Abstract
Exostosin glycosyltransferase (EXT) 1 and EXT2 have been identified as causative genes in osteochondroma; however, it is not known whether these genes are also involved in condylar osteochondromas. The aim of this study was to identify EXT1 and EXT2 mutations in patients with non-hereditary osteochondromas of the mandibular condyle. DNA was obtained from resected tissues (cartilage cap) of 12 patients with solitary condylar osteochondromas. The exons, 3′,5′-untranslated regions and intron-exon boundaries of EXT1 and EXT2 were amplified by polymerase chain reaction and the products were sequenced directly. Through direct sequencing, four genetic variations of EXT1 in 4 cases and three variations of EXT2 in 5 cases were identified. The intronic alteration of the EXT2 gene, occurring in 2 cases, was novel, whereas the other alterations had been previously reported. Nonsense somatic mutations were detected in tumor DNA. Our study extended the mutational spectrum in EXT1 and EXT2 and may facilitate a better understanding of the pathophysiology of condylar osteochondromas.
Keywords: exostosin glycosyltransferases 1 and 2, mutation, condylar osteochondroma
Introduction
Osteochondroma is a cartilage-capped bony projection arising from the external surface of bone, containing a marrow cavity that is continuous with that of the underlying bone (1). Osteochondroma is the most common benign bone tumour, mainly arising in the juxta-epiphyseal region of long bones (1). Approximately 15% of osteochondromas occur in the context of multiple osteochondromas (MO), previously referred to as hereditary multiple exostoses, which is an autosomal dominantly inherited disorder (2,3), while the majority of osteochondromas present as solitary (non-hereditary) lesions. Solitary and multiple osteochondromas are histologically indistinguishable (4). Osteochondromas have been associated with defects in the exostosin glycosyltransferase (EXT) 1 gene on chromosome 8q24.11-q24.13 (MIM 608177) and EXT2 on chromosome 11p12-p11 (MIM 608210) (5–7).
Osteochondroma may be an incidental finding, or diagnosed due to secondary events, such as esthetic or mechanical problems. Osteochondromas of the mandibular condyle have been associated with facial asymmetry, preauricular pain or edema, occlusal disorders, limitation of mouth opening, even condylar neck fracture. The most severe complication is malignant transformation into chondrosarcoma. According to Roychoudhury et al (8), by 2011 at least 108 cases had been reported in the English-language literature; those studies were mainly focused on clinical reports, such as clinical manifestations, radiological findings, treatment and prognosis, whereas the study on pathogenesis and molecular biology remains at the initial stage. However, it is not known whether the EXT genes are also involved in condylar osteochondromas. We performed a mutation analysis of the EXT1 and EXT2 genes in 12 cases of solitary osteochondroma of the condyle, to estimate the distribution of mutations that lead to the development of condylar osteochondromas.
Patients and methods
Patients
A total of 12 sporadic patients diagnosed with condylar osteochondroma were included in this study. Patients with a solitary osteochondroma were selected based on a review of their pathological, clinical and radiological data. After obtaining written informed consent, cartilage from the cap of the resected specimens was collected from each participant. The patients comprised 5 women and 7 men, with a mean age of 45.08 years (range, 23–76 years). The clinical characteristics of all the patients are summarised in Table I.
Table I.
Characteristics of 12 condylar osteochondroma patients.
| Case | Gender | Age (years) | Side | Duration of symptoms | Symptoms |
|---|---|---|---|---|---|
| 1 | M | 44 | Right | >3 years | Facial asymmetry, LMO, occlusal disorder |
| 2 | F | 76 | Right | 3 years | Facial asymmetry, LMO, occlusal disorder, pain |
| 3 | M | 49 | Left | 1 months | Facial asymmetry, pain, clicking, occlusal disorder |
| 4 | M | 65 | Right | 6 months | Numbness of right tongue base, pain, occlusal disorder |
| 5 | M | 50 | Right | 8 months | Facial asymmetry, clicking, occlusal disorder |
| 6 | F | 24 | Left | 4 months | Facial asymmetry, occlusal disorder |
| 7 | M | 23 | Left | 2 years | Facial asymmetry, occlusal disorder |
| 8 | M | 32 | Right | >5 years | Facial asymmetry, LMO, pain |
| 9 | F | 39 | Left | 7 years | Facial asymmetry, pain, occlusal disorder |
| 10 | F | 61 | Left | 2 years | Facial asymmetry, clicking, LMO, occlusal disorder |
| 11 | M | 39 | Left | >2 years | LMO, pain |
| 12 | F | 39 | Right | 2 months | Facial asymmetry |
M, male; F, female; LMO, limitation of mouth opening.
Mutation analysis of EXT genes
DNA was extracted from the cartilage cap of resected specimens using the DNeasy Tissue kit (cat. no. 69581; Qiagen). DNA was polymerase chain reaction (PCR)-amplified with 13 pairs of PCR primers for 11 exons, 3′,5′-untranslated regions (UTR) and intron-exon boundaries of the EXT1 gene, and 16 pairs for 15 exons, 3′,5′-UTRs and intron-exon boundaries of the EXT2 gene (Table II). PCR cycling was performed on the 2720 Thermal Cycler (Applied Biosystems) using the Taq PCR Mastermix kit (Takara Biotechnology). All PCR programs included an initial denaturation of 5 min at 94°C, followed by 32 cycles of 15 sec at 94°C, 35 sec at 55–60°C, and 60 sec at 72°C; and a final extension step of 5 min at 72°C. The products were purified with QIAquick PCR Purification kit (cat. no. 28106; Qiagen) and the purified PCR products were sequenced using the forward and reverse primers. Automated sequencing was performed on an ABI PRISM® 3730XL Genetic Analyzer (Applied Biosystems).
Table II.
Sequencing regions and primers of exostosin glycosyltransferase (EXT) 1 and EXT2 genes.
| Gene | Exon | Sense (5′-3′) | Antisense (3′-5′) | Fragment size (bp) |
|---|---|---|---|---|
| EXT1 | 1 | CGAGCGCAGGAGTAAACAC | ATTGATCCCAAGGAACGAA | 824 |
| 1 | GAAAGGCATCCAGAGAAGG | GACTCAGGACAAAGAGGCAC | 614 | |
| 1 | AAAACGGCTTCAAAGTCTACG | TTGCTCAGTTCCAGGCTCA | 768 | |
| 2 | GGGGTGGGGAACAAGAA | GGAACTGAGAGACAATGAAG | 906 | |
| 3 | GAAATGGGGTTTTAGCA | GTTATTGAAAGGGGTGG | 626 | |
| 4 | GAAGTGCTTGGGAGATAA | CGAAGGATGCCATTGAG | 834 | |
| 5 | AGTCTATTTTGGAATGAGC | GAGATATTGGGATTGTGA | 804 | |
| 6 | GCTCTTCCTTTCACCTTT | TCTCTGTAACCCATCCCT | 794 | |
| 7 | CGGACACAGTTGGTTTT | CCACTTTGTAGATGAGGAA | 624 | |
| 8 | GATTTATCTTTGTACCCTCTTTGAC | ATGCAGAACACGCACCC | 675 | |
| 9 | AGATGTGTTTGTGTCTCACG | CCAACTGAAAATGTTACTCTAC | 744 | |
| 10 | GGGAGTAATAATAGAACCTG | CAAATGGACTAAGACAAACT | 711 | |
| 11 | TCAGTTGCTAAGTCGTG | AACAAAGAACTCTGGTTT | 817 | |
| EXT2 | 1 | CGCCTGCCTGGGAAAAC | GGCTAGGAGAACAGGTGGGTA | 548 |
| 2 | CTGCTGGGTCGGGACAA | GTTCCCACCGAATGTAACAAA | 794 | |
| 3 | TGGTCACAGTTACTTGGG | GGCAGACTACTCTTCACG | 997 | |
| 4 | TAACCAGGCTTCTCTAATG | CGCTACCTTCTCTCAGTAA | 751 | |
| 5 | GGGAAGTAAGGAAAGGGTAT | CTAAGGGCAATGTGAAGC | 815 | |
| 6 | AACTGTTCCCAAATAAGATG | GGGGGTAAAAGCAAGATA | 763 | |
| 7 | AAGGTAGGCTGAGGTAAG | GTAAAGGAAGGGACACG | 776 | |
| 8 | GTAGGGAGTGGGAGGTAAA | AATGGGGTGTCAGAAGGT | 818 | |
| 9 | ACATGGCTATTCTCATCAT | TGCCTCCTTACTTATCTCT | 668 | |
| 10 | GGGTTTGGGGAGAGAAT | GAGCAGAGATAAGAAAGGAGA | 826 | |
| 11 | TTGAAGCCAATTTGTTC | CTTTGTTTGTCAGTGTCG | 877 | |
| 12 | TAATACAAATCAGGGCAGTT | GGCTCACAATACAATCCA | 883 | |
| 13 | TAATGCCTCCTTTTACC | GCCTTTATTCTGATACTGA | 533 | |
| 14 | GAAAGAGGAGAAAGAGCG | CCCTGAAAAATAATCCAGTA | 827 | |
| 15 | CATCTCCTGTTCACGTTCT | GCTGGTGCTCTTCCTGT | 949 | |
| 15 | TGGAGAAGAGAAGCGTGTT | GCAAAGCAGTTGTATAGCAG | 736 |
Results
Genetic variations of EXT1
Through direct sequencing of all exons, intron-exon boundaries and 3′,5′-UTRs, four genetic variations of EXT1 were identified, of which one was a synonymous coding variation (chr8_118819578_G/A in case 8), and three were in intronic regions (chr8_118830894_G/A and chr8_118834952_G/A in case 1, and chr8_118830820_A/G in case 2), which have been previously reported (Table III).
Table III.
Characters of EXT genetic variations in condylar osteochondroma.
| Gene | Case | Genetic variation | Identity in dbSNP | Region | Allele freq |
|---|---|---|---|---|---|
| EXT1 | 1 | chr8_118830894_G/A | rs4876757 | Intron | 0.2688 |
| 2 | chr8_118830820_A/G | rs10955837 | Intron | 0.4446 | |
| 1 | chr8_118834952_G/A | rs4355803 | Intron | 0.2848 | |
| 8 | chr8_118819578_G/A | rs7837891 | Exon 9 | 0.3681 | |
| EXT2 | 3 | chr11_44117372_C/G | rs12800404 | 5′UTR | 0.0403 |
| 7 | chr11_44117899_G/T | Novel | Intron | – | |
| 12 | chr11_44117899_G/T | Novel | Intron | – | |
| 1 | chr11_44129290_C/A | rs4755228 | Exon 3 | 0.0893 | |
| 2 | chr11_44129290_C/A | rs4755228 | Exon 3 | 0.0893 |
EXT, exostosin glycosyltransferase; dbSNP, single-nucleotide polymorphism database; UTR, untranslated region.
Genetic variations of EXT2
Five variations of EXT2 were detected, two of which were synonymous coding variations (chr11_44129290_C/A in cases 1 and 2), two were in intronic regions (chr11_44117899_G/T in cases 7 and 12) and one was in the 5′-UTR (chr11_44117372_C/G in case 3). The genetic variations (chr11_44117899_G/T in cases 7 and 12) in EXT2 were novel (Fig. 1, Table III). All the mutations were confirmed by repeat PCR and sequencing.
Figure 1.
Novel polymorphic loci of exostosin glycosyltransferase 2 in samples 7 and 12.
Discussion
Osteochondroma was previously considered as a perversion in the direction of normal bone growth, resulting from aberrant epiphyseal development (9). However, later studies demonstrated that loss or mutation of EXT1 or EXT2 are crucial in the pathogenesis of solitary as well as hereditary osteochondromas (10,11). Germline mutations of either the EXT1 or EXT2 gene may be identified in >85% of the analyzed MO cases and MO families (12–16). Approximately 77–80% of intragenic EXT1 and EXT2 mutations are inactivating mutations (44–66% associated with EXT1 and 27% with EXT2) (16,17). These alterations result in truncated (non-functional) EXT proteins (18,19). The protein products of EXT1 and EXT2 are type II transmembrane glycoproteins and comprise a Golgi-localized hetero-oligomeric complex involved in heparan sulphate proteoglycan (HSPG) biosynthesis. Hameetman et al (20) found that EXT1 or EXT2 mRNA expression in osteochondromas was decreased; however, in non-hereditary tumors, only decreased EXT1 mRNA expression was detected. Decreased EXT1 or EXT2 mRNA expression in osteochondromas was associated with intracellular accumulation of HSPGs in the Golgi apparatus. It has been shown that a lack of HSPGs on the cell surface affects growth signaling pathways in the growth plate [e.g., Indian hedgehog (IHH) signaling] and, possibly, those in osteochondromas (21–23). In the growth plate, IHH requires interaction with HSPGs to diffuse through the extracellular matrix to its receptor (21).
Somatic mutations in the EXT genes are extremely rare in non-hereditary osteochondromas and have been described in only 3 cases (24–26). However, the observation that loss of heterozygosity (LOH) and clonal rearrangement at 8q24 (EXT1 locus) are as frequent in non-hereditary osteochondromas as are EXT1 gene mutations in patients with hereditary osteochondromas, suggests that EXT1 may be involved in the development of non-hereditary osteochondromas (10,11,27). By contrast, LOH at the EXT2 locus has been reported in only 1 case of non-hereditary osteochondroma (28).
Structural changes in the EXT1 locus have been reported in 10/30 non-hereditary and in 1/13 hereditary osteochondromas (10,11). LOH detected by microsatellite analysis using DNA isolated from the cartilaginous cap was found almost exclusively at the EXT1 locus (27). Fluorescence in situ hybridization revealed loss of the 8q24.1 locus in 27/34 (79%) osteochondromas (29). Finally, in 7/8 solitary osteochondromas, homozygous deletion of EXT1 was detected (30). Of note, EXT2 was found to be affected only in MO and not in solitary lesions. In our study, we analyzed 12 patients with solitary osteochondroma for the presence of mutations in the EXT1 and EXT2 genes. A novel nonsense mutation (chr11_44117899_G/T in the intronic region in cases 7 and 12) was identified. The other 7 variations were already in the databases. Apart from known polymorphisms, no sense somatic or germline mutations were detected in tumor DNA. The results were consistent with the rarity of EXT gene mutations in non-hereditary osteochondromas. As the LOH and clonal rearrangement in EXT genes are common, we should analyse the incidence of deletions and rearrangement in condylar osteochondromas.
In conclusion, we screened EXT1 and EXT2 mutations in 12 patients with non-hereditary osteochondromas of the mandibular condyle. To the best of our knowledge, this is the first study to identify mutations of EXT1 and EXT2 in condylar osteochondromas. Our study extended the mutational spectrum in EXT1 and EXT2 and may facilitate a better understanding of the pathophysiology of condylar osteochondromas.
References
- 1.Khurana J, Abdul-Karim F, Bovée JVMG. Osteochondroma. In: World Health Organization Classification of Tumours. In: Fletcher CDM, Unni KK, Mertens F, editors. Pathology and Genetics of Tumours of Soft Tissue and Bone. IARC Press; Lyon: 2002. pp. 234–236. [Google Scholar]
- 2.Wicklund CL, Pauli RM, Johnston D, Hecht JT. Natural history study of hereditary multiple exostoses. Am J Med Genet. 1995;55:43–46. doi: 10.1002/ajmg.1320550113. [DOI] [PubMed] [Google Scholar]
- 3.Bovée JVMG, Hogendoorn PCW. Multiple osteochondromas. In: World Health Organization Classification of Tumours. In: Fletcher CDM, Unni KK, Mertens F, editors. Pathology and Genetics of Tumours of Soft Tissue and Bone. IARC Press; Lyon: 2002. pp. 360–362. [Google Scholar]
- 4.Hameetman L, Bovée JV, Taminiau AH, Kroon HM, Hogendoorn PC. Multiple osteochondromas: Clinicopathological and genetic spectrum and suggestions for clinical management. Hered Cancer Clin Pract. 2004;2:161–173. doi: 10.1186/1897-4287-2-4-161. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wu YQ, Heutink P, de Vries BB, Sandkuijl LA, van den Ouweland AM, Niermeijer MF, Galjaard H, Reyniers E, Willems PJ, Halley DJ. Assignment of a second locus for multiple exostoses to the pericentromeric region of chromosome 11. Hum Mol Genet. 1994;3:167–171. doi: 10.1093/hmg/3.1.167. [DOI] [PubMed] [Google Scholar]
- 6.Wuyts W, Ramlakhan S, Van Hul W, Hecht JT, van den Ouweland AM, Raskind WH, Hofstede FC, Reyniers E, Wells DE, de Vries B. Refinement of the multiple exostoses locus (EXT2) to a 3-cM interval on chromosome 11. Am J Hum Genet. 1995;57:382–387. [PMC free article] [PubMed] [Google Scholar]
- 7.Lüdecke HJ, Ahn J, Lin X, Hill A, Wagner MJ, Schomburg L, Horsthemke B, Wells DE. Genomic organization and promoter structure of the human EXT1 gene. Genomics. 1997;40:351–354. doi: 10.1006/geno.1996.4577. [DOI] [PubMed] [Google Scholar]
- 8.Roychoudhury A, Bhatt K, Yadav R, Bhutia O, Roychoudhury S. Review of osteochondroma of mandibular condyle and report of a case series. J Oral Maxillofac Surg. 2011;69:2815–2823. doi: 10.1016/j.joms.2010.10.016. [DOI] [PubMed] [Google Scholar]
- 9.Huvos AG. Diagnosis, Treatment and Prognosis. 2nd. WB Saunders; Philadelphia: 1991. Bone Tumors. [Google Scholar]
- 10.Mertens F, Rydholm A, Kreicbergs A, Willén H, Jonsson K, Heim S, Mitelman F, Mandahl N. Loss of chromosome band 8q24 in sporadic osteocartilaginous exostoses. Genes Chromosomes Cancer. 1994;9:8–12. doi: 10.1002/gcc.2870090103. [DOI] [PubMed] [Google Scholar]
- 11.Bridge JA, Nelson M, Orndal C, Bhatia P, Neff JR. Clonal karyotypic abnormalities of the hereditary multiple exostoses chromosomal loci 8q24.1 (EXT1) and 11p11-12 (EXT2) in patients with sporadic and hereditary osteochondromas. Cancer. 1998;82:1657–1663. doi: 10.1002/(SICI)1097-0142(19980501)82:9<1657::AID-CNCR10>3.0.CO;2-3. [DOI] [PubMed] [Google Scholar]
- 12.Wuyts W, Van Hul W, De Boulle K, Hendrickx J, Bakker E, Vanhoenacker F, Mollica F, Lüdecke HJ, Sayli BS, Pazzaglia UE, et al. Mutations in the EXT1 and EXT2 genes in hereditary multiple exostoses. Am J Hum Genet. 1998;62:346–354. doi: 10.1086/301726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wuyts W, Radersma R, Storm K, Vits L. An optimized DHPLC protocol for molecular testing of the EXT1 and EXT2 genes in hereditary multiple osteochondromas. Clin Genet. 2005;68:542–547. doi: 10.1111/j.1399-0004.2005.00538.x. [DOI] [PubMed] [Google Scholar]
- 14.Lonie L, Porter DE, Fraser M, Cole T, Wise C, Yates L, Wakeling E, Blair E, Morava E, Monaco AP, Ragoussis J. Determination of the mutation spectrum of the EXT1/EXT2 genes in British Caucasian patients with multiple osteochondromas and exclusion of six candidate genes in EXT negative cases. Hum Mutat. 2006;27:1160. doi: 10.1002/humu.9467. [DOI] [PubMed] [Google Scholar]
- 15.Pedrini E, De Luca A, Valente EM, Maini V, Capponcelli S, Mordenti M, Mingarelli R, Sangiorgi L, Dallapiccola B. Novel EXT1 and EXT2 mutations identified by DHPLC in Italian patients with multiple osteochondromas. Hum Mutat. 2005;26:280. doi: 10.1002/humu.9359. [DOI] [PubMed] [Google Scholar]
- 16.Jennes I, Pedrini E, Zuntini M, Mordenti M, Balkassmi S, Asteggiano CG, Casey B, Bakker B, Sangiorgi L, Wuyts W. Multiple osteochondromas: Mutation update and description of the multiple osteochondromas mutation database (MOdb) Hum Mutat. 2009;30:1620–1627. doi: 10.1002/humu.21123. [DOI] [PubMed] [Google Scholar]
- 17.Wuyts W, Van Hul W. Molecular basis of multiple exostoses: Mutations in the EXT1 and EXT2 genes. Hum Mutat. 2000;15:220–227. doi: 10.1002/(SICI)1098-1004(200003)15:3<220::AID-HUMU2>3.0.CO;2-K. [DOI] [PubMed] [Google Scholar]
- 18.McCormick C, Duncan G, Goutsos KT, Tufaro F. The putative tumor suppressors EXT1 and EXT2 form a stable complex that accumulates in the Golgi apparatus and catalyzes the synthesis of heparan sulfate. Proc Natl Acad Sci USA. 2000;97:668–673. doi: 10.1073/pnas.97.2.668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Cheung PK, McCormick C, Crawford BE, Esko JD, Tufaro F, Duncan G. Etiological point mutations in the hereditary multiple exostoses gene EXT1: A functional analysis of heparan sulfate polymerase activity. Am J Hum Genet. 2001;69:55–66. doi: 10.1086/321278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Hameetman L, David G, Yavas A, White SJ, Taminiau AH, Cleton-Jansen AM, Hogendoorn PC, Bovée JV. Decreased EXT expression and intracellular accumulation of HSPG in osteochondromas and peripheral chondrosarcomas. J Pathol. 2007;211:399–409. doi: 10.1002/path.2127. [DOI] [PubMed] [Google Scholar]
- 21.Koziel L, Kunath M, Kelly OG, Vortkamp A. Ext1-dependent heparan sulfate regulates the range of Ihh signaling during endochondral ossification. Dev Cell. 2004;6:801–813. doi: 10.1016/j.devcel.2004.05.009. [DOI] [PubMed] [Google Scholar]
- 22.Hameetman L, Rozeman LB, Lombaerts M, Oosting J, Taminiau AH, Cleton-Jansen AM, Bovée JV, Hogendoorn PC. Peripheral chondrosarcoma progression is accompanied by decreased Indian Hedgehog (IHH) signalling. J Pathol. 2006;209:501–511. doi: 10.1002/path.2008. [DOI] [PubMed] [Google Scholar]
- 23.Benoist-Lasselin C, de Margerie E, Gibbs L, Cormier S, Silve C, Nicolas G, LeMerrer M, Mallet JF, Munnich A, Bonaventure J, et al. Defective chondrocyte proliferation and differentiation in osteochondromas of MHE patients. Bone. 2006;39:17–26. doi: 10.1016/j.bone.2005.12.003. [DOI] [PubMed] [Google Scholar]
- 24.Hecht JT, Hall CR, Snuggs M, Hayes E, Haynes R, Cole WG. Heparan sulfate abnormalities in exostosis growth plates. Bone. 2002;31:199–204. doi: 10.1016/S8756-3282(02)00796-2. [DOI] [PubMed] [Google Scholar]
- 25.Bernard MA, Hall CE, Hogue DA, Cole WG, Scott A, Snuggs MB, Clines GA, Lüdecke HJ, Lovett M, Van Winkle WB, Hecht JT. Diminished levels of the putative tumor suppressor proteins EXT1 and EXT2 in exostosis chondrocytes. Cell Motil Cytoskeleton. 2001;48:149–162. doi: 10.1002/1097-0169(200102)48:2<149::AID-CM1005>3.0.CO;2-3. [DOI] [PubMed] [Google Scholar]
- 26.Hecht JT, Hogue D, Wang Y, Blanton SH, Wagner M, Strong LC, Raskind W, Hansen MF, Wells D. Hereditary multiple exostoses (EXT): Mutational studies of familial EXT1 cases and EXT-associated malignancies. Am J Hum Genet. 1997;60:80–86. [PMC free article] [PubMed] [Google Scholar]
- 27.Bovée JV, Cleton-Jansen AM, Wuyts W, Caethoven G, Taminiau AH, Bakker E, Van Hul W, Cornelisse CJ, Hogendoorn PC. EXT-mutation analysis and loss of heterozygosity in sporadic and hereditary osteochondromas and secondary chondrosarcomas. Am J Hum Genet. 1999;65:689–698. doi: 10.1086/302532. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Esko JD, Selleck SB. Order out of chaos: Assembly of ligand binding sites in heparan sulfate. Annu Rev Biochem. 2002;71:435–471. doi: 10.1146/annurev.biochem.71.110601.135458. [DOI] [PubMed] [Google Scholar]
- 29.Feely MG, Boehm AK, Bridge RS, Krallman PA, Neff JR, Nelson M, Bridge JA. Cytogenetic and molecular cytogenetic evidence of recurrent 8q24.1 loss in osteochondroma. Cancer Genet Cytogenet. 2002;137:102–107. doi: 10.1016/S0165-4608(02)00557-5. [DOI] [PubMed] [Google Scholar]
- 30.Hameetman L, Szuhai K, Yavas A, Knijnenburg J, van Duin M, van Dekken H, Taminiau AH, Cleton-Jansen AM, Bovée JV, Hogendoorn PC. The role of EXT1 in nonhereditary osteochondroma: Identification of homozygous deletions. J Natl Cancer Inst. 2007;99:396–406. doi: 10.1093/jnci/djk067. [DOI] [PubMed] [Google Scholar]

