Skip to main content
American Journal of Physiology - Regulatory, Integrative and Comparative Physiology logoLink to American Journal of Physiology - Regulatory, Integrative and Comparative Physiology
. 2016 Feb 17;310(9):R837–R846. doi: 10.1152/ajpregu.00311.2015

Development of ovine chorionic somatomammotropin hormone-deficient pregnancies

Callie M Baker 1, Lindsey N Goetzmann 1, Jeremy D Cantlon 1, Kimberly M Jeckel 1, Quinton A Winger 1, Russell V Anthony 1,✉
PMCID: PMC5000775  PMID: 26887431

Abstract

Intrauterine growth restriction (IUGR) is a leading cause of neonatal mortality and morbidity. Chorionic somatomammotropin hormone (CSH), a placenta-specific secretory product found at high concentrations in maternal and fetal circulation throughout gestation, is significantly reduced in human and sheep IUGR pregnancies. The objective of this study was to knock down ovine CSH (oCSH) expression in vivo using lentiviral-mediated short-hairpin RNA to test the hypothesis that oCSH deficiency would result in IUGR of near-term fetal lambs. Three different lentiviral oCSH-targeting constructs were used and compared with pregnancies (n = 8) generated with a scrambled control (SC) lentiviral construct. Pregnancies were harvested at 135 days of gestation. The most effective targeting sequence, “target 6” (tg6; n = 8), yielded pregnancies with significant reductions (P ≤ 0.05) in oCSH mRNA (50%) and protein (38%) concentrations, as well as significant reductions (P ≤ 0.05) in placental (52%) and fetal (32%) weights compared with the SC pregnancies. Fetal liver weights were reduced 41% (P ≤ 0.05), yet fetal liver insulin-like growth factor-I (oIGF1) and -II mRNA concentrations were reduced (P ≤ 0.05) 82 and 71%, respectively, and umbilical artery oIGF1 concentrations were reduced 62% (P ≤ 0.05) in tg6 pregnancies. Additionally, fetal liver oIGF-binding protein (oIGFBP) 2 and oIGFBP3 mRNA concentrations were reduced (P ≤ 0.05), whereas fetal liver oIGFBP1 mRNA concentration was not impacted nor was maternal liver oIGF and oIGFBP mRNA concentrations or uterine artery oIGF1 concentrations (P ≥ 0.10). Based on our results, it appears that oCSH deficiency does result in IUGR, by impacting placental development as well as fetal liver development and function.

Keywords: in vivo deficiency, lentivirus, near term, short-hairpin ribonucleic acid


intrauterine growth restriction (IUGR) complicates ∼6% of all human pregnancies and occurs when a fetus has failed to reach its growth potential (18). IUGR is the second leading cause of perinatal mortality and has been linked to increased risk of adult-onset disease such as diabetes, hypertension, heart disease, and stroke (1, 2, 3, 5, 18). While several environmental cues such as maternal malnutrition, substance abuse, diabetes, and multifetus pregnancies have been associated with the development of IUGR, aberrations in placental function account for nearly 60% of IUGR cases in normally formed fetuses (19). Additionally, in pregnancies complicated by IUGR, chorionic somatomammotropin hormone (CSH) concentrations are reduced in maternal circulation for both humans and sheep (31, 40). CSH is a placenta-specific protein hormone that belongs to the growth hormone/prolactin gene family and is the most abundant secretory product of the placenta. The syncytiotrophoblasts of the human placenta and the binucleate cells of the sheep placenta are the sites of CSH synthesis and secretion in maternal and fetal circulations (20). The production of CSH begins during the earliest stages of placental development and continues throughout gestation (47, 50).

Since its discovery >50 years ago, there has only been indirect evidence suggesting a role for CSH in the modulation of maternal and fetal amino acid, carbohydrate, and lipid metabolism to support healthy fetal growth. Maternal CSH is reported to be involved in the mobilization of free fatty acids, increased insulin resistance, and increased glucose and nitrogen retention (7, 9, 10, 11, 23, 21, 48). Fetal CSH is believed to have an anabolic role possibly by eliciting the actions of insulin-like growth factors (IGFs; see Ref. 38). However, inconsistencies in experimental design have led to variable results regarding CSH's function, thus making a precise role for CSH difficult to define. To determine the exact biological role for CSH during pregnancy, the development of a CSH-deficient animal model is critical.

To date, a CSH-deficient model has not been achieved in any species. While gene knockout models in rodents have been available for several decades, rodents uniquely express two structurally distinct forms of CSH during pregnancy (37), which may not be functionally relevant to the single CSH found in primates and sheep. However, the lack of gene knockout techniques in large animal species has inhibited the development of a CSH-deficient model in sheep. Fortunately, recent experiments conducted by Purcell and colleagues (36) demonstrated successful knock down of proline-rich 15 expression in vivo using lentiviral-mediated short-hairpin RNA (shRNA), which inhibited conceptus elongation in the sheep. This evidence suggests that lentiviral-mediated shRNA may be an effective method for the development of a CSH-deficient sheep model. Therefore, the objective of this study was to knock down ovine CSH (oCSH) expression in vivo using lentiviral-mediated shRNA to determine the impact of oCSH deficiency during pregnancy on near-term [135 days of gestation (dGA)] fetal growth. We hypothesized that oCSH deficiency could result in IUGR of fetal lambs.

MATERIALS AND METHODS

All procedures conducted with animals were approved by the Colorado State University Institutional Animal Care and Use Committee.

Lentivirus vector construction.

Lentiviral infection was used to stably integrate and express shRNA targeting oCSH mRNA in the host cell. Four different lentiviral vectors were constructed (Table 1) using two different plasmids: pLentiLox3.7 (plasmid 11795; Addgene, Cambridge, MA) and pGIPZ (Thermo Fisher Scientific, Waltham, MA), two different oCSH targeting sequences: target 2 (tg2) and target 6 (tg6), and a scrambled control sequence (SC).

Table 1.

Lentiviral vectors

Construct Name Vector Promoter oCSH Target
EF-1 SC pGIPZ human elongation factor-1α shRNAmiR-SC
EF-1 tg2 pGIPZ human elongation factor-1α shRNAmiR-tg2
EF-1 tg6 pGIPZ human elongation factor-1α shRNAmiR-tg6
hLL3.7 tg6 pLentiLox 3.7 human U6 shRNA-tg6

oCSH, ovine; chorionic somatomammotropin hormone; SC, scrambled control; tg 2, target 2; tg6, target 6; shRNAmiR, micro-RNA mimic sequences.

The lentiviral vector pLentiLox3.7 (pLL3.7) originally contained the mouse RNA polymerase III U6 promoter, upstream of the multiple cloning site for the introduction of shRNA cassettes, as well as the cytomegalovirus (CMV) promoter upstream of enhanced green fluorescent protein gene (EGFP). To introduce the human RNA polymerase III U6 promoter into the pLL3.7 and remove the mouse U6 promoter, the pLKO.1 vector (plasmid 10878; Addgene), which contains the human U6 promoter, was used as a template. Oligonucleotides containing the oCSH tg6 shRNA sequence were designed with 5′-AgeI and 3′-EcoRI restriction sites for compatibility with pLKO.1 (Table 2). Oligonucleotides were ordered with 5′-phosphates and PAGE purified (Integrated DNA Technologies, Coralville, IA). Oligonucleotides were resuspended in water to 60 pmol/μl, and 1 μl of the sense oligonucleotide and 1 μl of the antisense oligonucleotide were annealed in 48 μl of annealing buffer (100 mM potassium acetate; 30 mM HEPES-KOH, pH 7.4; 2 mM magnesium acetate). The annealing mixture was incubated at 95°C for 4 min, 70°C for 10 min, and 4°C for 10 min. Annealed oligonucleotides were ligated into pLKO.1 digested with AgeI/EcoRI restriction enzymes and treated with calf intestinal phosphatase (New England Biolabs, Ipswich, MA). The human U6 promoter and downstream oCSH tg6 shRNA sequence within pLKO.1 was PCR amplified using a forward primer with a 5′ XbaI restriction site(5′-TCTAGATTCACCGAGGGCCTATTTCCC-3′) and a reverse primer containing a 3′ XhoI restriction site (5′-GAATACTGCCATTTGTCTCGAGGTCG-3′). The resulting PCR amplicon was cloned into the pPCR-Script Amp SK(+) vector (Agilent, Santa Clara, CA). The human U6 promoter and oCSH tg6 shRNA DNA fragment was digested from pPCR-Script Amp SK(+) using XbaI/XhoI restriction enzymes. Subsequently, the DNA fragment was ligated into the pLL3.7 vector also digested with XbaI/XhoI and treated with calf intestinal phosphatase (New England Biolabs). Insertion of the human U6 promoter and oCSH tg6 shRNA sequence into pLL3.7 was verified by restriction digestion to confirm the presence of the DNA fragment between XbaI and XhoI restriction sites, as well as the disappearance of an AgeI restriction site.

Table 2.

oCSH-targeting shRNA/shRNAmiR sequences

Oligonucleotide Sequence (5′-3′)
tg6 shRNA sense CCGGAAGGCCAAAGTACTTGTAGACGTCGACGTCTACAAGTACTTTGGCCTTTTTTTG
tg6 shRNA antisense AATTCAAAAAAAGGCCAAAGTACTTGTAGACGTCGACGTCTACAAGTACTTTGGCCTT
tg2 shRNAmiR sense TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCGGTCATCAACTGCCACACTTTAGTGAAGCCACAGATGTAAAGTGTGGCAGTTGATGACCTTGCCTACTGCCTCGG
tg2 shRNAmiR antisense AATTCCGAGGCAGTAGGCAAGGTCATCAACTGCCACACTTTACATCTGTGGCTTCACTAAAGTGTGGCAGTTGATGACCGCGCTCACTGTCAACAGCAATATACCTTC
tg6 shRNAmiR sense AATTCCGAGGCAGTAGGCAAAGGACAAAGTACTTGTAGACGTACATCTGTGGCTTCACTACGTCTACAAGTACTTTGGCCTGCGCTCACTGTCAACAGCAATATACCTTC
tg6 shRNAmiR antisense TCGAGAAGGTATATTGCTGTTGACAGTGAGCGCAGGTACTTGTAGACGTAGTGAAGCCACAGATGTACGTCTACAAGTACTTTGGCCTTTGCCTACTGCCTCGG

shRNA, short-hairpin RNA.

The lentiviral vector pGIPZ originally contained the CMV promoter upstream of the turbo green fluorescent protein gene (tGFP), puromycin resistance gene, and a multiple cloning site for the introduction of micro-RNA mimic sequences (shRNAmiR). The pGIPZ vector was reconstructed to contain the human elongation factor-1α (hEF-1α) promoter upstream of oCSH tg2, tg6, or SC shRNAmiR sequences (Table 1). To create the oCSH targeting constructs, shRNAmiR oligonucleotides (Table 2) were first inserted in the pGIPZ vector containing the CMV promoter. Oligonucleotides were designed with 5′ XhoI and 3′ EcoRI restriction sites. Oligonucleotides were ordered with 5′-phosphates and PAGE purification (Integrated DNA Technologies), and annealed as described above. Annealed oligonucleotides were ligated into the pGIPZ vector digested with XhoI/EcoRI and treated with calf intestinal phosphatase (New England Biolabs). To introduce the hEF-1α promoter into pGIPZ and remove the CMV promoter, a BstBI restriction site was engineered between the 3′-end of the promoter and the transcription start site for tGFP. Within pGIPZ, the CMV promoter-tGFP cassette is flanked by XbaI and BsrGI restriction sites on the 5′- and 3′-ends, respectively. In addition, BstBI was identified as a unique restriction site between the 3′-end of the promoter and the transcription start site for tGFP, and was not found in the published sequence of the hEF-1α promoter. The XbaI site is also not present in the hEF-1α promoter. Therefore, primers were designed to amplify the hEF-1α promoter and include a 5′ XbaI site in the forward primer (5′-TCTAGACGCTCCGGTGCCCGTC-3′) and a 3′ BstBI site in the reverse primer (5′-TTCGAAAGCTTCAGCTGTGTTCTGGCGGC-3′). The pSico-EF1a-mCh-Puro plasmid (plasmid 31845; Addgene) was used as a template for the hEF-1α promoter. The PCR product was cloned into the pPCR-Script Amp SK(+) vector (Stratagene). Similarly, tGFP was PCR amplified using a forward primer containing a 5′ BstBI restriction site (5′-TTCGAAACCATGGAGAGCGACGAGAG-3′) and reverse primer containing a 3′ BsrGI restriction site (5′-GCTACTTGTACATTATTCTTCACCGGCATCTG-3′), and cloned into pPCR-Script Amp SK(+). The hEF-1α promoter and tGFP were digested from pPCR-Script Amp SK(+) using XbaI/BstBI and BstBI/BsrGI, respectively, and subsequently ligated into pGIPZ digested with XbaI/BsrGI and treated with calf intestinal phosphatase (New England Biolabs). Because a nonsilencing pGIPZ vector (Thermo Fisher Scientific) was available containing a scrambled control shRNAmiR sequence downstream from the original CMV promoter, the CMV promoter was removed and replaced with the hEF-1α promoter according to the procedure described above. All PCR products and constructs were verified by DNA sequencing during and after construction (Colorado State University Proteomics and Metabolomics Facility).

Lentivirus generation.

Lentiviral particles were generated in 293FT cells (Invitrogen) grown in high-glucose DMEM containing 10% fetal bovine serum at 37°C and 5% CO2. On the day of transfection, cells were grown to 60–70% confluency on a 150-mm tissue culture dish. For each 150-mm dish, 8.82 μg of oCSH-targeting plasmid, 6.66 μg of psPAX2 (Addgene) packaging plasmid, and 2.70 μg of pMD2.G (Addgene) packaging plasmid DNA were used for transfection. The plasmid DNA mixture was brought to a total volume of 675 μl using serum-free antibiotic-free high-glucose DMEM. The PolyFect transfection reagent (180 μl; Qiagen) was added to the plasmid DNA mixture and incubated for 10 min at room temperature to allow for complex formation. Immediately before treating cells with the transfection mixture, medium was gently aspirated from cells and replaced with 18 ml of fresh, complete medium. After complex formation, 885 μl of PolyFect transfection mixture was added to each 150-mm dish of 293FT cells dropwise for even distribution. Transfection medium was replaced with fresh complete medium after 4–6 h of incubation at 37°C and 5% CO2. The lentiviral-containing medium was collected at the end of 48 h incubation with the 293FT cells, and the supernatant was ultracentrifuged over a 20% sucrose cushion at 47,000 g for 2 h at 4°C. After ultracentrifugation, lentiviral pellets were resuspended in chemically defined medium for late-stage embryos (CDM-2) (14) and stored in aliquots at −80°C. Frozen aliquots of concentrated lentivirus were thawed, initially diluted 1:40, and then 10-fold serially diluted using high-glucose DMEM supplemented with 10% FBS. Serial dilutions of virus ranging from 10−2 to 10−7 and 8 μg of Polybrene (Sigma-Aldrich, St. Louis, MO) per milliliter of media were added to either 12- or 6-well tissue culture dishes of HEK 293 cells at 80% confluency. Cells were incubated with virus dilutions overnight and washed with PBS, and fresh complete medium was added. If titering pLL3.7 vector-based lentivirus, the number of eGFP-positive cells within the last well containing fluorescent cells were counted 48 h postinfection. The titer was then calculated by dividing the number of live cells by the serial dilution factor from which the live cells were counted and multiplying this number by the initial dilution factor (i.e., 40) used to dilute the original stock of virus. If titering pGIPZ vector-based lentivirus, cells were infected with serial dilutions of virus in replicates of four and put under antibiotic selection (puromycin, 1 μg/ml) 72 h after infection. The titer was calculated between 5 and 7 days after the start of selection. To calculate the titer, the number of replicates of the last serial dilution containing live cells was input into the 50% tissue culture infective dose (TCID50) calculator (25). The TCID50 calculation was then multiplied by the initial dilution factor (×40) used to dilute the original stock of virus to obtain a final concentration of virus.

Blastocyst collection and transfer.

Standing estrus in all ewes was determined using a vasectomized ram. Blastocyst donor and recipient ewes were synchronized by two intramuscular injections of PGF-2α given 4 h apart (10 mg/dose, Lutalyse; Pfizer, New York, NY). After synchronization (48 h), all donor ewes displaying standing estrus were bred by intact rams over a 24-h time period. Late-stage blastocysts were collected from donor ewes 9 days after breeding. Donor ewes were killed using pentobarbital sodium (90 mg/kg iv, Pentasol; Vibrac, Fort Worth, TX), a complete hysterectomy was performed, and the blastocysts were flushed from the uterus using DMEM-F-12 (1:1) medium supplemented with 0.25% BSA. Collected blastocysts were washed in HEPES-buffered chemically defined medium (HCDM-2) for late-stage embryos (14). To infect blastocysts with lentivirus, single hatched blastocysts were incubated in 100 μl drops overlaid with mineral oil. Each drop contained 100,000 transducing units of concentrated lentivirus, 50 ng of Polybrene (5 ng/μl; Sigma-Aldrich), and CDM-2. Drops containing blastocysts were cultured in 5% CO2-5% O2-90% N2 at 37°C for ∼5 h before being transferred. Blastocysts were washed in HCDM-2 immediately before transfer.

