, Su Y, Colberg-Poley AM. 2004. Alteration of cellular RNA splicing and polyadenylation machineries during productive human cytomegalovirus infection. J Gen Virol 85:3541–3553. doi: 10.1099/vir.0.80450-0. [DOI] [PubMed] [Google Scholar]
  • 29.Akter P, Cunningham C, McSharry BP, Dolan A, Addison C, Dargan DJ, Hassan-Walker AF, Emery VC, Griffiths PD, Wilkinson GW, Davison AJ. 2003. Two novel spliced genes in human cytomegalovirus. J Gen Virol 84:1117–1122. doi: 10.1099/vir.0.18952-0. [DOI] [PubMed] [Google Scholar]
  • 30.Sourvinos G, Tavalai N, Berndt A, Spandidos DA, Stamminger T. 2007. Recruitment of human cytomegalovirus immediate-early 2 protein onto parental viral genomes in association with ND10 in live-infected cells. J Virol 81:10123–10136. doi: 10.1128/JVI.01009-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Sinclair J. 2010. Chromatin structure regulates human cytomegalovirus gene expression during latency, reactivation and lytic infection. Biochim Biophys Acta 1799:286–295. doi: 10.1016/j.bbagrm.2009.08.001. [DOI] [PubMed] [Google Scholar]
  • 32.Gaddy CE, Wong DS, Markowitz-Shulman A, Colberg-Poley AM. 2010. Regulation of the subcellular distribution of key cellular RNA-processing factors during permissive human cytomegalovirus infection. J Gen Virol 91:1547–1559. doi: 10.1099/vir.0.020313-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.de Bruyn Kops A, Knipe DM. 1988. Formation of DNA replication structures in herpes virus-infected cells requires a viral DNA binding protein. Cell 55:857–868. doi: 10.1016/0092-8674(88)90141-9. [DOI] [PubMed] [Google Scholar]
  • 34.Stenberg RM, Fortney J, Barlow SW, Magrane BP, Nelson JA, Ghazal P. 1990. Promoter-specific trans activation and repression by human cytomegalovirus immediate-early proteins involves common and unique protein domains. J Virol 64:1556–1565. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Borst EM, Hahn G, Koszinowski UH, Messerle M. 1999. Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: a new approach for construction of HCMV mutants. J Virol 73:8320–8329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Warden C, Tang Q, Zhu H. 2011. Herpesvirus BACs: past, present, and future. J Biomed Biotechnol 2011:124595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Munch K, Messerle M, Plachter B, Koszinowski UH. 1992. An acidic region of the 89K murine cytomegalovirus immediate early protein interacts with DNA. J Gen Virol 73:499–506. doi: 10.1099/0022-1317-73-3-499. [DOI] [PubMed] [Google Scholar]
  • 38.Tang Q, Maul GG. 2006. Mouse cytomegalovirus crosses the species barrier with help from a few human cytomegalovirus proteins. J Virol 80:7510–7521. doi: 10.1128/JVI.00684-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hall KB. 2002. RNA-protein interactions. Curr Opin Struct Biol 12:283–288. doi: 10.1016/S0959-440X(02)00323-8. [DOI] [PubMed] [Google Scholar]
  • 40.Spadaccini R, Reidt U, Dybkov O, Will C, Frank R, Stier G, Corsini L, Wahl MC, Luhrmann R, Sattler M. 2006. Biochemical and NMR analyses of an SF3b155-p14-U2AF-RNA interaction network involved in branch point definition during pre-mRNA splicing. RNA 12:410–425. doi: 10.1261/rna.2271406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Warf MB, Diegel JV, von Hippel PH, Berglund JA. 2009. The protein factors MBNL1 and U2AF65 bind alternative RNA structures to regulate splicing. Proc Natl Acad Sci U S A 106:9203–9208. doi: 10.1073/pnas.0900342106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Caviness K, Bughio F, Crawford LB, Streblow DN, Nelson JA, Caposio P, Goodrum F. 2016. Complex interplay of the UL136 isoforms balances cytomegalovirus replication and latency. mBio 7:. doi: 10.1128/mBio.01986-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.O'Connor CM, Nukui M, Gurova KV, Murphy EA. 2016. Inhibition of the FACT complex reduces transcription from the human cytomegalovirus major immediate early promoter in models of lytic and latent replication. J Virol 90:4249–4253. doi: 10.1128/JVI.02501-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Goodrum F, Caviness K, Zagallo P. 2012. Human cytomegalovirus persistence. Cell Microbiol 14:644–655. doi: 10.1111/j.1462-5822.2012.01774.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Davies RC, Calvio C, Bratt E, Larsson SH, Lamond AI, Hastie ND. 1998. WT1 interacts with the splicing factor U2AF65 in an isoform-dependent manner and can be incorporated into spliceosomes. Genes Dev 12:3217–3225. doi: 10.1101/gad.12.20.3217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sickmier EA, Frato KE, Shen H, Paranawithana SR, Green MR, Kielkopf CL. 2006. Structural basis for polypyrimidine tract recognition by the essential pre-mRNA splicing factor U2AF65. Mol Cell 23:49–59. doi: 10.1016/j.molcel.2006.05.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Spellman R, Rideau A, Matlin A, Gooding C, Robinson F, McGlincy N, Grellscheid SN, Southby J, Wollerton M, Smith CW. 2005. Regulation of alternative splicing by PTB and associated factors. Biochem Soc Trans 33:457–460. doi: 10.1042/BST0330457. [DOI] [PubMed] [Google Scholar]
  • 48.Maul GG. 2008. Initiation of cytomegalovirus infection at ND10. Curr Top Microbiol Immunol 325:117–132. [DOI] [PubMed] [Google Scholar]
  • 49.Tang Q, Maul GG. 2006. Immediate early interactions and epigenetic defense mechanisms of cytomegaloviruses. Caister Academic Press, Wymondham, England. [Google Scholar]
  • 50.Castelo-Branco P, Furger A, Wollerton M, Smith C, Moreira A, Proudfoot N. 2004. Polypyrimidine tract binding protein modulates efficiency of polyadenylation. Mol Cell Biol 24:4174–4183. doi: 10.1128/MCB.24.10.4174-4183.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Noh SJ, Lee K, Paik H, Hur CG. 2006. TISA: tissue-specific alternative splicing in human and mouse genes. DNA Res 13:229–243. doi: 10.1093/dnares/dsl011. [DOI] [PubMed] [Google Scholar]
  • 52.Spellman R, Smith CW. 2006. Novel modes of splicing repression by PTB. Trends Biochem Sci 31:73–76. doi: 10.1016/j.tibs.2005.12.003. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES