Abstract
Premise of the study:
Expressed sequence tag–simple sequence repeat (EST-SSR) markers were developed using Illumina sequencing for further genetic diversity studies of Stipa purpurea (Poaceae).
Methods and Results:
Twenty-nine polymorphic and eight monomorphic EST-SSR loci were developed and characterized in 90 individuals from nine S. purpurea populations. The number of alleles per locus ranged from two to 13, and heterozygosity within populations and total heterozygosity ranged from 0.04–0.76 and from 0.04–0.87, respectively. Of 37 loci, 12 showed interspecific transferability and polymorphism in a related species, S. glareosa.
Conclusions:
These newly developed EST-SSR primers provide a useful tool to investigate genetic diversity at the population level and to analyze the population structure of S. purpurea.
Keywords: expressed sequence tag–simple sequence repeat (EST-SSR), Poaceae, polymorphism, Stipa purpurea.
Stipa purpurea Griseb. (Poaceae) is widely distributed along the precipitation gradient from the southeast to the northwest of the Qinghai–Tibet Plateau (Yue et al., 2011). It is a species endemic to the Qinghai–Tibet Plateau, and it plays a prominent role in protecting the ecological environment by acting as a windbreak, fixing sand, conserving water and soil, and preventing grassland degradation (Yue et al., 2008). Stipa purpurea is also important for the development of animal husbandry because of its high nutritional value and good palatability (Yue et al., 2008), but it has suffered natural and anthropogenic disturbances in recent years. Most studies on S. purpurea have focused on its biological characteristics (Li et al., 2015); however, little is known about its population genetic diversity (Yue and Peng, 2014).
To our knowledge, only a limited number of simple sequence repeat (SSR) markers (using the Fast Isolation by AFLP of Sequences COntaining repeats [FIASCO] protocol) (n = 15; Liu et al., 2011) and intersimple sequence repeat (ISSR) markers (n = 8; Liu et al., 2009) have been developed for use in S. purpurea to investigate its genetic diversity in different populations (Liu et al., 2009, 2011; Zhai, 2012). Furthermore, the development of microsatellite markers in S. purpurea has been very slow due to the lack of genome sequences. Thus, developing a greater number of microsatellite loci for this species is necessary for population genetic diversity studies of S. purpurea to progress. Next-generation sequencing allows for rapid development of a large number of SSR markers (Huang et al., 2014). Recently, we sequenced the S. purpurea transcriptome using the Illumina next-generation sequencing platform to understand drought tolerance (Yang et al., 2015). Here, we report the rapid and cost-effective development of 29 novel polymorphic expressed sequence tag (EST)–SSR markers for S. purpurea, which will be useful in future studies of population genetics in this species.
METHODS AND RESULTS
Transcriptome sequencing of S. purpurea was conducted using an Illumina Genome Analyzer (Illumina, San Diego, California, USA). Approximately 51 million 75-bp paired-end reads were obtained and assembled into 84,298 unigenes with mean sizes of 579 nucleotides (Yang et al., 2015). SSRs were detected using the MIcroSAtellite Identification Tool (MISA; Thiel et al., 2003), with the criteria of eight, five, five, five, and five repeat units for di-, tri-, tetra-, penta-, and hexanucleotide motifs, respectively. A total of 2105 SSRs were identified, with trinucleotide repeats (98.9%, 2081) being the most common, followed by dinucleotide (0.8%, 17), hexanucleotide (0.2%, 4), and tetranucleotide (0.1%, 3) repeats. Primer Premier 5 software (PREMIER Biosoft International, Palo Alto, California, USA) was used to design 50 primer pairs (GenBank accession numbers: KP729144–KP729174, KU987914–KU987932), 18–21 bp long, that amplified product sizes ranging from 100–600 bp.
Polymorphisms of these primer sets were assessed in 90 S. purpurea individuals from nine populations (10 individuals per population) in Tibet (Fig. 1, Appendix 1). We also chose S. glareosa P. A. Smirn. (Poaceae) (10 individuals; 32°39′47″N, 79°55′48″E) to test the cross-species amplification of polymorphic and monomorphic markers in S. purpurea. Voucher specimens (Appendix 1) were deposited in the herbarium of the Kunming Institute of Botany, Chinese Academy of Sciences (KUN).
Fig. 1.
Sampling locations of Stipa purpurea and S. glareosa in Tibet.
Genomic DNA was extracted from leaf tissues using the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). PCR amplifications were performed in 20-μL reaction mixtures containing 0.5 units of Taq polymerase (TaKaRa Biotechnology Co., Dalian, China), 2 μL 10× PCR buffer (200 mM Tris-HCl [pH 8.8], 100 mM (NH4)2SO4, 100 mM KCl, 1% Triton X-100, 20 mM MgSO4), 1.6 μL dNTPs (2.5 mM each), 0.5 μL each primer (10 μM), and 1 μL of genomic DNA (∼50 ng/μL). PCR conditions comprised an initial denaturing step at 94°C for 4 min; followed by 35 cycles of 94°C for 30 s, appropriate annealing temperatures (Table 1) for 30 s, and 72°C for 35 s; and a final extension at 72°C for 5 min. PCR products were first detected using 1.0% agarose gel electrophoresis, then run on 6% denaturing polyacrylamide gels and silver stained. The band size was calculated by comparison with a 25-bp DNA ladder (Fermentas, Vilnius, Lithuania; Yan et al., 2011). Stipa purpurea is a tetraploid species (2n = 4x = 44) (Sheidai and Attaei, 2005), so traditional measures of genetic variability such as deviation from linkage disequilibrium and Hardy–Weinberg equilibrium (HWE) could not be determined. However, GenoDive v.2.0b20 software (Meirmans and Van Tienderen, 2004) enables the analysis of amplified polymorphic fragments (bands) from polyploids.
Table 1.
Characteristics of 37 EST-SSR primers developed for use in Stipa purpurea.
Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Ta (°C) | GenBank accession no. |
ZH1 | F: GCGGAACAAGGAGAACC | (CGC)8 | 252–269 | 53 | KP729144 |
R: ATAGACATTTCCGCCAGC | |||||
ZH2 | F: CGCCATCGCTCGCAGTA | (CCG)6 | 45–65 | 53 | KP729145 |
R: TACGACTGGAAGGGCGAG | |||||
ZH3 | F: AGCCAGACGACCAAGAACC | (CCG)6 | 357–374 | 53 | KP729146 |
R: TACAGCGACAACGACATGGAC | |||||
ZH4 | F: CAAGACCAAGCCAGTA | (GAA)7 | 230–250 | 53 | KP729147 |
R: AAAACGGGAACTGTGA | |||||
ZH5 | F: GCGAGTTCTGGCAGTTCA | (CGG)4 | 379–390 | 50 | KP729148 |
R: CAAGTCCATCGGGAGGC | |||||
ZH6 | F: AGACGATTGGGTGCTGTGC | (AAG)3 | 57–81 | 53 | KP729149 |
R: GCGAAGAGCGACGAGTAG | |||||
ZH7 | F: GCGTCCAACTCCAAGAA | (GTG)8 | 43–66 | 52 | KP729150 |
R: ACGAGGCAAAGAGTCCA | |||||
ZH8 | F: CCAGCACCGCCGATGTA | (CCA)8 | 71–94 | 53 | KP729151 |
R: TTGGACAGGCTGAGTAGG | |||||
ZH9 | F: TGAAGAAGACCACCATCGC | (CAG)8 | 153–176 | 53 | KP729152 |
R: CCTCCACAGCGTGTAATCC | |||||
ZH10 | F: CCTCCTCGCAGTTCTTCC | (CCT)5 | 125 | 47 | KP729153 |
R: CCACCTGTTCCCATCCTC | |||||
ZH11 | F: CGCCAATAACTGCGGCTTC | (CCT)2 | 342–348 | 51 | KP729154 |
R: CGGCGAGGAGGAATCAGAGG | |||||
ZH12 | F: TCCCCAGACTCCAATCCTTCC | (AGC)7 | 191–211 | 51 | KP729155 |
R: TCAATTGCGGGCTCATTGC | |||||
ZH13 | F: TAGCATCAGCGGCACCTC | (CCG)6 | 70–87 | 51 | KP729156 |
R: GCGGCTTGCTTGTTTCCT | |||||
ZH14 | F: CCTCCAGTGAGCAACCCA | (TGC)4 | 193–204 | 50 | KP729157 |
R: GACGGCAGACGACTCCTT | |||||
ZH15 | F: AGGCTCAGCAGCAAAGA | (CCA)5 | 456–464 | 50 | KP729158 |
R: CAGAAGTGGACGCAAAC | |||||
ZH16 | F: GGTGAAGGAGGGTTGCG | (CCA)2 | 303–308 | 52 | KP729159 |
R: TGTCGGTGCCGTTGCTG | |||||
ZH17 | F: CCAAAAACCAAGCGAACCGA | (CCG)6 | 252–269 | 51 | KP729160 |
R: TTTGTTGGCCTCATCCTCGT | |||||
ZH18 | F: ACACTCCCAGTTCAGCCATC | (CAG)7 | 542–562 | 51 | KP729161 |
R: CGTGGTACCATCTGGCCTTG | |||||
ZH19 | F: CTGTGGCTACTCGTGAT | (CAG)7 | 416 | 53 | KP729162 |
R: CGATAAAGGCAGATAGTAAA | |||||
ZH20 | F: CCCACTTCGGCGGCATCAT | (CAG)6 | 380–397 | 51 | KP729163 |
R: AGCATCGGTCGCAGGGAGGA | |||||
ZH21 | F: AGGCTCCATCCATCTTTACT | (TGC)6 | 42–59 | 50 | KP729164 |
R: TTTCAGATAACCACCAGATT | |||||
ZH22 | F: CCCTCATCGCCATCTTTG | (AGC)4 | 161–172 | 50 | KP729165 |
R: GCACTCCTGCCACTCCAT | |||||
ZH23 | F: GCATCCATCCCTACCTCA | (AAG)7 | 198–218 | 50 | KP729166 |
R: CAGCGTCACCATTAGCAG | |||||
ZH24 | F: GCTGCTCCTCATCGTCGTCT | (CCT)4 | 80–91 | 51 | KP729167 |
R: GCCTTCACCTTCTTGCCCT | |||||
ZH25 | F: CTCGCGTGATTTCCAAACCC | (CCG)2 | 484–489 | 51 | KP729168 |
R: CGCAACCCTAGCTAACAACA | |||||
ZH26 | F: TCATCAAGCTCTTCCTGCCG | (CCG)3 | 50–58 | 51 | KP729169 |
R: GCCGCCATTTCCATTTCCAT | |||||
ZH27 | F: GCGGATGAGGAAGTAGAGG | (AAG)2 | 53–58 | 51 | KP729170 |
R: GCAGAAGGTCCATCAACA | |||||
ZH28 | F: GCTCCCTACCGTCCTCCTC | (CT)13 | 53–78 | 55 | KP729171 |
R: TGGGTTGGGTGGTGGCTC | |||||
ZH29 | F: CGGCGAGCGAACTGTCCAT | (AAC)5 | 172–186 | 55 | KP729172 |
R: CGCTTGAGGGTAGCCAGATGA | |||||
ZH30 | F: AGCACTTGGCAACCTGAA | (GA)5 | 571–580 | 53 | KP729173 |
R: GCATCAAGCCTCACAAACCAT | |||||
ZH31 | F: TACTGCCATTGCCACCTT | (AGC)8 | 515–538 | 50 | KP729174 |
R: TCGCCGCATTCGTTGT | |||||
ZH32 | F: GTCGCCGCATTGTCATCAG | (CCA)6 | 282 | 53 | KU987914 |
R: TATCGGTGCTGGAGGAGGC | |||||
ZH33 | F: GCCCAGTTCTTGGCTATCTTAC | (CAC)5 | 282 | 53 | KU987915 |
R: CTGCTGAGAAACGGTGGGT | |||||
ZH34 | F: CAACTCGCTGGTATCGTGC | (CAC)7 | 154 | 55 | KU987916 |
R: TCTCGGCTATGTCAGGTGC | |||||
ZH35 | F: ACCGTGGCACAGGCTCCGTC | (GCA)7 | 507 | 55 | KU987917 |
R: AGGCATCCCATTGCGTAG | |||||
ZH36 | F: CACAAGGGTTACTGGGATA | (CCA)6 | 291 | 55 | KU987918 |
R: AACGGTGGGTGCGGATG | |||||
ZH37 | F: TGGCACAGGCTCCGTC | (GCA)7 | 435 | 53 | KU987919 |
R: TCCCATTGCGTAGGTAG |
Note: Ta = annealing temperature.
Of the 50 primer pairs, 29 (58%) amplified a polymorphism after excluding those that did not amplify (13, 26%) or were monomorphic (8, 16%) (Table 1), and this was assessed using 90 individuals from nine populations. The 29 polymorphic SSR markers were analyzed using GenoDive v.2.0b20 software, and the number of alleles per locus (A) according to Nei (1987) ranged from two to 13 alleles with a mean of 4.07 alleles per locus. The average heterozygosity within populations (Hs) and total heterozygosity (Ht) ranged from 0.044 to 0.756 and 0.044 to 0.868 with averages of 0.38 and 0.43, respectively, suggesting that genetic diversity was higher within than among populations. HWE (P < 0.05) tests showed that no loci significantly deviated from the equilibrium between locus pairs, suggesting that the nine populations investigated were in genetic equilibrium. All loci in the current study, including 29 polymorphic and eight monomorphic primers in S. purpurea, were also screened in cross-amplification tests of 10 S. glareosa individuals. Twelve of the 37 primers were successfully amplified and all revealed polymorphisms. A varied from two to three, and Hs and Ht ranged from 0.50 to 0.83 and 0.50 to 0.83 with averages of 0.58 and 0.58, respectively (Table 2).
Table 2.
Results of initial primer screening for the 29 polymorphic loci in Stipa purpurea and cross-species amplification in S. glareosa.
Stipa purpurea | Stipa glareosa | ||||||||||||||||||||||||||||||||
Nagqu (N = 10) | Bangor (N = 10) | Nyima (N = 10) | Tsochen (N = 10) | Tradom (N = 10) | Burang (N = 10) | Menshi (N = 10) | Zanda (N = 10) | Shiquanhe (N = 10) | Total (N = 90) | Shiquanhe (N = 10) | |||||||||||||||||||||||
Locus | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht | A | Hs | Ht |
ZH1 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 3 | 0.444 | 0.451 | — | — | — |
ZH2 | 2 | 0.356 | 0.356 | 3 | 0.622 | 0.622 | 3 | 0.622 | 0.622 | 2 | 0.533 | 0.533 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 3 | 0.489 | 0.621 | — | — | — |
ZH3 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.044 | 0.044 | 2 | 0.500 | 0.500 |
ZH4 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.533 | 0.533 | 1 | 0.000 | 0.000 | 2 | 0.044 | 0.232 | — | — | — |
ZH5 | 3 | 0.622 | 0.622 | 1 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.711 | 0.711 | 2 | 0.356 | 0.356 | 3 | 0.456 | 0.531 | 2 | 0.667 | 0.667 |
ZH6 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 3 | 0.711 | 0.711 | 3 | 0.622 | 0.622 | 3 | 0.711 | 0.711 | 2 | 0.356 | 0.356 | 4 | 0.800 | 0.800 | 3 | 0.571 | 0.571 | 2 | 0.356 | 0.356 | 4 | 0.644 | 0.644 | — | — | — |
ZH7 | 4 | 0.800 | 0.800 | 3 | 0.622 | 0.622 | 2 | 0.533 | 0.533 | 5 | 0.889 | 0.889 | 3 | 0.711 | 0.711 | 2 | 0.356 | 0.356 | 4 | 0.800 | 0.800 | 2 | 0.711 | 0.711 | 4 | 0.800 | 0.800 | 13 | 0.756 | 0.868 | 3 | 0.833 | 0.833 |
ZH8 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 3 | 0.622 | 0.622 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 3 | 0.356 | 0.356 | 3 | 0.622 | 0.622 | 5 | 0.333 | 0.356 | — | — | — |
ZH9 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 3 | 0.711 | 0.711 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 4 | 0.444 | 0.572 | 2 | 0.500 | 0.500 |
ZH11 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.533 | 0.533 | 1 | 0.000 | 0.000 | 5 | 0.378 | 0.473 | — | — | — |
ZH12 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 3 | 0.714 | 0.714 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.000 | 0.000 | 3 | 0.622 | 0.622 | 4 | 0.222 | 0.222 | — | — | — |
ZH13 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 4 | 0.178 | 0.178 | 2 | 0.500 | 0.500 |
ZH14 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 5 | 0.600 | 0.588 | 2 | 0.667 | 0.667 |
ZH15 | 3 | 0.622 | 0.622 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 3 | 0.622 | 0.622 | 3 | 0.711 | 0.711 | 3 | 0.711 | 0.711 | 2 | 0.533 | 0.533 | 2 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.222 | 0.202 | — | — | — |
ZH16 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 1 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 3 | 0.467 | 0.469 | 2 | 0.500 | 0.500 |
ZH17 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.800 | 0.800 | 2 | 0.356 | 0.356 | 6 | 0.489 | 0.635 | 2 | 0.667 | 0.667 |
ZH18 | 2 | 0.533 | 0.533 | 3 | 0.711 | 0.711 | 3 | 0.711 | 0.711 | 1 | 0.000 | 0.000 | 3 | 0.622 | 0.622 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 4 | 0.533 | 0.533 | 3 | 0.711 | 0.711 | 4 | 0.189 | 0.21 | 2 | 0.500 | 0.500 |
ZH20 | 4 | 0.857 | 0.857 | 2 | 0.667 | 0.667 | 3 | 0.622 | 0.622 | 2 | 0.356 | 0.356 | 2 | 0.429 | 0.429 | 3 | 0.714 | 0.714 | 2 | 0.533 | 0.533 | 2 | 0.711 | 0.711 | 1 | 0.000 | 0.000 | 5 | 0.756 | 0.77 | — | — | — |
ZH21 | 4 | 0.8 | 0.8 | 3 | 0.622 | 0.622 | 4 | 0.800 | 0.800 | 3 | 0.622 | 0.622 | 3 | 0.711 | 0.711 | 3 | 0.622 | 0.622 | 3 | 0.622 | 0.622 | 3 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 4 | 0.211 | 0.211 | — | — | — |
ZH22 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 3 | 0.622 | 0.622 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 1 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.178 | 0.267 | 2 | 0.500 | 0.500 |
ZH23 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 2 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 5 | 0.389 | 0.39 | 2 | 0.500 | 0.500 |
ZH24 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 3 | 0.622 | 0.622 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 2 | 0.111 | 0.127 | — | — | — |
ZH25 | 2 | 0.429 | 0.429 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.533 | 0.533 | 1 | 0.000 | 0.000 | 3 | 0.456 | 0.487 | 2 | 0.596 | 0.596 |
ZH26 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.571 | 0.571 | 2 | 0.356 | 0.356 | 2 | 0.533 | 0.533 | 3 | 0.622 | 0.622 | 2 | 0.429 | 0.429 | 2 | 0.356 | 0.356 | 3 | 0.711 | 0.711 | 2 | 0.044 | 0.044 | — | — | — |
ZH27 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 9 | 0.633 | 0.794 | — | — | — |
ZH28 | 2 | 0.356 | 0.356 | 4 | 0.800 | 0.800 | 3 | 0.711 | 0.711 | 4 | 0.800 | 0.800 | 2 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 5 | 0.889 | 0.889 | 2 | 0.533 | 0.533 | 4 | 0.800 | 0.800 | 3 | 0.478 | 0.555 | — | — | — |
ZH29 | 1 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 3 | 0.622 | 0.622 | 2 | 0.533 | 0.533 | 3 | 0.711 | 0.711 | 1 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 2 | 0.714 | 0.714 | 2 | 0.356 | 0.356 | 5 | 0.733 | 0.733 | — | — | — |
ZH30 | 2 | 0.571 | 0.571 | 3 | 0.622 | 0.622 | 3 | 0.800 | 0.800 | 3 | 0.622 | 0.622 | 2 | 0.533 | 0.533 | 3 | 0.711 | 0.711 | 3 | 0.800 | 0.800 | 3 | 0.000 | 0.000 | 4 | 0.800 | 0.800 | 3 | 0.289 | 0.453 | — | — | — |
ZH31 | 1 | 0.000 | 0.000 | 2 | 0.533 | 0.533 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 2 | 0.356 | 0.356 | 1 | 0.356 | 0.356 | 1 | 0.000 | 0.000 | 3 | 0.289 | 0.453 | — | — | — |
Note: A = number of alleles; Hs = heterozygosity within populations; Ht = total heterozygosity.
CONCLUSIONS
This is the first known report of EST-SSRs developed for use in S. purpurea. Twenty-nine polymorphic and eight monomorphic primer sequences were described in this study. The markers described here appear to be highly reliable and will enable the investigation of genetic diversity at the population level and the analysis of population structure of S. purpurea. They may also contribute to studies of genetic diversity across other Stipa species.
Appendix 1.
Locality and accession information of the nine Stipa purpurea populations and a single S. glareosa population of the Qinghai–Tibet Plateau used in this study. All specimens are deposited in the herbarium of the Kunming Institute of Botany, Chinese Academy of Sciences (KUN), Kunming, Yunnan, China.
Population code/Species | Collection locality | Voucher specimen accession no. | Altitude (m a.s.l.) | Geographic coordinates | N |
P1/S. purpurea Griseb. | Nagqu, Tibet | 1270416 | 4690 | 30°50′52″N, 90°37′15″E | 10 |
P2/S. purpurea | Bangor, Tibet | 1270417 | 4636 | 31°36′58″N, 89°32′14″E | 10 |
P3/S. purpurea | Nyima, Tibet | 1270411 | 4538 | 32°00′05″N, 86°50′54″E | 10 |
P4/S. purpurea | Tsochen, Tibet | 1270414 | 4794 | 31°03′06″N, 85°05′42″E | 10 |
P5/S. purpurea | Tradom, Tibet | 1270412 | 4651 | 30°14′54″N, 82°58′31″E | 10 |
P6/S. purpurea | Burang, Tibet | 1270415 | 4639 | 30°42′57″N, 81°21′39″E | 10 |
P7/S. purpurea | Menshi, Tibet | 1270408 | 4495 | 31°10′57″N, 80°47′22″E | 10 |
P8/S. purpurea | Zanda, Tibet | 1270409, 1270410 | 4584 | 31°31′43″N, 79°58′42″E | 10 |
P9/S. purpurea | Shiquanhe, Tibet | 1270406 | 4682 | 32°39′47″N, 79°55′48″E | 10 |
P9/S. glareosa P. A. Smirn. | Shiquanhe, Tibet | 1270424 | 4682 | 32°39′47″N, 79°55′48″E | 10 |
Note: a.s.l. = above sea level; N = number of individuals.
LITERATURE CITED
- Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Huang D. N., Zhang Y. Q., Jin M. D., Li H. K., Song Z. P., Wang Y. G., Chen J. K. 2014. Characterization and high cross-species transferability of microsatellite markers from the floral transcriptome of Aspidistra saxicola (Asparagaceae). Molecular Ecology Resources 14: 569–577. [DOI] [PubMed] [Google Scholar]
- Li X., Yin X., Yang S. H., Yang Y. Q., Qian M., Zhou Y. L., Yang Y. P. 2015. Variations in seed characteristics among and within Stipa purpurea populations on the Qinghai-Tibet Plateau. Botany 93: 651–662. [Google Scholar]
- Liu W. S., Dong M., Song Z. P., Wei W. 2009. Genetic diversity pattern of Stipa purpurea populations in the hinterland of Qinghai-Tibet Plateau. Annals of Applied Biology 154: 57–65. [Google Scholar]
- Liu W. S., Liao H., Zhou Y., Zhao Y., Song Z. P. 2011. Microsatellite primers in Stipa purpurea (Poaceae), a dominant species of the steppe on the Qinghai-Tibet Plateau. American Journal of Botany 98: e150–e151. [DOI] [PubMed] [Google Scholar]
- Meirmans P. G., Van Tienderen P. H. 2004. GENOTYPE and GENODIVE: Two programs for the analysis of genetic diversity of asexual organisms. Molecular Ecology Notes 4: 792–794. [Google Scholar]
- Nei M. 1987. Molecular evolutionary genetics. Columbia University Press, New York, New York, USA. [Google Scholar]
- Sheidai M., Attaei S. 2005. Meiotic studies of some Stipa (Poaceae) species and population in Iran. Cytologia 70: 23–31. [Google Scholar]
- Thiel T., Michalek W., Varshney R. K., Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 10: 411–422. [DOI] [PubMed] [Google Scholar]
- Yan Y. B., Huang Y., Fang X. T., Lu L., Zhaou R. C., Ge X. J., Shi S. H. 2011. Development and characterization of EST-SSR markers in the invasive weed Mikania micrantha (Asteraceae). American Journal of Botany 98: el–e3. [DOI] [PubMed] [Google Scholar]
- Yang Y. Q., Li X., Kong X. X., Ma L., Hu X. Y., Yang Y. P. 2015. Transcriptome analysis reveals diversified adaptation of Stipa purpurea along a drought gradient on the Tibetan Plateau. Functional & Integrative Genomics 15: 295–307. [DOI] [PubMed] [Google Scholar]
- Yue P. P., Lu X. F., Lu R. R., Zhou Y. B., Yang S. B., Zhang C. X., Tao M. 2008. Community characteristics of Stipa purpurea steppe in source regions of Changjiang and Huanghe rivers, China. Journal of Plant Ecology 32: 1116–1125. [Google Scholar]
- Yue P. P., Lu X. F., Ye R. R., Zhang C. X., Peng M. 2011. Distribution of Stipa purpurea steppe in the Northeastern Qinghai-Xizang Plateau, China. Russian Journal of Ecology 42: 50–56. [Google Scholar]
- Yue P. P., Peng M. 2014. On the research progress of Stipa purpurea steppe in Qinghai-Tibetan Plateau. Journal of Yulin University 24: 1–6. [Google Scholar]
- Zhai X. Y.2012. The population genetic characteristic of Stipa purpurea under different grazing intensity. Master’s dissertation, Henan Agricultural University, Zhengzhou, China.