Recipient ewes that had displayed standing estrus behavior within 24 h of the donor ewes were eligible to receive blastocysts. Recipient ewes were fasted for ∼16 h before blastocyst transfer. Recipient ewes were sedated using ketamine (12.5 mg/kg iv, Ketacine; VetOne, Boise, ID) and diazepam (0.125 mg/kg iv; Hospira, Lake Forest, IL), intubated with an endotracheal tube, and maintained on 2 l/min O2 and 1–2% isofluorane (Fluriso; VetOne) during the surgical blastocyst transfer. The transfer was performed using a fine fire-polished glass pipette inserted through a puncture wound in the uterine horn ipsilateral to the corpus luteum. A single blastocyst was transferred into each recipient. A total of 49 blastocysts were transferred to recipient ewes, including: 13 hEF-1 SC-, 11 hEF-1 tg2-, 10 hEF-1 tg6-, and 15 hLL3.7 tg6-infected blastocysts. Postoperative pain was managed by intramuscular administration of flunixin meglumine (100 mg im/dose, Banamine; Merck, Whitehouse Station, NJ) immediately before surgery and again at 24, 48, and 72 h after surgery. In addition, ampicillin was administered (1 g im/dose, Polyflex; Boehringer Ingelheim, St. Joseph, MO) immediately before surgery and again at 24 and 48 h after surgery. After surgery, recipient ewes were given an ad libitum diet of alfalfa hay and water and monitored for 72 h postsurgery.

Tissue collection.

For analysis of oCSH knockdown, terminal surgeries were conducted on mature crossbred ewes at 135 dGA, and tissues were collected. A total of 33 pregnancies were harvested at 135 dGA, including: 8 hEF-1 SC, 9 hEF-1 tg2, 7 hEF-1 tg6, and 9 hLL3.7 tg6 pregnancies. Pregnant recipient ewes were food and water restricted for 16 h before surgery. Pregnant recipient ewes were sedated using ketamine (12.5 mg/kg iv, Ketacine; VetOne) and diazepam (0.125 mg/kg iv; Hospira), intubated with an endotracheal tube, and maintained on 2 l/min O2 and 1–2% isofluorane (Fluriso; VetOne). Fetal blood was simultaneously collected from the umbilical artery and vein, and maternal blood was collected from the uterine artery and vein ipsilateral to the fetus. The fetus was then killed using pentobarbital sodium by intravenous administration through the umbilical vein (90 mg/kg, Pentasol; Vibrac) and removed. The recipient ewe was also killed using pentobarbital sodium (90 mg/kg iv, Pentasol; Vibrac). All blood samples were allowed to coagulate and then centrifuged at 2,000 g for 10 min at 4°C. Serum was collected and stored at −80°C until use. Sex, body weight (FBW), and crown-rump length (CRL) were recorded for the recovered fetus. The fetal liver was harvested, recorded for weight, and stored in a 50-ml conical that was snap-frozen in liquid nitrogen. A portion of the maternal liver was also harvested and stored in a 50-ml conical tube that was snap-frozen in liquid nitrogen. After a complete hysterectomy was performed, all placentomes were excised, washed in PBS, and recorded for placental weight (PW) and total placentome number. Placentomes were then classified based on morphology as either type A/B or type C/D placentomes, and the total number of each placentome type was recorded. Type A placentomes are concave in shape, and the maternal caruncle surrounds a small portion of the fetal cotyledon tissue (46). In contrast, type D placentomes are convex in shape, and the fetal cotyledon tissue surrounds the maternal caruncle tissue (46). Type B and C placentomes are intermediate in morphology (46). Type A/B fetal cotyledons were separated from maternal caruncles, and the cotyledon tissue was stored in 50-ml conical tubes that were snap-frozen in liquid nitrogen. After being frozen, tissue samples were pulverized using a mortar and pestle. Pulverized tissue was kept frozen at −80°C until use.

RNA isolation.

Total cellular RNA was isolated from 135 dGA fetal cotyledon, fetal liver, and maternal liver tissue using the RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. RNA concentration was quantified using the BioTek Synergy 2 Microplate Reader (BioTek, Winooski, VT), and quality was measured by the 260- to 280-nm absorbance ratio. Samples were stored at −80°C until use.

cDNA synthesis and quantitative real-time PCR.

cDNA was synthesized from 1 μg of total cellular RNA using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad, Hercules, CA) according to the manufacturer's protocol. After cDNA synthesis, all cDNA samples were treated with 5 units of RNase H (Thermo Fisher Scientific) at 37°C for 20 min. To control for variance in efficiency of the reverse transcription reaction, cDNA was quantified using the Quant-iT OliGreen ssDNA Assay Kit (Invitrogen) according to the manufacturer's protocol, and quality was measured according to the 260/280 nm absorbance ratio. An equal mass of cDNA (20 ng) was used for each sample in the quantitative real-time PCR (qRT-PCR) reaction.

qRT-PCR was performed using the LightCycler 480 (Roche Applied Science, Indianapolis, IN) and protocol previously described (36). All primer sets for qRT-PCR were designed using Oligo software (Molecular Biology Insights, Cascade, CO) to amplify an intron-spanning product. Primer sequences and PCR conditions are summarized in Table 3. The starting quantity (pg) was normalized by dividing the starting quantity of the mRNA of interest by the geometric mean of starting mRNA quantities (pg) for the housekeeping genes. Housekeeping genes include: ovine ribosomal protein S15, ovine GAPDH, and ovine RNA polymerase II.

Table 3.

PCR primers, annealing temperatures, and product sizes for cDNA used in qRT-PCR

cDNA Forward Primer (5′-3′) Reverse Primer (5′-3′) Anneal, °C Product, bp
oCSH ataaactccgaatccaaggtc gttccttttgagtttgccag 58 177
oRPS15 atcattctgcccgagatggtg tgctttacgggcttgtaggtg 58 124
oPol II agtccaacatgctgacggacatga agccaagtgccggtaattgacgta 60 332
oGAPDH accactgtccactgccatcac cctgcttcaccaccttcttga 60 268
oIGF1 tcgcatctctcttctatctggccctgt acagtacatctccagcctcctcaga 62 238
oIGF2 gaccgcggcttctacttcag aagaacttgcccacggggtat 62 202
oIGFBP1 tgatgaccgagtccagtgag gtccagcgaagtctcacac 62 247
oIGFBP2 caatggcgaggagcactctg tggggatgtgtagggaatag 55 330
oIGFBP3 ctcagagcacagacaccca ggcatatttgagctccac 54 335

o, Ovine; PRR15, ribosomal protein S15; Pol II, polymerase II; IGF, insulin-like growth factor; IGFBP, IGF-binding protein.

Western immunoblotting.

Cellular protein from 135 dGA cotyledon tissue was assessed using Western immunoblot analysis. To isolate total cellular protein, cotyledon tissue (100 mg) was lysed in 500 μl of Western lysis buffer (0.48 M Tris, pH 7.4; 10 mM EGTA, pH 8.6; 10 mM EDTA, pH 8; 0.1 mM PMSF; 0.1 mM AEBSF; 0.0015 mM pepstatin A; 0.0014 mM EG4; 0.004 mM bestatin; 0.002 mM leupeptin; and 0.00008 mM aprotinin) and sonicated on ice. A total of 10 μg of protein was electrophoresed through 4–12% Bis-Tris gels (Life Technologies, Grand Island, NY) and transferred to a 0.45-μm pore nitrocellulose membrane. To detect oCSH a polyclonal antibody generated in the rabbit (1:25,000 dilution, α-oPL-S4; see Ref. 28) in conjunction with a horseradish peroxidase-conjugated secondary antibody (1:5,000 dilution, product no. sc-2004; Santa Cruz Biotechnology, Dallas, TX) was used. As a loading control and housekeeping protein to normalize oCSH, a polyclonal antibody to β-actin (ACTB, 1:2,500 dilution, product no. sc-47778; Santa Cruz Biotechnology) bound by a horseradish peroxidase-conjugated secondary antibody (1:5,000, product no. sc-2005; Santa Cruz Biotechnology) was used. Membranes were developed using an ECL Western Blotting Detection Reagent chemiluminescent kit (Amersham, Pittsburgh, PA) and imaged using the ChemiDoc XRS+ chemiluminescence system (Bio-Rad). Densitometry calculations were performed using Image Lab Software (Bio-Rad). To correct for technical error between Western immunoblots, a common sample was included in each Western immunoblot. Densitometry measurements were then adjusted proportional to the average densitometry measurement of the common sample and normalized to ACTB.

Radioimmunoassay.

The concentration of serum oCSH was assessed by RIA as previously described (28) with an intra-assay coefficient of variance of 5.5%. The concentration of insulin in maternal and fetal circulation was measured according to a previously described procedure (12) with a 4.3% intra-assay coefficient of variance. The concentration of insulin-like growth factor-I (IGF-I) in maternal and fetal circulation was measured according to a previously described procedure (8) with modifications (12) and an intra-assay coefficient of variance of 8.3%.

Serum glucose and lactate measurements.

Maternal and fetal serum glucose and lactate concentrations were measured using the YSI 2700 SELECT Biochemistry Analyzer (YSI, Yellow Springs, OH) according to the manufacturer's protocol. The following enzymatic membranes and standard solutions were used to detect the presence of glucose and lactate: a glucose (dextrose) membrane kit (model no. 2365; YSI), a lactate membrane kit (model no. 2329; YSI), a dextrose/lactate standard (2.5 g/l dextrose, 0.5 g/l lactate, model no. 2777; YSI), and a buffer concentrate kit (model no. 2357; YSI). Samples were thawed and allowed to adjust to room temperature before being measured in duplicate using 25 μl of serum per read. A calibration was performed after every fifth measurement, and accuracy was confirmed using a standard control sample.

Statistical analysis.

All data were analyzed using SAS software (SAS Institute, Cary, NC). All data were subjected to analysis of variance using the PROC Mixed procedure, with treatment, gender, and sire as dependent variables and all interactions considered. There were no treatment by gender or treatment by sire interactions that were confounding to the overall statistical analysis. This was followed by Dunnett's t-test where all three treatment groups were compared with the SC pregnancies, with gender and sire as dependent variables. This analysis revealed parameters where gender and sire effects were expected, such as PW, FBW, fetal CRL, and fetal liver weight. Subsequently, analysis of variance was conducted using the PROC GLM procedure with gender and sire as dependent variables to compare SC pregnancies with tg6 shRNA/shRNAmiR pregnancies with PW that fell below 2 SDs of the mean PW for SC. Such tg6 shRNA/shRNAmiR pregnancies were defined as oCSH deficient and were evaluated for all parameters. Eight oCSH-deficient pregnancies were compared with eight SC (control) pregnancies. Statistical significance was set at P ≤ 0.05, and statistical tendency was set at P ≤ 10.

RESULTS

Day 135 fetectomy and fetal and placental measurements.

A total of 49 day 9 blastocysts were infected with lentivirus and surgically transferred as single blastocyst transfers to recipient ewes. Of the 49 single blastocyst transfers, 33 resulting pregnancies were harvested near term (135 dGA), which was equal to a 67.3% blastocyst transfer success rate (Table 4). Within each treatment group, there were eight hEF-1 SC (SC), nine hEF-1 tg2, seven hEF-1 tg6, and nine hLL3.7 tg6 near-term pregnancies. For each pregnancy FBW and PW were recorded and summarized in Fig. 1. The average PW for SC pregnancies was 0.78 ± 0.03 kg, with 0.61 kg being 2 SD below the average. Compared with the SC pregnancies the average PW for all hEF-1 tg2 pregnancies was 0.75 ± 0.07 kg, all hEF-1 tg6 pregnancies was 0.60 ± 0.09 kg (P ≤ 0.10), and all hLL3.7 tg6 pregnancies was 0.53 ± 0.07 kg (P ≤ 0.05), representing 3.8, 23.1, and 32.6% change in PW, respectively. The average FBW for SC pregnancies was 4.90 ± 0.11 kg, with 4.26 kg being 2 SD below the average. Compared with SC pregnancies the average FBW for all hEF-1 tg2 pregnancies was 4.43 ± 0.19 kg (P ≤ 0.10), all hEF-1 tg6 pregnancies was 4.22 ± 0.38 kg (P ≤ 0.10), and all hLL3.7 tg6 was 3.95 ± 0.38 (P ≤ 0.05), representing 9.6, 14.0, and 19.4% change in FBW, respectively. While the objective was to create oCSH-deficient pregnancies, placental and fetal development was only assessed at 135 dGA, and the events that occurred throughout gestation can only be speculated. Accordingly, as apparent from Fig. 1, there was variability in PW and FBW of oCSH-targeted pregnancies. Because a greater degree of growth restriction was observed in PW compared with FBW, we chose to evaluate pregnancies in which the PW fell below 2 SD of the mean PW of SC pregnancies. While there was one hEF-1 tg2 pregnancy that met this criteria, overall the hEF-1 tg2 lentivirus did not appear to be as effective as the hEF-1 tg6 and hLL3.7 tg6 lentivirus based off of PW, FBW, and concentrations of oCSH mRNA and protein in placental tissue (data not shown). Because the inefficiency of hEF-1 tg2 lentivirus relative to hEF-1 tg6 and hLL3.7 tg6 may be related to the different oCSH targeting sequences, pregnancies treated with the tg6 oCSH targeting sequence that had PW 2 SD below the mean PW for the SC group were defined as oCSH deficient. As a result, two out of seven hEF-1 tg6 pregnancies and six out of nine hLL3.7 tg6 were considered oCSH deficient. This definition was supported by a significant reduction in oCSH protein concentrations in the placental tissue of responder pregnancies (oCSH deficient), but no significant difference in that of tg6 “nonresponder” pregnancies (Fig. 2). The remainder of our analysis focused on comparing oCSH-deficient (n = 8) with SC (control) (n = 8) pregnancies.

Table 4.

Blastocyst transfer success

Treatment Group Embryos Transferred Returned to Estrus Positive Ultrasounds Near-Term Pregnancies Success, %
SC 13 5 8 8 61.5
hEF-1 tg2 11 2 9 9 81.8
hEF-1 tg6 10 3 7 7 70.0
hLL3.7 tg6 15 5 10 9 60.0
Total 49 15 34 33 67.3

h, Human. Success was calculated as the percentage of near-term pregnancies resulting from the embryos transferred.

Fig. 1.

Fig. 1.

A: scattergram of placental weight distribution between treatment groups. Horizontal bold bars represent mean placental weight of all ewes in each treatment group, and vertical bars represent 2 SD calculated from the mean. Percentages represent average percent growth restriction relative to scrambled controls (SC). The P value represents statistical analysis compared with SC, and N represents the number of singleton pregnancies. Data points below the horizontal line correspond to ovine chorionic somatomammotropin hormone (oCSH)-deficient pregnancies. B: scattergram of fetal body weight distribution between treatment groups. Horizontal bold bars represent mean fetal body weight of all ewes in each treatment group, and vertical bars represent 2 SDs calculated from the mean. Percentages represent average percent growth restriction relative to SC. The P value represents statistical analysis compared with SC, and N represents the number of singleton pregnancies.

Fig. 2.

Fig. 2.

oCSH concentrations in 135 days gestational age (dGA) placental tissue of control, nonresponder, and oCSH-deficient pregnancies. Concentration of oCSH was measured by Western immunoblotting. ACTB, β-actin. Data are shown as mean values ± SE for all ewes in each treatment group. *P ≤ 0.05 compared with controls.

The PW of oCSH-deficient pregnancies (0.37 ± 0.04 kg) was significantly reduced (P ≤ 0.05) compared with the PW of control pregnancies (0.78 ± 0.03 kg) (Fig. 3), representing a 52% placental growth restriction. Similarly, the FBW of oCSH-deficient pregnancies (3.35 ± 0.35 kg) was significantly reduced (P ≤ 0.05) compared with that of control pregnancies (4.90 ± 0.11 kg) (Fig. 3), representing a 32% fetal growth restriction. In addition, placentome number, placentome morphology, and placental efficiency (FBW/PW) were evaluated (Table 5). The oCSH-deficient pregnancies tended to have a decreased total number of placentomes (P ≤ 0.10) and a decreased number of type C/D placentomes compared with controls (P ≤ 0.10). The oCSH-deficient pregnancies also had significantly increased placental efficiency (P ≤ 0.05) relative to the control group. Fetal CRL, fetal liver weight, and ponderal index were also recorded and compared between oCSH-deficient and control pregnancies (Table 6). The CRL and fetal liver weights of oCSH-deficient pregnancies were significantly decreased (P ≤ 0.05) compared with controls. On the other hand, no change was observed in ponderal index (Table 6).

Fig. 3.

Fig. 3.

Average placental weight (PW) and fetal body weight (FBW) of control vs. oCSH-deficient pregnancies. Data are shown as mean values ± SE for all ewes in each treatment group. *P ≤ 0.05 compared with controls.

Table 5.

Placental measurements

Placental Measurement Controls oCSH Deficient P Value
Placentome no. 68.5 ± 3.8 56.6 ± 6.1 ≤0.10
Type A/B placentomes 42.9 ± 9.5 48.9 ± 8.9 0.65
Type C/D placentomes 24.4 ± 7.6 7.8 ± 3.7 ≤0.10
Placental efficiency, FBW/PW 6.3 ± 0.2 9.2 ± 0.8 ≤0.05

Values are means ±SE. FBW, fetal body wt; PW placental wt. P ≤ 0.10 indicates a trending difference from the controls. P ≤ 0.05 indicates a significant difference from the controls.

Table 6.

Fetal measurements

Fetal Measurement Controls oCSH Deficient P Value
Fetal CRL, cm 51.3 ± 0.6 44.0 ± 1.4 ≤0.05
Fetal liver wt, kg 0.16 ± 0.01 0.10 ± 0.01 ≤0.05
Ponderal index, kg/cm3 3.3 ± 0.03 3.4 ± 0.05 0.43

Values are means ±SE. CRL, crown-rump length. P ≤ 0.05 indicates a significant difference from the controls.

oCSH expression in day 135 placental tissue.

The concentrations of oCSH mRNA and protein were measured in cotyledon tissue at 135 dGA for analysis of oCSH expression. qRT-PCR was performed to determine the expression of oCSH mRNA in cotyledon tissue. Compared with the controls (71.22 ± 11.40 pg/pg), we observed significantly decreased (P ≤ 0.05) oCSH mRNA concentrations in the cotyledon tissue of the oCSH-deficient group (35.35 ± 4.68 pg/pg) (Fig. 4), which is equal to a 50% reduction. The presence of oCSH in 135 dGA cotyledon tissue was detected using Western immunoblotting and densitometry measurements. The oCSH-deficient group (0.38 ± 0.05) displayed significantly reduced (P ≤ 0.05) concentrations of oCSH compared with the controls (0.61 ± 0.08), which was equivalent to a 38% change in placental oCSH concentration (Fig. 4).

Fig. 4.

Fig. 4.

Effect of lentivirus-mediated short-hairpin RNA knockdown of oCSH on oCSH mRNA and protein in 135 dGA cotyledon tissue. Concentration of oCSH mRNA was measured by qRT-PCR, and oCSH was measured by Western immunoblotting. Data are shown as mean values ± SE for all ewes in each treatment group. *P ≤ 0.05 when oCSH-deficient pregnancies are compared with controls.

Day 135 serum measurements.

On day 135 of gestation fetal blood samples were collected from the umbilical artery and umbilical vein, and maternal blood samples were collected from the uterine artery and uterine vein ipsilateral to the fetus. Samples were collected at a single point in time during terminal fetectomy surgery and after ∼16 h of fasting. Circulating concentrations of oCSH were measured in uterine vein and umbilical vein serum samples (Table 7). There were no statistical differences in maternal and fetal circulating oCSH. Likewise, we did not observe any statistical differences in insulin and glucose concentrations in maternal circulation between oCSH-deficient and control pregnancies. However, the uterine artery to uterine vein glucose gradient was significantly increased (P ≤ 0.05), and the uterine artery insulin-to-glucose ratio tended to be increased (P ≤ 0.10) in oCSH-deficient pregnancies compared with controls. Concentrations of insulin and glucose in fetal circulation were not statistically different with the exception that umbilical artery insulin tended to be decreased (P ≤ 0.10) in oCSH-deficient pregnancies compared with controls (Table 7).

Table 7.

Maternal and fetal serum measurements

Serum Measurement Controls oCSH Deficient P Value
Utr vein oCSH, ng/ml 797 ± 84 609 ± 102 0.18
Umb vein oCSH, ng/ml 45.6 ± 3.7 40.0 ± 5.8 0.43
Utr artery insulin, ng/ml 0.40 ± 0.08 0.94 ± 0.31 0.14
Umb artery insulin, ng/ml 0.56 ± 0.13 0.29 ± 0.06 ≤0.10
Utr artery glucose, mmol/l 3.4 ± 0.6 3.7 ± 0.5 0.68
Utr vein glucose, mmol/l 3.1 ± 0.5 3.3 ± 0.6 0.72
Utr artery-vein glucose, mmol/l 0.23 ± 0.04 0.36 ± 0.03 ≤0.05
Utr artery insulin/glucose 0.12 ± 0.02 0.24 ± 0.06 ≤0.10
Umb artery glucose, mmol/l 0.80 ± 0.31 0.53 ± 0.21 0.49
Umb vein glucose, mmol/l 0.97 ± 0.33 0.77 ± 0.22 0.62
Umb vein-artery glucose, mmol/l 0.17 ± 0.04 0.24 ± 0.07 0.42
Utr artery-Umb vein glucose, mmol/l 2.4 ± 0.2 2.9 ± 0.4 0.28
Umb artery insulin/glucose 1.2 ± 0.3 1.8 ± 0.8 0.51

Serum concentrations are means ± SE. Utr, uterine; Umb, umbilical. P ≤ 0.10 indicates a trending difference from the controls. P ≤ 0.05 indicates a significant difference from the controls.

IGFs in maternal and fetal liver.

Because oCSH has been proposed to achieve its actions through IGFs, qRT-PCR was performed to determine the concentration of ovine IGF (oIGF) 1 and oIGF2 mRNA, as well as ovine IGF-binding protein (oIGFBP) 1, oIGFBP2, and oIGFBP3 mRNA in both maternal and fetal liver tissue. There were no significant differences in the concentration of oIGF1, oIGF2, or oIGFBP1, oIGFBP2, and oIGFBP3 in the liver tissue of the oCSH-deficient mothers compared with controls (Table 8). On the other hand, oIGF1 and oIGF2 concentrations in liver tissue of oCSH-deficient fetuses were significantly decreased (P ≤ 0.05) by 83 and 71%, respectively, compared with controls (Table 9). Additionally, compared with the controls, oIGFBP2 and oIGFBP3 mRNA concentrations in oCSH-deficient fetal livers were also significantly reduced (Table 9). Fetal liver oIGFBP1 mRNA concentrations were not statistically different between oCSH-deficient and control pregnancies.

Table 8.

Maternal liver insulin-like growth factor mRNA concentrations

Maternal Liver
Gene SC tg6 Responders P value
oIGF1, pg/pg 0.04 ± 0.01 0.04 ± 0.03 0.68
oIGF2, pg/pg 0.08 ± 0.01 0.09 ± 0.02 0.88
oIGFBP1, pg/pg 0.58 ± 0.17 0.67 ± 0.10 0.66
oIGFBP2, pg/pg 0.19 ± 0.10 0.21 ± 0.07 0.87
oIGFBP3, pg/pg 0.08 ± 0.02 0.08 ± 0.01 0.92

mRNA concentrations are means ± SE for the starting quantity of the mRNA of interest (pg) divided by the geomean of the starting quantity (pg) for the housekeeping mRNA.

Table 9.

Fetal liver insulin-like growth factor mRNA concentrations

Fetal Liver
Gene Controls oCSH deficient P value
oIGF1, pg/pg 0.04 ± 0.01 0.01 ± 0.00 ≤0.05
oIGF2, pg/pg 0.49 ± 0.08 0.14 ± 0.04 ≤0.05
oIGFBP1, pg/pg 0.72 ± 0.16 0.64 ± 0.31 0.81
oIGFBP2, pg/pg 0.18 ± 0.04 0.05 ± 0.03 ≤0.05
oIGFBP3, pg/pg 0.09 ± 0.011 0.02 ± 0.01 ≤0.05

mRNA concentrations are means ± SE for the starting quantity of the mRNA of interest (pg) divided by the geomean of the starting quantity (pg) for the housekeeping mRNA. P ≤ 0.05 indicates a significant difference from the control.

In addition, circulating concentrations of oIGF1 were measured in uterine artery and umbilical artery serum samples (Fig. 5). No statistical differences were observed in maternal circulating oIGF1; however, umbilical artery oIGF1 was significantly decreased (P ≤ 0.05) by 62% in oCSH-deficient pregnancies.

Fig. 5.

Fig. 5.

Circulating concentration of ovine insulin-like growth factor-I (oIGF1) in 135 dGA uterine artery (maternal oIGF1) and umbilical artery (fetal oIGF1) serum measured by RIA. Data are shown as mean values ± SE for all ewes in each treatment group. *P ≤ 0.05 when oCSH-deficient pregnancies are compared with controls.

DISCUSSION

Grumbach et al. (22) and Spellacy et al. (41) made the first observations that circulating levels of maternal human CSH (hCSH) were positively correlated with placental mass and FBW. This relationship has since led to a series of experiments investigating a role for CSH in modulating maternal metabolism and promoting fetal growth. Unfortunately, numerous studies regarding the activity of CSH during pregnancy report contradictory findings because of inconsistent experimental design and the lack of an effective translational model. The aim of this study was to develop a CSH-deficient sheep model to further investigate a precise biological role for CSH during pregnancy. To address this, oCSH-deficient pregnancies were generated using lentiviral-mediated shRNA targeting oCSH mRNA and assessed for the impact on placental and fetal development near term. Data presented here confirm earlier reports linking CSH to PW and FBW and provide additional evidence illustrating a role for CSH in early pregnancy development and fetal IGF expression.

Pregnancies impacted by oCSH deficiency led to substantially decreased PW and FBW at 135 dGA. Surprisingly, we observed a greater impact on PW (52% reduction) than FBW (32% reduction) in oCSH-deficient pregnancies. The overall function of the placenta is to accommodate fetal growth; therefore, if placental development is inhibited, then fetal growth will also be repressed. Accordingly, if oCSH expression was reduced during early pregnancy, this could have interfered with placental development, and consequently fetal development, suggesting a direct action for CSH in early placental development. Additionally, despite significantly decreased FBW, CRL, and liver weights of fetuses harvested from oCSH-deficient pregnancies, the ponderal index of these fetuses did not differ from that of the control fetuses. Ponderal index is a useful indicator of body proportionality, and a method for distinguishing between symmetric and asymmetric growth restriction (29). Similar ponderal index between growth-restricted fetuses and control fetuses indicates that the growth restriction experienced by fetuses harvested from oCSH-deficient pregnancies was symmetric. Because symmetric growth restriction typically results from an insult encountered early in utero (29), this provides additional evidence that reduced CSH early in pregnancy may impede placental development. While this IUGR phenotype could be a direct result of dysregulation of oCSH activity within the placenta, to date a specific CSH receptor has not been identified in the placenta of sheep or humans, making it unclear how much of a direct effect CSH has on placental development and function. However, an oCSH-specific receptor has been identified in fetal liver (35) but has yet to be structurally characterized. Furthermore, a study conducted by Spencer et al. (42) reported a potential role for oCSH during early pregnancy development in which oCSH may regulate glandular epithelium proliferation and differentiation in preparation for placentation. If CSH has the ability to stimulate proliferation and differentiation of the maternal epithelium, it could have a similar function during the development of the placenta; however, this is only speculation, and further experiments are necessary to confirm the function of CSH during early placental growth and development.

Significant decreases in placental mass and fetal size were accompanied by a 50% decrease in oCSH mRNA and a 38% decrease in oCSH in 135 dGA placental tissue of oCSH-deficient pregnancies relative to the controls. These data imply that lentiviral-mediated shRNA targeting the degradation of oCSH mRNA leads to decreased oCSH expression in placental tissue. Previous studies in sheep have demonstrated that decreased placental mass and fetal growth restriction are associated with decreased maternal circulating concentrations of oCSH as well as the expression of oCSH in placental tissue (31). Based on this relationship, a decrease in serum oCSH concentrations proportional to the 52 and 50% reductions in placental mass and oCSH mRNA, respectively, would be expected in oCSH-deficient pregnancies. However, serum concentrations of oCSH were variable, and there were no significant changes in maternal or fetal serum oCSH concentrations between oCSH-deficient and control pregnancies. Previously, measurements of serum CSH in ruminants have proven to be highly variable and can undergo short-term fluctuations (6, 11). For instance, a study in which pregnant ewes and their fetuses were chronically catheterized from day 110 of gestation until term reported that oCSH in maternal plasma showed no circadian rhythm and that plasma oCSH has the ability to vary up to twofold in 1 h (44). In the same study, it was also reported that surgery elevated concentrations of oCSH in maternal and fetal plasma for up to 5 days following the operation. Given this evidence, measuring serum concentrations of oCSH from blood samples collected at a single point in time under the influence of anesthesia, as was conducted in this study, may not accurately represent the overall secretion of oCSH into circulation. Additionally, a number of studies have also demonstrated nutritional regulation of circulating CSH (6, 11, 34). In particular, fetuses of pregnant ewes that were fed a high plane of nutrition and underwent a short-term fast experienced markedly elevated concentrations of plasma oCSH during starvation (33). Because pregnant ewes in the current study underwent a short-term fast before terminal surgery, this may have altered the rate of oCSH secretion in maternal and fetal circulation, thus leading to skewed measurements of plasma oCSH. To obtain a more accurate assessment of circulating oCSH, blood samples should be collected after chronic catheterization and instrumentation of pregnant ewes, under nonanesthetized/nonstressed and steady-state conditions.

During pregnancy maternal metabolism undergoes major alterations to maintain an adequate supply of nutrients to support fetal growth. Previous studies have indicated that CSH may be involved in maternal glucose retention and the mobilization of maternal carbohydrates (24). Butler et al. (11) noted that increased oCSH concentrations induced by fasting in pregnant ewes at mid- to late gestation led to reduced glucose clearance rates compared with fed ewes. In addition, nonpregnant nonlactating ewes treated with partially purified CSH experienced increased blood glucose concentrations (50). These studies illustrate that CSH may modulate the availability of glucose to support pregnancy. In this study, serum samples collected at a single point in time on day 135 of gestation were evaluated for the impact of oCSH deficiency on insulin and glucose metabolism in both maternal and fetal systems. While we did not observe any changes in the concentrations of maternal insulin or glucose, a significant increase in the uterine artery to uterine vein glucose gradient was revealed for oCSH-deficient pregnancies compared with controls. Conversely, no changes were observed in the uterine artery to umbilical vein glucose gradient between oCSH-deficient pregnancies and controls. Together these data could suggest that glucose uptake by the placenta of oCSH-deficient pregnancies was increased compared with control pregnancies, which might help explain the 32% increase in placental efficiency observed in oCSH-deficient pregnancies. However, to verify alterations in glucose uptake by the placenta in the case of oCSH deficiency, chronic catheterization and instrumentation would be needed to monitor uteroplacental blood flow as well as uptake and utilization of nutrients.

Fetal growth restriction, or IUGR, is commonly associated with fetal hypoinsulinemia in parallel with fetal hypoglycemia (30, 32). While circulating fetal insulin was decreased by 49% in oCSH-deficient pregnancies, a corresponding decrease in circulating concentrations of glucose was not observed. These results may signify increased insulin sensitivity in fetuses of oCSH-deficient pregnancies, since increased insulin sensitivity was also reported for sheep IUGR fetuses as an adaptation to maintain normal rates of fetal glucose metabolism (32). However, these results could also denote an effect of oCSH deficiency on β-cell function during development of the fetal pancreas. A study conducted using human fetal pancreatic explants revealed significantly increased insulin and IGF-I content and release in pancreatic tissue treated with hCSH in the presence of glucose (43). This proposes that CSH may modulate β-cell function and contribute to fetal pancreatic development (43). To meet the metabolic demands of pregnancy, increased β-cell proliferation in the maternal pancreas has also been associated with the activity of CSH (39). Overall, these data raise the possibility that CSH has an important function in early fetal development and may help set metabolic standards for continued fetal growth. Nonetheless, additional experiments are required to elucidate the exact biological role of CSH on fetal insulin metabolism and pancreatic function.

CSH is believed to have an important anabolic function in the fetus, possibly through the stimulation of IGFs (24, 38). To address the relationship between CSH and IGFs, the expression of oIGFs and oIGFBPs was measured in maternal and fetal liver tissue. While no significant changes were noted in oIGF and oIGFBP expression in maternal liver tissue, fetal liver from oCSH-deficient pregnancies revealed 83 and 71% reductions in oIGF1 and oIGF2, respectively, compared with control fetuses. This was accompanied by significant reductions in fetal liver oIGFBP2 and oIGFBP3 mRNA concentrations from oCSH-deficient pregnancies. Additionally, serum concentrations of oIGF1 were measured in maternal and fetal circulation. In concurrence with the mRNA data, no significant changes were observed in maternal circulating concentrations of oIGF1; however, fetal circulating concentrations of oIGF1 were significantly reduced by 62% in oCSH-deficient fetuses compared with controls. These data support results of earlier studies in which CSH stimulated fetal IGF secretion in vitro and in vivo. In vitro studies demonstrate increased IGF-I production in human fetal myoblasts and fibroblasts treated with hCSH, which was diminished after treatment with IGF-I antiserum (26). Furthermore, fetal lambs given a chronic intravenous infusion of purified oCSH during late gestation experienced increased IGF-I concentrations (38). IGFs and their associated binding proteins are critical for conceptus cell proliferation, differentiation, and metabolism (15,17, 27). Similarly, IGFs have been noted to be altered in relation to the development of IUGR (15). While the results collected in this study could be an indirect result of IUGR, CSH may well induce the expression of IGFs, supporting earlier reports (26, 38). Additionally, if oCSH was significantly reduced during early gestation, leading to a lack of fetal IGF production/secretion, then fetal liver development may have been permanently disrupted. Supporting evidence shows that fetal IGF1 and IGF2 gene expression occurs from the earliest preimplantation stages (49), and can be affected by the endocrine environment in utero (16). Furthermore, the “Barker hypothesis” states that adverse influences that occur during intrauterine life can lead to permanent alterations in physiology and metabolism, which increase the risk for adult-onset disease (4, 13). Because data collected here were for the purpose of assessing the impacts of oCSH deficiency near term, to gain a better understanding of the importance for CSH in fetal development, additional studies should be conducted focused on oCSH deficiency during early pregnancy.

CSH is an abundantly secreted placenta-specific hormone and has a number of postulated somatogenic functions; however, the exact biological mechanisms behind CSH's activity are largely unknown. Previously, the lack of an appropriate CSH-deficient animal model has inhibited our ability to clearly define CSH's function. In this study, oCSH-deficient sheep pregnancies were generated using lentiviral-mediated shRNA targeting oCSH mRNA to shed light on the role of CSH in promoting fetal growth. oCSH deficiency led to phenotypes that are consistent with that of IUGR in a clinical setting, including decreased FBW and PW and fetal hypoinsulinemia. However, we did not observe decreased circulating concentrations of oCSH or fetal glucose, which have been previously reported as complications associated with IUGR (30, 32, 34, 40). While the results of oCSH deficiency support an important role for CSH in the modulation of placental and fetal growth, additional experiments are necessary to specify the exact biological mechanism by which CSH achieves its actions.

Perspectives and Significance

To our knowledge, this is the first study to purposely generate CSH-deficient pregnancies. Furthermore, these CSH-deficient pregnancies were generated in sheep using lentiviral-mediated RNA interference. While our hypothesis regarding oCSH deficiency resulting in IUGR proved to be correct, additional studies are required to determine the exact biological mechanisms by which oCSH impacts early placental and fetal development as well as maternal and fetal metabolism throughout pregnancy. By developing CSH deficiency in sheep, follow-up experiments can focus on monitoring nutrient transport and utilization by the placenta, changes in blood flow and circulating hormone and nutrient concentrations, as well as nutrient utilization by various fetal organs, under nonanesthetized nonstressed conditions. In addition, evaluation of maternal and fetal gluconeogenic pathways in response to oCSH deficiency may reveal additional alterations in maternal and/or fetal glucose metabolism. Measurement of such parameters during early, mid, and late gestation are necessary to determine enhanced or changing pathways throughout gestation in response to oCSH deficiency. Overall, a more detailed understanding of the downstream effects of oCSH deficiency may lead to the identification of the exact biological mechanisms behind CSH activity and the development of IUGR.

GRANTS

This work was supported by Agriculture and Food Research Initiative Competitive Grant no. 2012–67015-30215 from the United States Department of Agriculture National Institute of Food and Agriculture.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

C.M.B. and R.V.A. conception and design of research; C.M.B., L.N.G., J.D.C., K.M.J., Q.A.W., and R.V.A. performed experiments; C.M.B., L.N.G., K.M.J., and R.V.A. analyzed data; C.M.B., J.D.C., Q.A.W., and R.V.A. interpreted results of experiments; C.M.B. and R.V.A. prepared figures; C.M.B. and R.V.A. drafted manuscript; C.M.B., L.N.G., J.D.C., K.M.J., Q.A.W., and R.V.A. edited and revised manuscript; C.M.B. and R.V.A. approved final version of manuscript.

ACKNOWLEDGMENTS

We thank Vince Abushaban, Zella Brink, Richard Brandes, Gregory Harding, and Rachel West for additional technical support and animal care.

REFERENCES

  • 1.Barker DJ, Bull AR, Osmond C, Simmonds SJ. Fetal and placental size and risk of hypertension in adult life. Br Med J 301: 259–262, 1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Barker D, Godfrey K, Gluckman P, Harding J, Owens J, Robinson J. Fetal nutrition and cardiovascular disease in adult life. Lancet 341: 938–941, 1993a. [DOI] [PubMed] [Google Scholar]
  • 3.Barker DJ, Hales CN, Fall CH, Osmond C, Phipps K, Clark PM. Type 2 (non-insulin-dependent) diabetes mellitus, hypertension and hyperlipidaemia (syndrome X): relation to reduced fetal growth. Diabetologia 36: 62–67, 1993b. [DOI] [PubMed] [Google Scholar]
  • 4.Barker DJ, Osmond C. Infant mortality, childhood nutrition, and ischaemic heart disease in England and Wales. Lancet 327: 1077–1081, 1986. [DOI] [PubMed] [Google Scholar]
  • 5.Barker DJ, Osmond C, Golding J, Kuh D, Wadsworth ME. Growth in utero, blood pressure in childhood and adult life, and mortality from cardiovascular disease. Br Med J 298: 564–567, 1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bauer MK, Breier BH, Harding JE, Veldhuis JD, Gluckman P. The fetal somatotropic axis during long term maternal undernutrition in sheep: evidence for nutritional regulation in utero. Endocrinology 136: 1250–1257, 1995. [DOI] [PubMed] [Google Scholar]
  • 7.Beck WH, Daughaday P. Human placental lactogen: studies of its acute metabolic effects and disposition in normal man. J Clin Invest 46: 103–110, 1967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Berrie RA, Hallford DM, Galyean ML. Effects of zinc source and level on performance and metabolic hormone concentrations of growing and finishing lambs. Prof Anim Sci 11: 49–156, 1995. [Google Scholar]
  • 9.Brinsmead MW, Bancroft BJ, Thorburn GD, Waters MJ. Fetal and maternal ovine placental lactogen during hyperglycaemia, hypoglycaemia and fasting. J Endocrinol 90: 337–343, 1981. [DOI] [PubMed] [Google Scholar]
  • 10.Burt RL, Facog NH, Rhyne AL. Human placental lactogen and insulin-blood glucose homeostasis. Obstet Gynecol 36: 233–237, 1970. [PubMed] [Google Scholar]
  • 11.Butler WR, Huyler SE, Grandis AS, Handwerger S. Failure of fasting and changes in plasma metabolites to affect spontaneous fluctuations in plasma concentrations of ovine placental lactogen. J Endocrinol 114: 391–397, 1987. [DOI] [PubMed] [Google Scholar]
  • 12.Camacho LE, Benavidez JM, Hallford DM. Serum hormone profiles, pregnancy rates, and offspring performance of Rambouillet ewes treated with recombinant bovine somatotropin before breeding. J Anim Sci 90: 2826–2835, 2012. [DOI] [PubMed] [Google Scholar]
  • 13.De Boo HA, Harding JE. The developmental origins of adult disease (Barker) hypothesis. Aust N Z J Obstet and Gynaecol 46: 4–14, 2006. [DOI] [PubMed] [Google Scholar]
  • 14.De La Torre-Sanchez JF, Gardner DK, Preis K, Seidel GE. Metabolic regulation of in-vitro produced bovine embryos. I. Effects of metabolic regulators at different glucose concentrations with embryos produced by semem from different bulls. Reprod Fertil Dev 18: 585–596, 2006. [DOI] [PubMed] [Google Scholar]
  • 15.De Vrijer B, Davidsen ML, Wilkening RB, Anthony RV, Regnault TR. Altered placental and fetal expression of Igfs and Igf-binding proteins associated with intrauterine growth restriction in fetal sheep during early and mid-pregnancy. Pediatr Res 60: 507–512, 2006. [DOI] [PubMed] [Google Scholar]
  • 16.Fowden AL. Endocrine regulation of fetal growth. Reprod Fertil Dev 7: 351–363, 1995. [DOI] [PubMed] [Google Scholar]
  • 17.Fowden AL. The insulin-like growth factors and feto-placental growth. Placenta 24: 803–812, 2003. [DOI] [PubMed] [Google Scholar]
  • 18.Gagnon R. Placental insufficiency and its consequences. Eur J Obstet Gynecol Reprod Biol 110: S99–S107, 2003. [DOI] [PubMed] [Google Scholar]
  • 19.Ghidini A. Idiopathic fetal growth restriction. Obstet Gynecol Surv 51: 376–382, 1996. [DOI] [PubMed] [Google Scholar]
  • 20.Gootwine E. Placental hormones and fetal-placental development. Anim Reprod Sci 82–83: 551–566, 2004. [DOI] [PubMed] [Google Scholar]
  • 21.Grumbach MM, Kaplan SL, Abrams CL, Bell JJ, Conte FA. Plasma free fatty acid response to the administration of chorionic “growth hormone-prolactin.” J Clin Endocrinol Metab 26: 478–482, 1966. [DOI] [PubMed] [Google Scholar]
  • 22.Grumbach MM, Kaplan SL, Sciarra JJ, Burr IM. Chorionic growth hormone-prolactin (CGP): secretion, disposition, biological activity in man and postulated function as the growth hormone of the second half of pregnancy. Anns NY Acad Sci 148: 501–531, 1968. [DOI] [PubMed] [Google Scholar]
  • 23.Handwerger S, Fellows RE, Crenshaw MC, Hurley T, Barrett J, Maurer WF. Ovine placental lactogen: acute effects on intermediary metabolism in pregnant and non-pregnant sheep. J Endocrinol 69: 133–137, 1976. [DOI] [PubMed] [Google Scholar]
  • 24.Handwerger S, Freemark M. The roles of placental growth hormone and placental lactogen in the regulation of human fetal growth and development. J Pediatr Endocrinol Metab 13: 343–356, 2000. [DOI] [PubMed] [Google Scholar]
  • 25.Hierholzer JC, Killington RA. Virus isolation and quantitation. Virol Meth Man 25–46, 1996. [Google Scholar]
  • 26.Hill DJ, Crace CJ, Milner RD. Incorporation of [3H]thymidine by isolated fetal myoblasts and fibroblasts in response to human placental lactogen (HPL): possible mediation of HPL action by release of immunoreactive SM-C. J Cell Physiol 125: 337–344, 1985. [DOI] [PubMed] [Google Scholar]
  • 27.Jones JI, Clemmons DR. Insulin-like growth factors and their binding proteins: biological actions. Endocr Rev 16: 3–34, 1995. [DOI] [PubMed] [Google Scholar]
  • 28.Kappes SM, Warren WC, Pratt SL, Liang R, Anthony RV. Quantification and cellular localization of ovine placental lactogen messenger ribonucleic acid expression during mid- and late gestation. Endocrinology 131: 2829–2838, 1992. [DOI] [PubMed] [Google Scholar]
  • 29.Landmann E, Reiss I, Misselwitz B, Gortner L. Ponderal index for discrimination between symmetric and asymmetric growth restriction: Percentiles for neonates from 30 weeks to 43 weeks of gestation. J Matern Fetal Neonatal Med 19: 157–160, 2006. [DOI] [PubMed] [Google Scholar]
  • 30.Langer O, Damus K, Maiman M, Divon M, Levy J, Bauman W. A link between relative hypoglycemia-hypoinsulinemia during oral glucose tolerance tests and intrauterine growth retardation. Am J Obstet Gynecol 155: 711–716, 1986. [DOI] [PubMed] [Google Scholar]
  • 31.Lea RG, Wooding P, Stewart I, Hannah LT, Morton S, Wallace K, Aitken RP, Milne JS, Regnault TR, Anthony RV, Wallace JM. The expression of ovine placental lactogen, StAR and progesterone-associated steroidogenic enzymes in placentae of overnourished growing adolescent ewes. Reproduction 135: 889–889, 2008. [DOI] [PubMed] [Google Scholar]
  • 32.Limesand SW, Rozance PJ, Smith D, Hay WW. Increased insulin sensitivity and maintenance of glucose utilization rates in fetal sheep with placental insufficiency and intrauterine growth restriction. Am J Physiol Endocrinol Metab 293: E1716–E1725, 2007. [DOI] [PubMed] [Google Scholar]
  • 33.Oliver MH, Harding JE, Breier BH, Evans PC, Gluckman PD. The nutritional regulation of circulating placental lactogen in fetal sheep. Pediatr Res 31: 520–523, 1992. [DOI] [PubMed] [Google Scholar]
  • 34.Oliver MH, Hawkins P, Harding JE. Periconceptional undernutrition alters growth trajectory and metabolic and endocrine responses to fasting in late-gestation fetal sheep. Pediatr Res 57: 591–598, 2005. [DOI] [PubMed] [Google Scholar]
  • 35.Pratt SL, Kappes SM, Anthony RV. Ontogeny of a specific high-affinity binding site for ovine placental lactogen in fetal and postnatal liver. Domest Anim Endocrinol 12: 337–347, 1995. [DOI] [PubMed] [Google Scholar]
  • 36.Purcell SH, Cantlon JD, Wright CD, Henkes LE, Seidel GE, Anthony RV. The involvement of proline-rich 15 in early conceptus development in sheep. Biol Reprod 81: 1112–1121, 2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Robertson MC, Friesen H. Two forms of rat placental lactogen revealed by radioimmunoassay. Endocrinology 108: 2388–2390, 1981. [DOI] [PubMed] [Google Scholar]
  • 38.Schoknecht P, Mcguire M, Cohick W, Currie W, Bell A. Effect of chronic infusion of placental lactogen on ovine fetal growth in late gestation. Dom Anim Endocrinol 13: 519–528, 1996. [DOI] [PubMed] [Google Scholar]
  • 39.Sorenson RL, Brelje TC. Adaptation of islets of langerhans to pregnancy: b-cell growth, enhanced insulin secretion and the role. Horm Metab Res 29: 301–307, 1997. [DOI] [PubMed] [Google Scholar]
  • 40.Spellacy WN, Buhi WC, Birk SA. Human placental lactogen and intrauterine growth restriction. Obstet Gynecol 47: 446–448 1976. [PubMed] [Google Scholar]
  • 41.Spellacy WN, Buhi WC, Schram JD, Birk SA, McCreary SA. Control of human chorionic somatomammotropin levels during pregnancy. Obstet Gynecol 37: 567–573, 1971. [PubMed] [Google Scholar]
  • 42.Spencer TE, Gray A, Johnson GA, Taylor KM, Gertler A, Gootwine E, Ott TL, Bazer FW. Effects of recombinant ovine interferon tau, placental lactogen, and growth hormone on the ovine uterus. Biol Reprod 61: 1409–1418, 1999. [DOI] [PubMed] [Google Scholar]
  • 43.Swenne I, Hill DJ, Strain AJ, Milner RD. Effects of human placental lactogen and growth hormone on the production of insulin and somatomedin C/insulin-like growth factor I by human fetal pancreas in tissue culture. J Endocrinol 113: 297–303, 1987. [DOI] [PubMed] [Google Scholar]
  • 44.Taylor MJ, Jenkin G, Robinson JS, Thorburn GD, Friesen H, Chan JS. Concentrations of placental lactogen in chronically catheterized ewes and fetuses in late pregnancy. J Endocrinol 85: 27–34, 1980. [DOI] [PubMed] [Google Scholar]
  • 45.Thordarson G, Mcdowell GH, Smith SV, Iley S, Forsyth IA. Effects of continuous intravenous infusion of an ovine placental extract enriched in placental lactogen on plasma hormones, metabolites and metabolite biokinetics in non-pregnant sheep. J Endocrinol 113: 277–283, 1987. [DOI] [PubMed] [Google Scholar]
  • 46.Vatnick I, Schocknecht PA, Darrigrand R, Bell AW. Growth and metabolism of the placenta after unilateral fetectomy in twin pregnant ewes. J Dev Physiol 15: 351–356, 1991. [PubMed] [Google Scholar]
  • 47.Walker WH, Fitzpatrick SL, Barrera-Saldana HA, Resendez-Perez D, Saunders GF. The human placental lactogen genes: Structure, function, evolution and transcriptional regulation. Endocrine Rev 12: 316–328, 1991. [DOI] [PubMed] [Google Scholar]
  • 48.Waters MJ, Oddy VH, Mccloghry CE, Gluckman PD, Duplock R, Owens PC, Brinsmead MW. An examination of the proposed roles of placental lactogen in the ewe by means of antibody neutralization. J Endocrinol 106: 377–386, 1985. [DOI] [PubMed] [Google Scholar]
  • 49.Watson AJ, Watson PH, Arcellana-Panlilio M, Warnes D, Walker SK, Schultz GA, Armstrong DT, Seamark RF. A growth factor phenotype map for ovine preimplantation development. Biol Reprod 50: 725–733, 1994. [DOI] [PubMed] [Google Scholar]
  • 50.Wooding F, Burton G. Comparative Placentation: Structures, Functions and Evolution. New York, NY: Springer, 2008. [Google Scholar]

Articles from American Journal of Physiology - Regulatory, Integrative and Comparative Physiology are provided here courtesy of American Physiological Society

RESOURCES