Skip to main content
Eukaryotic Cell logoLink to Eukaryotic Cell
. 2004 Aug;3(4):900–909. doi: 10.1128/EC.3.4.900-909.2004

Ectopic Expression of URA3 Can Influence the Virulence Phenotypes and Proteome of Candida albicans but Can Be Overcome by Targeted Reintegration of URA3 at the RPS10 Locus

Alexandra Brand 1,†, Donna M MacCallum 1,†, Alistair J P Brown 1, Neil A R Gow 1, Frank C Odds 1,*
PMCID: PMC500875  PMID: 15302823

Abstract

Uridine auxotrophy, based on disruption of both URA3 alleles in diploid Candida albicans strain SC5314, has been widely used to select gene deletion mutants created in this fungus by “Ura-blasting” and PCR-mediated disruption. We compared wild-type URA3 expression with levels in mutant strains where URA3 was positioned either within deleted genes or at the highly expressed RPS10 locus. URA3 expression levels differed significantly and correlated with the specific activity of Ura3p, orotidine 5′-monophosphate decarboxylase. Reduced URA3 expression following integration at the GCN4 locus was associated with an attenuation of virulence. Furthermore, a comparison of the SC5314 (URA3) and CAI-4 (ura3) proteomes revealed that inactivation of URA3 caused significant changes in the levels of 14 other proteins. The protein levels of all except one were partially or fully restored by the reintegration of a single copy of URA3 at the RPS10 locus. Transcript levels of genes expressed ectopically at this locus in reconstituted heterozygous mutants also matched the levels found when the genes were expressed at their native loci. Therefore, phenotypic changes in C. albicans can be associated with the selectable marker rather than the target gene. Reintegration of URA3 at an appropriate expression locus such as RPS10 can offset most problems related to the phenotypic changes associated with gene knockout methodologies.


Genes encoding enzymes in the uridine biosynthetic pathway are used as positive selectable markers in gene disruption strategies for a wide range of eukaryotic organisms. For the major human pathogenic fungus Candida albicans, this approach, based on the URA3 gene, was the only means available for gene disruption for more than 10 years. C. albicans is diploid and has no known natural sexual cycle that leads to a haploid form. Therefore, molecular genetic evidence associating phenotypic changes with individual gene functions requires the successive disruption of two copies of the gene of interest. “Ura-blasting,” used for gene disruption in C. albicans (28), is based on a similar approach in Saccharomyces cerevisiae (1) and makes use of a C. albicans ura3 auxotroph. Transformants are selected on the basis of uridine prototrophy. The marker is then recycled by use of 5-fluoroorotic acid to select for Ura− segregants that have lost URA3 through a reciprocal crossover between identical flanking DNA repeats. The “Ura-blaster” can then be used to disrupt the second allele in these ura3 segregants. PCR-based gene disruption protocols also exploit the URA3 marker but often do not recycle it (90).

One area of investigation that has made extensive use of specific gene disruption based on the URA3 selection strategy is the study of virulence in C. albicans. At least 50 genes have been implicated as putative virulence factors in this fungus based on results of mouse intravenous challenge experiments in which the homozygous C. albicans null mutants of interest were shown to be less lethal than wild-type controls (61). In most of these studies, the strain tested in mice had been the Ura+ transformant obtained after the second round of Ura-blasting (e.g., yfgΔ::hisG/yfg1Δ::hisG-URA3-hisG).

“Molecular Koch's postulates” suggest that confirmation of a microbial virulence factor requires that (i) inactivation of the gene should attenuate virulence and (ii) reintegration of the gene into the null mutant should restore wild-type virulence. In C. albicans, this process depends predominantly on the use of URA3 as a selectable marker. However, the use of Ura selection creates a technical problem. These procedures result in the transfer of URA3 from its normal location on chromosome 3 to a nonnative chromosomal location. Hence, mutant and control strains used in virulence experiments often differ in two (not one) respects: disruption of the target locus and the genomic location of URA3.

A number of publications have documented problems arising from the use of URA3 as a selectable marker following gene disruption. Lay et al. (48) demonstrated that specific activities of orotidine 5′-monophosphate (OMP) decarboxylase (Ura3p) differed between strains of C. albicans harboring one or two copies of URA3 in a way that was not simply related to the gene dosage. They showed an inverse correlation between OMP decarboxylase activity and the survival times of mice infected with these mutants. Sundstrom et al. (82) showed that the location of URA3 at the disruption site affected the virulence phenotype of hwp1/hwp1 mutants. Bain et al. (7) demonstrated that the URA3 status of cell wall mutants affected their ability to adhere to buccal epithelial cells. Cheng et al. showed that changing the location of URA3 in the C. albicans genome affected OMP decarboxylase activity, hyphal morphogenesis, buccal cell adherence, and lethality for mice (19). In addition, the phenotypic effects that have been correlated with the disruption of four C. albicans genes were shown to be a consequence of the genomic relocation of URA3 in three of these cases (19). Staab and Sundstrom reviewed the importance of URA3 positional effects in influencing phenotypes of C. albicans mutants (81). They propose that a “wild-type” strain of C. albicans comprising CAI-4 with URA3 reintegrated at a highly expressed locus, ENO1, is a more appropriate control for Ura-blasted mutants than either of the CAI-4 parental strains, SC5314 and CAF2-1.

We have further assessed the significance of URA3 expression as an influence on virulence and other phenotypic characteristics in C. albicans. Our experiments make use of the CIp10 vector, which reintegrates URA3 at the high-expression RPS10 locus (59), producing mutant and control strains with isogenic backgrounds. We show that expression levels of URA3 correlate with OMP decarboxylase activities in three mutants created using the Ura-blaster protocol. We have tested the association between OMP decarboxylase activities and mouse virulence in several C. albicans mutants and clinical isolates and studied the global effects of URA3 deletion on the C. albicans proteome in a pairwise comparison of SC5314 and CAI-4. We show, for a wide range of mutant strains, that ectopic expression of URA3 is likely to have an effect on the virulence phenotype in as many as 30% of published cases but that the phenotype can be corrected by expression of URA3 at the RPS10 locus.

MATERIALS AND METHODS

C. albicans strains, culture media, and growth conditions.

The C. albicans strains used in this study are listed in Table 1. C. albicans strains were routinely grown and maintained on Sabouraud agar. For reverse transcription-PCR (RT-PCR) experiments, strains were grown with shaking at 37°C in SD (6.7 g of yeast nitrogen base per liter, 20 g of glucose per liter) to an optical density at 600 nm (OD600) of 0.95. For analysis by two-dimensional (2D) gel electrophoresis, strains were grown to an OD600 of 0.65 at 37°C in YEPD (10 g of yeast extract [Oxoid] per liter, 20 g of mycological peptone [Oxoid] per liter, 20 g of glucose per liter) supplemented with 25 μg of uridine per ml. For inoculum preparation in animal experiments, strains were grown for 24 h in 5-ml lots of NGY (1 g of neopeptone [Difco] per liter, 4 g of glucose per liter, 1 g of yeast extract [Difco] per liter) rotated at 30°C at 20 rpm in a test tube wheel set at an angle of 5° from the horizontal. For OMP decarboxylase assays, cells were either grown in SD, as for RT-PCR experiments, or shaken in flasks of NGY at 37°C until growth reached an OD600 of 0.6. Pilot experiments showed that there was no significant difference in enzyme activity from cells grown under the two conditions.

TABLE 1.

C. albicans strains used in this study

Strain Description or name Genotype Source or reference
ATCC 44858 Isolate from parrot Originally from Janssen Pharmaceutica
NCPF 3153 Clinical isolate Reference antigen strain, Public Health Mycology Reference Laboratory
RV4688 Clinical isolate Originally from Janssen Pharmaceutica
AM2003-020 Isolate from healthy carrier
73/034 Isolate from healthy carrier
SC5314 Clinical isolate 28
CAF2-1 ura3Δ-iro1Δ::imm434/URA3 28
CAI-4 ura3Δ-iro1Δ::imm434/ura3Δ-iro1Δ::imm434 28
NGY152 CAI-4/CIp10 ura3Δ-iro1Δ::imm434/Δura3Δ-iro1Δ::imm434/Clp10 60
NGY23 mnt1Δ/mnt1 As CAI-4 but mnt1Δ::hisG/mnt1Δ::hisG-URA3-hisG 15
NGY158 mnt1Δ/Clp10 As CAI-4 but mnt1Δ::hisG/mnt1Δ::hisG/Clp10 Bates et al., unpublished
NGY148 mnt1Δ/Clp10-MNT1 As CAI-4 but mnt1Δ::hisG/mnt1Δ::hisG/Clp10-MNT1 Bates et al., unpublished
NGY337a mnt1Δ/mnt2Δ/Clp10 As CAI-4 but mnt1-IPF6318-mnt2Δ::hisG/mnt1-IPF6318- mnt2Δ::hisG/Clp10 Bates et al., unpublished
NGY105 mnt2Δ As CAI-4 but mnt2Δ::hisG/mnt2Δ::hisG-URA3-hisG Bates et al., unpublished
NGY145 mnt2Δ/Clp10 As CAI-4 but mnt2Δ::hisG/mnt2Δ::hisG/Clp10 Bates et al., unpublished
NGY103 MNT2/mnt2Δ MNT2/mnt2Δ::hisG-URA3-hisG Bates et al., unpublished
NGY336 MNT2/mnt2Δ/Clp10 MNT2/mnt2Δ::hisG/Clp10 Bates et al., unpublished
NGY63 mnt3Δ As CAI-4 but mnt3Δ::hisG/mnt3Δ::hisG-URA3-hisG Thomson et al., unpublished
NGY146 mnt3Δ/Clp10 As CAI-4 but mnt3Δ::hisG/mnt3Δ::hisG/Clp10 Thomson et al., unpublished
NGY71 mnt4Δ As CAI-4 but mnt4Δ::hisG/mnt4Δ::hisG-URA3-hisG Bates et al., unpublished
NGY313 mnt4Δ/Clp10 As CAI-4 but mnt4Δ::hisG/mnt4Δ::hisG/Clp10 Bates et al., unpublished
NGY71 mnt5Δ As CAI-4 but mnt5Δ::hisG/mnt5Δ::hisG-URA3-hisG Thomson et al., unpublished
NGY147 mnt5Δ/Clp10 As CAI-4 but mnt5Δ::hisG/mnt5Δ::hisG/Clp10 Thomson et al., unpublished
NGY151 mnt5Δ/Clp10-MNT5 As CAI-4 but mnt5Δ::hisG/mnt5Δ::hisG/Clp10-MNT5 Thomson et al., unpublished
DH5 mnn4Δ As CAI-4 but mnn4Δ::hisG/mnn4Δ::hisG-URA3-hisG Hobson et al., unpublished
DH15 mnn4Δ/Clp10 As CAI-4 but mnn4Δ::hisG/mnn4Δ::hisG/Clp10 Hobson et al., unpublished
DH11 mnn4Δ/Clp10-MNN4 As CAI-4 but mnn4Δ::hisG/mnn4Δ::hisG/Clp10-MNN4 Hobson et al., unpublished
DH13 mnn4Δ/Clp10-MNN4nb As CAI-4 but mnn4Δ::hisG/mnn4Δ::hisG/Clp10-MNN4n Hobson et al., unpublished
DH17 MNN4/mnn4Δ MNN4/mnn4Δ::hisG/Clp10 Hobson et al., unpublished
GTC43 gcn4Δ As CAI-4 but gcn4Δ::hisG/gcn4Δ::hisG-URA3-hisG 84
GTC41 GCN4/gcn4Δ As CAI-4 but GCN4/gcn4Δ::hisG-URA3-hisG Tournu et al., unpublished
GTC45 gcn4Δ/Clp10 As CAI-4 but gcn4Δ::hisG/gcn4Δ::hisG/Clp10 Tournu et al., unpublished
GTC49a gcn4Δ/Clp10-GCN4(a) As CAI-4 but gcn4Δ::hisG/gcn4Δ::hisG/Clp10-ACT1p-GCN4 Tournu et al., unpublished
GTC49b gcn4Δ/Clp10-GCN4(b) As CAI-4 but gcn4Δ::hisG/gcn4Δ::hisG/Clp10-ACT1p-/GCN4 Tournu et al., unpublished
GTC47 gcn4Δ/pMET-GCN4 As CAI-4 but gcn4Δ::hisG/gcn4Δ::hisG/pMET-GCN4 Tournu et al., unpublished
MMC3 nrg1Δ As CAI-4 but nrg1Δ::hisG/nrg1Δ::hisG-URA3-hisG 60
NGY205 och1Δ och1Δ::hisG/och1Δ::hisG Thomas et al., unpublished
BH1-1-1 sap3Δ As CAI-4 but sap3Δ::hisG/sap3Δ::hisG-URA3-hisG 35
VC3.9 sap3Δ/Clp10 As CAI-4 but sap3Δ::hisG/sap3Δ::hisG/Clp10 Copping et al., unpublished
rad52 heterozygote RAD52/rad52Δ As CAI-4 but RAD52/rad52Δ::hisG-URA3-hisG Ciudad et al., unpublished
rad52 reintegrant rad52Δ/RAD52 As CAI-4 but rad52Δ::hisG/RAD52::URA3-hisG Ciudad et al., unpublished
a

Deletion spans MNT1, MNT2, and intervening ORF IPF6318 (putative β-glucosidase).

b

Multicopy reintegrant.

RNA isolation and cDNA synthesis.

Total RNA was extracted by the method of Schaller et al. (72). mRNA was isolated from total RNA using a Dynabeads mRNA purification kit (Dynal A. S., Oslo, Norway). cDNA was synthesized using 400 U of Superscript II RNase H− reverse transcriptase kit (Invitrogen) as specified by the manufacturer. cDNA was quantified by measurement of OD260 and diluted to give a stock concentration of 500 μg/ml.

Multiplex RT-PCR and estimation of URA3 mRNA abundance.

Fragments of URA3, GCN4, MNN4, and MNT5 cDNA were each coamplified with the cDNA of elongation factor B1 (54, 72). Primers for PCR are listed in Table 2. PCR conditions were 94°C for 10 s followed by 27 cycles of 94°C for 45 s, annealing temperature for 60 s (Table 2), and 72°C for 60 s. Approximately 500 ng of cDNA was used as template. The PCR products from sequential PCR cycles were visualized on 2% agarose gels, and the difference in cycle number between the appearance of the first band for EFB1 and that of the gene of interest was recorded for three independent samples for each strain. Within each RT-PCR experiment, the relative abundance of URA3 mRNA was estimated from the mean cycle number difference.

TABLE 2.

Primers used for RT-PCR

Gene amplified Primer name Primer sequence (5′-3′) Product size (bp) Annealing temp (°C) Reference
EFB1 EFB1F ATTGAACGAATTCTTGGCTGAC 526 (cDNA) 72
EFB1R CATCTTCTTCAACAGCAGCTTG 891 (genomic DNA)
MNT5 MNT5F AGCATTGGAATCAATGCGATC 460 53 This study
MNT5R TTTCATAAATGATTCTACTGTGG
MNN4 MNN4F AGATTCAGACGCTGATAGAGC 338 56 This study
MNN4R ATTCACGGATATGAACCTTC
GCN4 GCN4F TTGGAGATGACAATGATGATGG 276 56 This study
GCN4R CAACTTCACCACCAGCAGTG
URA3 URA3F TAATGCTCATGGTGTCCATG 243 54 This study
URA3R CAAATCCTTCTTCTTGTCCA

OMP decarboxylase assays.

Protein extraction from cells that had been disrupted by vortexing with 0.45-mm-diameter glass beads (Sigma-Aldrich Ltd, Poole, United Kingdom) and OMP decarboxylase assays were based on the methods described by Lay et al. (48) and Yashimoto et al. (95). The assay mixture, in a total volume of 850 μl, contained approximately 100 μg of cell lysate protein, 0.1 M phosphate buffer (pH 6.0), 1.0 μmol of β-mercaptoethanol and 0.15 μmol of OMP substrate (Sigma-Aldrich). Conversion of OMP to UMP was measured spectrophotometrically at room temperature as the decrease in absorbance of the substrate at 285 nm over a specified period. The concentration of OMP in the assay was calculated from a molar extinction coefficient for orotidine 5′-monophosphate of 1.65 × 103 liters cm−1 M−1. One unit of enzyme was defined as the amount of enzyme required to convert 1 μmol of OMP to UMP per min. Specific activity was defined as units of enzyme activity per milligram of protein. The protein concentration was determined with a Coomassie protein assay reagent kit (Pierce, Rockford, Ill.). Enzyme activity was assayed for three independent samples per strain, and C. albicans SC5314 was included as a reference control in each experiment. To compare data from different experiments, specific activities of OMP decarboxylase were normalized to the activity measured for SC5314, which was set at 100%. The OMP decarboxylase specific activities reported previously for CAF2-1 (48) differed by approximately 1,000-fold from those we have measured.

Protein extraction and 2D gel electrophoresis.

The COGEME Proteome Research Facility 1 (http://www.abdn.ac.uk/cogeme) undertook all protein extraction and 2D gel electrophoresis experiments. Samples were resolved in the first dimension on 24-cm Immobiline DryStrip gels (pH 4 to 7) (Amersham Biosciences, Chalfont St. Giles, United Kingdom) in an Ettan IPGphor isoelectric focusing unit (Amersham Biosciences) and in the second dimension on precast sodium dodecyl sulfate-12.5% polyacrylamide gels with an Ettan Dalt system (Amersham Biosciences).

Image analysis and protein identification.

Images from three independent samples per strain were analyzed with Phoretix 2D software (Nonlinear Dynamics Ltd., Newcastle-upon-Tyne, United Kingdom) to identify features that were reproducibly altered between strains. Spots that displayed more than a twofold change in relative volume with a statistical significance of P ≤ 0.05 (Student's t test) were analyzed further. Peptide mass fingerprints were generated from spots by MALDI-TOF mass spectrometry and used to interrogate the CandidaDB database (http://genolist.pasteur.fr/CandidaDB/). Data are available at the COGEME PRF website (http://www.cogeme.abdn.ac.uk).

Experimental infections in mice.

Experimentation was done under the terms of United Kingdom Home Office licenses for research on animals. Female DBA/2 and BALB/c mice (Harlan) with a weight range from 17 to 23 g were maintained in individually ventilated cages under conditions specified by the Health and Safety Executive for level 2 biohazard containment. The animals were supplied with food and water ad libitum. Challenge inocula were grown overnight at 30°C in NGY, centrifuged, washed twice with sterile distilled water, and resuspended in sterile saline. The inocula were standardized by spectrophotometry, and their concentrations were adjusted according to the experimental design. The true concentrations of yeast inocula were routinely determined by viable counts made from the suspensions used for (intravenous) challenge.

Mice were challenged by i.v. inoculation of C. albicans suspensions via a lateral tail vein. For BALB/c mice the challenge dose was in the range of 4.2 to 5.0 log10 CFU/g of body weight (median, 104.5 CFU/g), and for DBA/2 mice the dose range was 2.4 to 3.3 log10 CFU/g of body weight (median, 102.8 CFU/g). Differences in mouse survival and organ burdens between C. albicans strains were not attributable to the variations in challenge dose. Correlation coefficients between challenge dose and mean survival times or mean organ burdens ranged from −0.1 to 0.3 for both mouse strains.

For all animals, the postchallenge day of death or of euthanasia for animals exhibiting signs of serious illness was recorded and the C. albicans tissue burden in both kidneys and brain was determined at the time of demise by viable counting of 100-μl samples homogenized in 0.5-ml volumes of sterile saline. Detection limits for tissue burdens under these conditions were 150 CFU (kidneys) and 80 CFU (brains); culture-negative samples were scored as 0.5 log10 unit lower than these limits for statistical purposes. All experiments ended 28 days after challenge; animals surviving at this time were humanely killed, and tissue burdens were determined by plating on Sabouraud agar.

RESULTS

OMP decarboxylase activity correlates with URA3 mRNA abundance.

Ura3p specific activities were measured for cell extracts from a range of strains created with the Ura-blaster methodology and containing one or two copies of URA3. OMP decarboxylase activity reflected the URA3 gene copy number in the control strains SC5314 and CAF2-1 and was not affected by growing the cells in increasing concentrations of exogenous uridine (Table 3). No activity was detected in strain CAI-4, consistent with the lack of a functional URA3 allele in this strain. In mutant strains derived from the SC5314-CAF2-1-CAI-4 lineage, OMP decarboxylase activity varied depending on the genomic location of the URA3 gene and was lower than that of CAF2-1 in all mutants. However, OMP decarboxylase activity was restored to the level of CAF2-1 when URA3 was reintegrated at the RPS10 locus by using CIp10. There was one exception (NGY145), which had significantly higher activity than CAF2-1 (Student's t test; P = 0.022), although this was only 73% of the activity of SC5314. A selection of five wild-type clinical isolates of C. albicans had OMP decarboxylase specific activities of the same order as that of SC5314 (Table 3). Therefore, the chromosomal location of URA3 significantly influenced Ura3p specific activity.

TABLE 3.

OMP decarboxylase activity in control and mutant strains that were grown in SDG or NGY, with and without uridine supplementation

C. albicans strain OMP decarboxylase activity (nmol/mg/min)a Activity relative to SC5314 (%) Strain transformed with Clp10 OMP decarboxylase activity (nmol/mg/min)a Activity relative to SC5314 (%)
SC5314 29.7 ± 3.7 100.0
CAF2-1 15.4 ± 1.4 51.7
CAF2-1 + uridine (25 μg/ml) 14.7 ± 0.8 49.5
CAF2-1 + uridine (250 μg/ml) 15.0 ± 2.0 50.5
CAI-4 <1.0b <1.0b NGY152 16.7 ± 1.3 56.2
CAI-4 + uridine (25 μg/ml) <1.0b <1.0b NGY152 13.0 ± 1.2 43.8
CAI-4 + uridine (250 μg/ml) <1.0b <1.0b NGY152 13.0 ± 2.8 43.8
NGY23 (mnt1Δ) 8.8 ± 0.5 29.6 NGY158 16.8 ± 0.7 56.6
NGY105 (mnt2Δ) 13.6 ± 1.5 45.8 NGY145 21.6 ± 2.9 72.7
NGY63 (mnt3Δ) 2.6 ± 0.8 8.7 NGY146 12.9 ± 1.9 43.4
NGY87 (mnt4Δ) 2.7 ± 1.1 9.1 NGY313 14.4 ± 1.4 48.5
NGY71 (mnt5Δ) 5.9 ± 0.3 19.9 NGY147 17.7 ± 1.2 59.6
DH5 (mnn4Δ) 7.0 ± 0.9 23.6 DH15 12.3 ± 1.1 41.4
GTC43 (gcn4Δ) 8.8 ± 0.9 29.6 GTC45 15.5 ± 0.8 52.1
BH1-1-1 (sap3Δ) 14.1 ± 0.9 47.5 VC3.9 15.4 ± 0.0 51.9
73/034 38.7 ± 0.2 130.3
AM2003-020 29.4 ± 1.0 99.0
3153 25.0 ± 3.2 84.2
B2360 24.9 ± 2.2 83.8
a

Results are expressed as mean ± standard error of the mean.

b

Limit of detection.

URA3 expression levels depend on chromosomal location but are restored to the CAF2-1 equivalent by reintegration at the RPS10 locus.

To establish whether the expression of ectopically placed URA3 was influenced by the normal level of transcriptional activity at target loci, MNT5, MNN4, and GCN4 mRNA abundance was measured relative to URA3 mRNA abundance for strain CAF2-1 (URA3/ura3) by semiquantitative RT-PCR. The results (Table 4) showed that GCN4 mRNA levels were considerably higher than those for URA3. The MNN4 mRNA levels were similar to those of URA3, and expression of MNT5 was 25-fold lower than that of URA3.

TABLE 4.

Expression of C. albicans genes and expression of URA3 in ectopic gene loci measured on the basis of relative RNA abundance by RT-PCR

Gene Expression of target genes in CAF2-1a URA3 expression at different loci
URA3 expression at the RPS10 locus
Strain URA3 mRNA abundance relative to CAF2-1 Strain URA3 mRNA abundance relative to CAF2-1
URA3 CAF2-1 NGY152 (CA1-4/CIp10) Increased 1.34-fold
MNT5 Decreased 26-fold NGY71 (mnt5Δ) Decreased 6.8-fold NGY147 (mnt5Δ/CIP10) Decreased 1.33-fold
MNN4 Decreased 0.6-fold DH5 (mnn4Δ) Decreased 2.0-fold DH15 (mnn4Δ/Clp10) Decreased 1.33-fold
GCN4 Increased 435-fold GTC43 (gcn4Δ) Decreased 8.0-fold GTC45 (gcn4Δ/Clp10) Decreased 2.0-fold
a

Measured as mRNA abundance relative to URA3 mRNA.

Notwithstanding these differences in the expression of the native genes, URA3 mRNA abundance was relatively low at all of these loci compared with URA3 expression at its native locus (in CAF2-1 [Fig. 1; Table 4]). This indicated that expression levels of URA3 at ectopic loci do not reflect the expression level of the gene native to each locus. When CIp10 was used to transform the mnt5, mnn4, and gcn4 mutants, producing strains with URA3 at the RPS10 locus, URA3 mRNA abundance was restored essentially to the same levels as in CAF2-1 (Fig. 1). Hence, the reinsertion of URA3 at the RPS10 locus restored URA3 mRNA to normal (heterozygote) levels, regardless of which chromosomal locus had been disrupted by Ura-blasting. There was a strong positive correlation between URA3 mRNA level and OMP decarboxylase activity in the same strains (Tables 3 and 4; r = 0.75).

FIG. 1.

FIG. 1.

URA3 mRNA abundance when URA3 is positioned at its native locus (CAF2-1) (A), the GCN4 locus (GTC43) (B), or the RPS10 locus after reintegration using the CIp10 vector (GTC45) (C). cDNA was synthesized from mRNA isolated from late-exponential-phase cells. URA3 mRNA abundance was measured relative to an internal control gene, EFB1, using multiplex RT-PCR.

Influence of URA3 expression on virulence of C. albicans mutants.

To determine the importance of URA3 expression levels for the virulence of C. albicans, a series of strains derived from CAI-4 were tested by i.v. challenge in DBA/2 mice for differences in survival times and tissue burdens of C. albicans. The strains tested carried a single copy of URA3: CAF2-1 (URA3/ura3), NGY152 (CAI-4/CIp10), GTC41 (GCN4/gcn4Δ), GTC43 (gcn4Δ), GTC45 (gcn4Δ/CIp10), GTC49 (gcn4Δ/CIp10-GCN4). The results are shown in Fig. 2 and Table 5. A marked reduction in virulence for both the heterozygous GCN4/gcn4Δ mutant (GTC41) and the homozygous gcn4Δ mutant (GTC43) was found relative to the parent strain (CAF2-1). The effect was equally evident from both the long survival (Fig. 2) and the relatively low tissue burdens (Table 5) of mice challenged with these strains. However, integration of CIp10 containing only the URA3 gene into the gcn4Δ null mutant (GTC45) restored wild-type virulence, with survival curves and tissue burdens matching those of CAF2-1 and NGY152. Reintegration of one copy of GCN4 at the RPS10 locus using CIp10 also produced a mutant with wild-type virulence restored.

FIG. 2.

FIG. 2.

Survival curves for female DBA/2 mice challenged iv. with C. albicans CAF2-1 (solid circles) and the following mutants derived from this strain: NGY152 (solid squares), GTC41 (GCN4/gcn4Δ; open circles), GTC43 (gcn4Δ; open squares), GTC45 (gcn4Δ/CIp10; solid triangles) and GTC49 (gcn4Δ/CIp10-GCN4; open triangles). Mice were in groups of 6 animals, except for CAF2-1, with 10 animals challenged.

TABLE 5.

Tissue burdens of C. albicans in left kidneys and brains from mice challenged i.v. with mutants derived from CAF2-1a

Strain C. albicans burden (log10 CFU/g)b in:
Left kidney Brain
CAF2-1 6.6 ± 0.6 4.4 ± 0.5
NGY152 (CAI-4/CIp10) 6.4 ± 0.6 4.3 ± 0.4
GTC41 (GCN4/cgn4Δ) 3.2 ± 1.2 2.9 ± 1.1
GTC43 (gcn4Δ) 3.2 ± 1.2 1.7 ± 1.0
GTC45 (gcn4Δ/CIp10) 6.5 ± 0.2 4.5 ± 0.1
GTC49 (gcn4Δ/CIp10/GCN4) 6.7 ± 0.1 4.3 ± 0.2
a

There were 6 mice per group except for CAF2-1, which had 10 mice per group.

b

Results are expressed as mean ± standard deviation.

Figure 3 shows scatter plots of OMP decarboxylase specific activities for a range of C. albicans clinical isolates and mutants versus their mean survival times in the mouse and versus mean fungal burdens in the kidneys and brains of infected animals. For mutants derived from the SC5314-CAF2-1-CAI-4 lineage by Ura-blasting, a weak negative association was apparent between relative OMP decarboxylase specific activity and mean survival time (r = −0.38) and a weak positive association was apparent between enzyme activity and kidney burdens (r = 0.40) and brain burdens (r = 0.38). Data for strains RV4688 and 73/034 show clearly that strains of relatively low virulence can have wild-type OMP decarboxylase levels. This suggests that factors other than OMP decarboxylase levels influence the virulence of these strains.

FIG. 3.

FIG. 3.

Scatter plots of OMP decarboxylase specific activity in wild-type and mutant C. albicans strains versus three parameters of virulence in a mouse i.v. C. albicans challenge model: mean survival time (a), mean kidney burden (b), and mean brain burden (c). Each point represents the result with a single strain tested for BALB/c mice (open circles) or DBA/2 mice (solid circles) in groups of 6 animals, except for CAF2-1, NGY152, SC5314, BH1-1-1, and VC3.9, where group sizes of 12 to 30 animals were pooled from two to five replicate experiments. The strains tested were all derived originally from SC5314, whose OMP decarboxylase activity was taken as 100%. Details of the strains are shown in Table 1. Additional results for five natural isolates of C. albicans that differed in inherent virulence are individually identified on the graphs as solid squares; their virulence was tested in BALB/c mice. Data for brain burdens were not available for ATCC 44858.

Proteomic analysis of SC5314 and CAI-4.

To investigate the global effects of inactivating the URA3 gene, we compared the proteomes of SC5314 and CAI-4 cells grown in YPD supplemented with uridine. Because the gene deletion in CAI-4 includes a portion of IRO1 as well as URA3 (31), we also examined the proteome of strain NGY152, in which one copy of URA3 is reintegrated at the RPS10 locus. As predicted, Ura3p was present on SC5314 gels at a position consistent with its pI and molecular mass (pI = 5.24, molecular mass = 24 kDa) but was not detected on CAI-4 gels. Exogenous uridine was supplied for all strains to facilitate growth of CAI-4. The presence of Ura3p in SC5314 gels under these growth conditions was consistent with the finding in this study that exogenous uridine supplied to growing cells did not affect OMP decarboxylase activity. Fourteen other proteins showed altered expression in CAI-4 (Table 6). Levels of all proteins except the transcription factor, Toa2p, were partially or fully restored by the reintegration of a single copy of URA3 in strain NGY152, indicating that the deletion of URA3, and not the truncation of IRO1, accounts for the majority of proteomic changes observed for CAI-4. Of the 13 proteins displaying URA3-dependent changes, 3 (Hpt1p, Ade2p, and Ura5p) are involved in purine and pyrimidine metabolism. These pathways may be perturbed by an altered flux of metabolic intermediates in the absence of OMP decarboxylase, the last of six enzymes in the uridine de novo biosynthetic pathway. Other changes in expression suggest that heme biosynthesis (Ald5p and Hem13p) and aromatic amino acid turnover (Aro8p and Aro10p) may also be perturbed by the loss of Ura3p. Another group of proteins with related function that showed altered expression in CAI-4 comprised Rps12p, Eft2p, and IPF6037p, which are involved in translation or transcription. Therefore, inactivation of URA3 appears to influence C. albicans metabolism in unexpected ways.

TABLE 6.

Effect of URA3 deletion on the cytosolic proteomera

Protein (Reference) Change in expression in CAI-4 Expression in NGY152 (URA3 reintegrated at RPS10 locus)
Ura3p (33) Not detected Partially restored
Hpt1p (34) Not detected Fully restored
Ald5p (2 spots) (46, 68) Only 1 spot present Fully restored
Sgt2p (22, 45) Only 1 spot present Fully restored
Pmm1p (78) 4.5-fold increase Fully restored
IPF6037 4.5-fold increase Fully restored
Aro8p (40) 3.8-fold increase Fully restored
Ade2p (73) 3.8-fold increase Partially restored
Ura5p (25) 3.3-fold increase Fully restored
Eft2p (55) 2.9-fold increase Partially restored
Aro10p (87) 2.9-fold increase Partially restored
Hem13p (96) 2.1-fold increase Partially restored
Rps12p (63) 4.2-fold decrease Fully restored
Toa2p (43) 3.2-fold decrease Not restored (same as CAI-4)
IPF4328 2.6-fold decrease Fully restored
a

Results are shown for proteins with a greater than twofold change in expression between SC5314 and CAI-4. Cells were grown in YPD with 25 μg of uridine per ml at 30°C to OD600 = 0.6. Total solubilized protein was resolved by 2D gel electrophoresis and subjected to proteomic analysis. Proteins were identified by MALDI-TOF mass spectrometry and interrogation of the CandidaDB database.

DISCUSSION

We show that the chromosomal location of URA3 has a significant impact on its expression, the resulting specific activity of the gene product, the cellular proteome, and consequently the virulence of C. albicans. The Ura-blaster approach to disruption of diploid genes is highly effective as a molecular tool, but phenotypic alterations recorded in mutants created by Ura-blasting cannot be reliably attributed to the target gene unless care is taken to ensure that the mutant expresses adequate levels of Ura3p. Ectopic expression of URA3 from within a disrupted gene cannot be depended on to provide adequate Ura3p levels, presumably because of positional effects of the target locus on URA3 gene expression. Only by specific insertion of the marker gene at a common genomic locus in different strains can a scientifically comparable set of parents and mutants be created. Sundstrom and her colleagues have recommended (81) and implemented (4, 5) specific insertion of the URA3 gene at the ENO1 locus as a means of circumventing positional effects on URA3 expression. Our own preference is for placement of URA3 at the RPS10 locus, since the plasmid CIp10 makes the necessary transformation technically very simple and we have confirmed that this locus enables near-normal levels of gene expression to occur.

One area of study in which the difficulties associated with ectopic expression of URA3 may have greatly affected the outcome of experiments is in the delineation of molecular virulence factors in C. albicans. At least 70 C. albicans genes (Table 7) have been implicated in virulence on the basis of evidence of attenuation in the mouse i.v. challenge model for Ura-blasted homozygous null mutants. However, in the majority of these animal studies, URA3 was expressed from within the locus of the disrupted gene (Table 7). We show a dramatic example of this, where attenuated virulence in C. albicans was attributable to decreased URA3 expression rather than disruption of the GCN4 locus (Fig. 2, compare NGY152 [wild type], GTC43 [gcn4Δ] and GTC45 [gcn4Δ/CIp10]). Our evidence supporting a role for Gcn4p in virulence satisfies the molecular Koch's postulates. However, the virulence of the mutant containing only URA3 reintegrated at the RPS10 locus proves that the attenuated phenotype in the homozygous null mutant was the result of ectopic expression of URA3 and not of deletion of GCN4 (Fig. 2, compare NGY152 [wild type], GTC45 [gcn4Δ/CIp10], and GTC49 [gcn4Δ/CIp10-GCN4]). We have similar data for two other C. albicans loci (unpublished data). It seems likely that many of the attenuated virulence phenotypes attributed to particular genes in the studies listed in Table 7 may also have resulted from (inadequate) ectopic expression of URA3, and hence these virulence phenotypes require reexamination. In some of the instances tabulated, the evidence for a virulence role of the gene concerned has been confirmed in experiments not dependent on the ectopic expression of URA3, including reintegration of a disrupted gene without altering the ectopic locus of URA3 (11), but there remain many examples where this is not the case. Based on the analysis of the number of strains in which Ura3p specific activities were below 40% of that found when the URA3 was at the native locus and which were significantly attenuated as measured by mean survival time or kidney burdens (Fig. 3), we estimate that the virulence of at least 30% of all mutants generated to date may have to be formally reassessed after correction for ectopic URA3 expression. Of the 73 genes for which attenuated virulence has been associated with specific disruptions (Table 7), at least 60 were tested in experiments where URA3 was expressed ectopically. Our data suggest that more than 20 of these genes may have been incorrectly designated virulence factors in C. albicans.

TABLE 7.

Publications on C. albicans describing attenuated virulence related to specific gene disruptions

Gene Function Locus containing URA3a Reference(s)
AAF1 Unknown function AAF1 66
ADE2 Phosphoribosylaminoimidazole carboxylase ADE2 27
ALO1 d-Arabinono-1,4-lactone oxidase ALO1 36
ALS1 Surface adhesin ALS1 29
ASH1 Transcription factor ASH1 39
BGL2 (1-3) β-Glucosyltransferase BGL2 71
CAP1 Adenyl cyclase regulator eno::URA3 4, 5
CAT1 Catalase CAT1 91
CDC10 Septin ARG4 88
CDC11 Septin ARG4 88
CDC24 GDP:GTP exchange factor RPS10 8
CDC35 Adenyl cyclase regulator part of plasmid pVEC 67
CDC42 G protein (GTPase) RPS10 8
CHS1 Chitin synthase CHS1 under mal promoter 58
CHS3 Chitin synthase CHS3 14, 58
CLA4 Ser/Thr protein kinase CLA4 50
CNA Calcineurin A CNA 70
CNB1 Calcineurin B CNB1 11
COS1 Histidine kinase COS1? 75
CPP1 Protein phosphatase CPP1 20
CRK1 Cdc2 kinase CRK1 18
CSP37 37-kDa surface protein CSP37 76
CST20 MEKK kinase CST20 49
EFG1 Transcription factor EFG1 52
FAS2 Fatty acid synthase FAS2 98
FTR1 High-affinity iron permease FTR1 64
GNA1 Glucosamine-6-phosphate acetyltransferase GNA1 56
GP17 Transcription factor GP17 65
HEM3 Uroporphyrin I synthase URA3 44
HK1 Histidine kinase HK1 17, 93
HOG1 Mitogen-activated protein kinase MKC1 2
HWP1 Transglutaminase HWP1, ENO1 21, 80, 82, 85
ICL1 Isocitrate lyase ICL1 53
INT1 Surface protein INT1 10, 30
KEX2 Kexin (subtilase) KEX2 62
LIG4 DNA ligase LIG4 3
MAD2 Spindle assembly factor MAD2 6
MDR1 Membrane efflux pump MDR1 9
MKC1 Mitogen-activated protein kinase MKC1 26
MNT1 α-1,2-Mannosyl transferase MNT1 15
NAG1 N-Acetylglucosamine-6-phosphate deaminase NAG1 77, 94
NAG2 N-Acetylglucosamine phosphate deacetylase NAG2 94
NAG6 N-Acetylglucosamine kinase NAG6 94
NIK1 Histidine kinase NIK1 93
NMT1 N-Myristoyl transferase NMT1 89
NRG1 Transcriptional repressor NRG1 60
PHR1 pH-regulated expression PHR1 24, 32
PLB1 Phospholipase B PLB1 51, 57
PMT1 Protein O mannosylation PMT1 83
RAS1 Regulates gene expression Part of plasmid pVEC 49
RBT1 Hypha-specific wall protein RBT1 12
RBT4 Unknown function RBT4 12
RFG1 Transcription factor RFG1 42
RIM101 Transcription factor NotI-digested pRS-ARG-URA-BN 23
RIM8 Transcription factor NotI-digested pRS-ARG-URA-BN 23
RSR1 GTPase RSR1 92
SAP1 Aspartyl proteinase SAP1 35
SAP2 Aspartyl proteinase SAP2 35
SAP3 Aspartyl proteinase SAP3 35
SAP4-6 Aspartyl proteinases SAP5 69
SLN1 Histidine kinase SLN1 93
SOD1 Cu/Zn superoxide dismutase SOD1 38
SPT3 Transcriptional activator SPT3 47
SSK1 Two-component response regulator SSK1 16
SSN6 Transcriptional corepressor SSN6 37
TEC1 Hyphal transcription factor Part of plasmid pVEC 74
TOP1 Topoisomerase Upstream of TOP1, part of inducible promoter construct 41
TPK2 Protein kinase A subunit TPK2 79
TPS1 Trehalose phosphate synthase TPS1 97
TPS2 Trehalose phosphate phosphatase TPS2 86
TUP1 Transcription regulator TUP1 60
URA3 Nucleotide synthesis 44
VPS34 Phosphoinositol-3-kinase VPS34 13
a

The URA3 position in the mutants is indicated according to the information published.

Ura3p enzyme activities correlated well with URA3 mRNA levels in C. albicans mutants. Our results relating relative OMP decarboxylase activity with mean survival time (Fig. 3) are consistent with those of Lay et al. (48). However, any relationship between the enzyme activity and virulence can be interpreted only for mutants in the C. albicans SC5314 lineage. The existence of naturally attenuated wild-type strains with normal levels of OMP decarboxylase shows that a virulence phenotype (as measured by mouse mean survival times) is polygenic. Our experiments with an isogenic set of mutants have allowed us to determine specifically the influence of URA3 expression on virulence. We interpret the data in Fig. 3 as indicating that a minimum necessary level of OMP decarboxylase activity (URA3 expression) of around 40% of wild-type (SC5314) levels is required for an SC5314-derived mutant used in a mouse virulence assay.

Iron uptake is thought to be important for the growth and survival of a pathogen such as C. albicans (64). Hence, the fact that the disruption of URA3 in CAI-4 also removed a portion of the IRO1 locus (31) could be argued as another cause of the phenotypic changes that we and others have attributed to URA3 underexpression. However, we could reestablish wild-type virulence in our homozygous gcn4 and mnn4 mutants by reintegrating URA3 alone at the RPS10 locus. Proteomic analysis showed that changes in the expression of only one protein appeared to be URA3 independent, suggesting that its lowered expression in CAI-4 and NGY152 was related to the truncation of IRO1. Taken together, these data strongly suggest that URA3 and not IRO1 is the more important regulator of phenotype, at least for the mouse lethality phenotype.

Our proteomic data (Table 6) show that the expression of 13 proteins is altered in CAI-4 in a URA3-dependent manner, because reintegration of a single copy of URA3 at the RPS10 locus either partially or fully restored expression levels to those of SC5314. While some of the proteins that are collaterally affected by URA3 deletion are obviously related to purine and pyrimidine metabolism (Hpt1p, Ade2p, and Ura5p), others are not. These findings further reinforce the main conclusion of this study and its predecessors, where phenotypic effects resulting from URA3 disruption were demonstrated (7, 19, 48, 81, 82). Namely, the use of auxotrophic selectable markers can result in misleading phenotypes that arise from unpredicted collateral effects on cell metabolism and physiology.

Acknowledgments

We thank the COGEME Proteome Research Facility 1, and especially Janet Walker, Laura Selway, David Stead, and Zhikang Yin, for help with the proteomics. We thank Richard Hobson, Bernhard Hube, Gwyneth Bertram, and Gyanendra Tripathi for providing strains used in the study. We gratefully acknowledge the skilled technical assistance of Louise Walker and Michelle Cunningham.

We thank the Wellcome Trust (grants 063204 and 072263), the MRC, the British Society for Antimicrobial Chemotherapy (grant PG1), and the BBSRC (grants 34/IGF13036, 1G18883, and P10256) for financial support of the work of our group.

REFERENCES

  • 1.Alani, E., and N. Kleckner. 1987. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116:541-545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Alonso-Monge, R., F. Navarro-Garcia, G. Molero, R. Diez-Orejas, M. Gustin, J. Pla, M. Sanchez, and C. Nombela. 1999. Role of the mitogen-activated protein kinase Hog1p in morphogenesis and virulence of Candida albicans. J. Bacteriol. 181:3058-3068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Andaluz, E. 2001. Phenotypic analysis and virulence of Candida albicans LIG4 mutants. Infect. Immun. 69:137-147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bahn, Y. S., and P. Sundstrom. 2001. CAP1, an adenylate cyclase-associated protein gene, regulates bud-hypha transitions, filamentous growth, and cyclic AMP levels and is required for virulence of Candida albicans. J. Bacteriol. 183:3211-3223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bahn, Y. S., J. Staab, and P. Sundstrom. 2003. Increased high-affinity phosphodiesterase PDE2 gene expression in germ tubes counteracts CAP1-dependent synthesis of cyclic AMP, limits hypha production and promotes virulence of Candida albicans. Mol. Microbiol. 50:391-409. [DOI] [PubMed] [Google Scholar]
  • 6.Bai, C., N. Ramanan, Y. M. Wang, and Y. Wang. 2002. Spindle assembly checkpoint component CaMad2p is indispensable for Candida albicans survival and virulence in mice. Mol. Microbiol. 45:31-44. [DOI] [PubMed] [Google Scholar]
  • 7.Bain, J. M., C. Stubberfield, and N. A. R. Gow. 2001. Ura-status-dependent adhesion of Candida albicans mutants. FEMS Microbiol. Lett. 204:323-328. [DOI] [PubMed] [Google Scholar]
  • 8.Bassilana, M., J. Blyth, and R. A. Arkowitz. 2003. Cdc24, the GDP-GTP exchange factor for Cdc42, is required for invasive hyphal growth of Candida albicans. FEMS Microbiol. Lett. 2:9-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Becker, J. M., L. K. Henry, W. D. Jiang, and Y. Koltin. 1995. Reduced virulence of Candida albicans mutants affected in multidrug resistance. Infect. Immun. 63:4515-4518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bendel, C. M., K. M. Kinneberg, R. P. Jechorek, C. A. Gale, S. L. Erlandsen, M. K. Hostetter, and C. L. Wells. 1999. Systemic infection following intravenous inoculation of mice with Candida albicans int1 mutant strains. Mol. Genet. Metab. 67:343-351. [DOI] [PubMed] [Google Scholar]
  • 11.Blankenship, J. R., F. L. Wormley, M. K. Boyce, W. A. Schell, S. G. Filler, J. R. Perfect, and J. Heitman. 2003. Calcineurin is essential for Candida albicans survival in serum and virulence. Eukaryot. Cell. 2:422-430. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Braun, B. R., W. S. Head, M. X. Wang, and A. D. Johnson. 2000. Identification and characterization of TUP1-regulated genes in Candida albicans. Genetics 156:31-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bruckmann, A., W. Kunkel, A. Hartl, R. Wetzker, and R. Eck. 2000. A phosphatidylinositol 3-kinase of Candida albicans influences adhesion, filamentous growth and virulence. Microbiology 146:2755-2764. [DOI] [PubMed] [Google Scholar]
  • 14.Bulawa, C. E., D. W. Miller, L. K. Henry, and J. M. Becker. 1995. Attenuated virulence of chitin-deficient mutants of Candida albicans. Proc. Natl. Acad. Sci. USA 92:10570-10574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Buurman, E. T., C. Westwater, B. Hube, A. J. P. Brown, F. C. Odds, and N. A. R. Gow. 1998. Molecular analysis of CaMnt1p, a mannosyl transferase important for adhesion and virulence of Candida albicans. Proc. Natl. Acad. Sci. USA 95:7670-7675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Calera, J. A., X. J. Zhao, and R. Calderone. 2000. Defective hyphal development and avirulence caused by a deletion of the SSK1 response regulator gene in Candida albicans. Infect. Immun. 68:518-525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Calera, J. A., X. J. Zhao, F. De Bernardis, M. Sheridan, and R. Calderone. 1999. Avirulence of Candida albicans CaHK1 mutants in a murine model of hematogenously disseminated candidiasis. Infect. Immun. 67:4280-4284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chen, J. Y., S. Zhou, Q. Wang, X. Chen, T. Pan, and H. P. Liu. 2000. Crk1, a novel Cdc2-related protein kinase, is required for hyphal development and virulence in Candida albicans. Mol. Cell. Biol. 20:8696-8708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Cheng, S. J., M. H. Nguyen, Z. D. Zhang, H. Y. Jia, M. Handfield, and C. J. Clancy. 2003. Evaluation of the roles of four Candida albicans genes in virulence by using gene disruption strains that express URA3 from the native locus. Infect. Immun. 71:6101-6103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Csank, C., C. Makris, S. Meloche, K. Schroppel, M. Rollinghoff, D. Dignard, D. Y. Thomas, and M. Whiteway. 1997. Derepressed hyphal growth and reduced virulence in a vh1 family-related protein phosphatase mutant of the human pathogen Candida albicans. Mol. Biol. Cell 8:2539-2551. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Daniels, K. J., S. R. Lockhart, J. F. Staab, P. Sundstrom, and D. R. Soll. 2003. The adhesin Hwp1 and the first daughter cell localize to the a/a portion of the conjugation bridge during Candida albicans mating. Mol. Biol. Cell 14:4920-4930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Das, A. K., P. T. W. Cohen, and D. Barford. 1998. The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J. 17:1192-1199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Davis, D., J. E. Edwards, A. P. Mitchell, and A. S. Ibrahim. 2000. Candida albicans RIM101 pH response pathway is required for host-pathogen interactions. Infect. Immun. 68:5953-5959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.De Bernardis, F., F. A. Muhlschlegel, A. Cassone, and W. A. Fonzi. 1998. The pH of the host niche controls gene expression in and virulence of Candida albicans. Infect. Immun. 66:3317-3325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.de Montigny, J., A. Belarbi, J. C. Hubert, and F. Lacroute. 1989. Structure and expression of the URA5 gene of Saccharomyces cerevisiae. Mol. Gen. Genet. 215:455-462. [DOI] [PubMed] [Google Scholar]
  • 26.Diez-Orejas, R., G. Molero, F. Navarro-Garcia, J. Pla, C. Nombela, and M. Sanchez-Perez. 1997. Reduced virulence of Candida albicans MKC1 mutants: a role for mitogen-activated protein kinase in pathogenesis. Infect. Immun. 65:833-837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Donovan, M., J. J. Schumuke, W. A. Fonzi, S. L. Bonar, K. Gheesling-Mullis, G. S. Jacob, V. J. Davisson, and S. B. Dotson. 2001. Virulence of a phosphoribosylaminoimidazole carboxylase-deficient Candida albicans strain in an immunosuppressed murine model of systemic candidiasis. Infect. Immun. 69:2542-2548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Fonzi, W., and M. Irwin. 1993. Isogenic strain construction and gene mapping in Candida albicans. Genetics 134:717-728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Fu, Y., A. S. Ibrahim, D. C. Sheppard, Y. C. Chen, S. W. French, J. E. Cutler, S. G. Filler, and J. E. Edwards. 2002. Candida albicans Als1p: an adhesin that is a downstream effector of the EFG1 filamentation pathway. Mol. Microbiol. 44:61-72. [DOI] [PubMed] [Google Scholar]
  • 30.Gale, C. A., C. M. Bendel, M. Mcclellan, M. Hauser, J. M. Becker, J. Berman, and M. K. Hostetter. 1998. Linkage of adhesion, filamentous growth, and virulence in Candida albicans to a single gene, INT1. Science 279:1355-1358. [DOI] [PubMed] [Google Scholar]
  • 31.Garcia, M. G., J. E. O'Connor, L. L. Garcia, S. I. Martinez, E. Herrero, and L. D. Agudo. 2001. Isolation of a Candida albicans gene, tightly linked to URA3, coding for a putative transcription factor that suppresses a Saccharomyces cerevisiae AFT1 mutation. Yeast 18:301-311. [DOI] [PubMed] [Google Scholar]
  • 32.Ghannoum, M. A., B. Spellberg, S. M. Saporito-Irwin, and W. A. Fonzi. 1995. Reduced virulence of Candida albicans PHR1 mutants. Infect. Immun. 63:4528-4530. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gillum, A. M., E. Y. H. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by complementation of S. cerevisiae URA3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179-182. [DOI] [PubMed] [Google Scholar]
  • 34.Guetsova, M. L., K. Lecoq, and B. Daignan-Fornier. 1997. The isolation and characterization of Saccharomyces cerevisiae mutants that constitutively express purine biosynthetic genes. Genetics 147:383-397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Hube, B., D. Sanglard, F. C. Odds, D. Hess, M. Monod, W. Schafer, A. J. P. Brown, and N. A. R. Gow. 1997. Disruption of each of the secreted aspartyl proteinase genes SAP1, SAP2, and SAP3 of Candida albicans attenuates virulence. Infect. Immun. 65:3529-3538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Huh, W. K., S. T. Kim, H. Kim, G. Jeong, and S. O. Kang. 2001. Deficiency of D-erythroascorbic acid attenuates hyphal growth and virulence of Candida albicans. Infect. Immun. 69:3939-3946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hwang, C. S., J. H. Oh, W. K. Huh, H. S. Yim, and S. O. Kang. 2003. SSN6, an important factor of morphological conversion and virulence in Candida albicans. Mol. Microbiol. 47:1029-1043. [DOI] [PubMed] [Google Scholar]
  • 38.Hwang, C. S., G. E. Rhie, J. H. Oh, W. K. Huh, H. S. Yim, and S. O. Kang. 2002. Copper- and zinc-containing superoxide dismutase (Cu/ZnSOD) is required for the protection of Candida albicans against oxidative stresses and the expression of its full virulence. Microbiology 148:3705-3713. [DOI] [PubMed] [Google Scholar]
  • 39.Inglis, D. O., and A. D. Johnson. 2002. Ash1 protein, an asymmetrically localized transcriptional regulator, controls filamentous growth and virulence of Candida albicans. Mol. Cell. Biol. 22:8669-8680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Iraqui, I., S. Vissers, M. Cartiaux, and A. Urrestarazu. 1998. Characterisation of Saccharomyces cerevisiae ARO8 and ARO9 genes encoding aromatic aminotransferases I and II reveals a new aminotransferase subfamily. Mol. Gen. Genet. 257:238-248. [DOI] [PubMed] [Google Scholar]
  • 41.Jiang, W. D., D. Gerhold, E. B. Kmiec, M. Hauser, J. M. Becker, and Y. Koltin. 1997. The topoisomerase I gene from Candida albicans. Microbiology 143:377-386. [DOI] [PubMed] [Google Scholar]
  • 42.Kadosh, D., and A. D. Johnson. 2001. RFG1, a protein related to the Saccharomyces cerevisiae hypoxic regulator ROX1, controls filamentous growth and virulence in Candida albicans. Mol. Cell. Biol. 21:2496-2505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kang, J. J., D. T. Auble, J. A. Ranish, and S. Hahn. 1995. Analysis of the yeast transcription factor TFIIA: distinct functional regions and a polymerase II-specific role in basal and activated transcription. Mol. Cell. Biol. 15:1234-1243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Kirsch, D. R., and R. R. Whitney. 1991. Pathogenicity of Candida albicans auxotrophic mutants in experimental infections. Infect. Immun. 59:3297-3300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kordes, E., L. Savelyeva, M. Schwab, J. Rommelaere, J. C. Jauniaux, and C. Cziepluch. 1998. Isolation and characterization of human SGT and identification of homologues in Saccharomyces cerevisiae and Caenorhabditis elegans. Genomics 52:90-94. [DOI] [PubMed] [Google Scholar]
  • 46.Kurita, O., and Y. Nishida. 1999. Involvement of mitochondrial aldehyde dehydrogenase ALD5 in maintenance of the mitochondrial electron transport chain in Saccharomyces cerevisiae. FEMS Microbiol. Lett. 181:281-287. [DOI] [PubMed] [Google Scholar]
  • 47.Laprade, L., V. L. Boyartchuk, W. F. Dietrich, and F. Winston. 2002. SPT3 plays opposite roles in filamentous growth in Saccharomyces cerevisiae and Candida albicans and is required for C. albicans virulence. Genetics 161:509-519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Lay, J., L. K. Henry, J. Clifford, Y. Koltin, C. E. Bulawa, and J. M. Becker. 1998. Altered expression of selectable marker URA3 in gene-disrupted Candida albicans strains complicates interpretation of virulence studies. Infect. Immun. 66:5301-5306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Leberer, E., D. Harcus, D. Dignard, L. Johnson, S. Ushinsky, D. Y. Thomas, and K. Schroppel. 2001. Ras links cellular morphogenesis to virulence by regulation of the MAP kinase and cAMP signalling pathways in the pathogenic fungus Candida albicans. Mol. Microbiol. 42:673-687. [DOI] [PubMed] [Google Scholar]
  • 50.Leberer, E., K. Ziegelbauer, A. Schmidt, D. Harcus, D. Dignard, J. Ash, L. Johnson, and D. Y. Thomas. 1997. Virulence and hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p. Curr. Biol. 7:539-546. [DOI] [PubMed] [Google Scholar]
  • 51.Leidich, S. D., A. S. Ibrahim, Y. Fu, A. Koul, C. Jessup, J. Vitullo, W. Fonzi, F. Mirbod, S. Nakashima, Y. Nozawa, and M. A. Ghannoum. 1998. Cloning and disruption of Caplb1, a phospholipase B gene involved in the pathogenicity of Candida albicans. J. Biol. Chem. 273:26078-26086. [DOI] [PubMed] [Google Scholar]
  • 52.Lo, H. J., J. R. Köhler, D. Di, D. Loebenberg, A. Cacciapuoti, and G. R. Fink. 1997. Nonfilamentous C. albicans mutants are avirulent. Cell 90:939-949. [DOI] [PubMed] [Google Scholar]
  • 53.Lorenz, M. C., and G. R. Fink. 2001. The glyoxylate cycle is required for fungal virulence. Nature 412:83-86. [DOI] [PubMed] [Google Scholar]
  • 54.Maneu, V., A. M. Cervera, J. P. Martinez, and D. Gozalbo. 1996. Molecular cloning and characterization of a Candida albicans gene (EFB1) coding for the elongation factor EF-1-beta. FEMS Microbiol. Lett. 145:157-162. [DOI] [PubMed] [Google Scholar]
  • 55.Mendoza, A., M. J. Serramia, L. Capa, and J. F. Garcia-Bustos. 1999. Translation elongation factor 2 is encoded by a single essential gene in Candida albicans. Gene 229:183-191. [DOI] [PubMed] [Google Scholar]
  • 56.Mio, T., M. Kokado, M. Arisawa, and H. Yamada-Okabe. 2000. Reduced virulence of Candida albicans mutants lacking the GNA1 gene encoding glucosamine-6-phosphate acetyltransferase. Microbiology 146:1753-1758. [DOI] [PubMed] [Google Scholar]
  • 57.Mukherjee, P. K., K. R. Seshan, S. D. Leidich, J. Chandra, G. T. Cole, and M. A. Ghannoum. 2001. Reintroduction of the PLB1 gene into Candida albicans restores virulence in vivo. Microbiology 147:2585-2597. [DOI] [PubMed] [Google Scholar]
  • 58.Munro, C. A., K. Winter, A. Buchan, K. Henry, J. M. Becker, A. J. P. Brown, C. E. Bulawa, and N. A. R. Gow. 2001. CHS1 of Candida albicans is an essential chitin synthase required for synthesis of the septum and for cell integrity. Mol. Microbiol. 39:1414-1426. [DOI] [PubMed] [Google Scholar]
  • 59.Murad, A. M. A., P. R. Lee, I. D. Broadbent, C. J. Barelle, and A. J. P. Brown. 2000. CIp10, an efficient and convenient integrating vector for Candida albicans. Yeast 16:325-327. [DOI] [PubMed] [Google Scholar]
  • 60.Murad, A. M. A., P. Leng, M. Straffon, J. Wishart, S. Macaskill, D. MacCallum, N. Schnell, D. Talibi, D. Marechal, F. Tekaia, C. d'Enfert, C. Gaillardin, F. C. Odds, and A. J. P. Brown. 2001. NRG1 represses yeast-hypha morphogenesis and hypha-specific gene expression in Candida albicans. EMBO J. 20:4742-4752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Navarro-Garcia, F., M. Sanchez, C. Nombela, and J. Pla. 2001. Virulence genes in the pathogenic yeast Candida albicans. FEMS Microbiol. Rev. 25:245-268. [DOI] [PubMed] [Google Scholar]
  • 62.Newport, G., A. Kuo, A. Flattery, C. Gill, J. J. Blake, M. B. Kurtz, G. K. Abruzzo, and N. Agabian. 2003. Inactivation of Kex2p diminishes the virulence of Candida albicans. J. Biol. Chem. 278:1713-1720. [DOI] [PubMed] [Google Scholar]
  • 63.Planta, R. J., and W. H. Mager. 1998. The list of cytoplasmic ribosomal proteins of Saccharomyces cerevisiae. Yeast 14:471-477. [DOI] [PubMed] [Google Scholar]
  • 64.Ramanan, N., and Y. Wang. 2000. A high-affinity iron permease essential for Candida albicans virulence. Science 288:1062-1064. [DOI] [PubMed] [Google Scholar]
  • 65.Richard, M., S. Ibata-Ombetta, F. Dromer, F. Bordon-Pallier, T. Jouault, and C. Gaillardin. 2002. Complete glycosylphosphatidylinositol anchors are required in Candida albicans for full morphogenesis, virulence and resistance to macrophages. Mol. Microbiol. 44:841-853. [DOI] [PubMed] [Google Scholar]
  • 66.Rieg, G., Y. Fu, A. S. Ibrahim, X. Zhou, S. G. Filler, and J. E. Edwards. 1999. Unanticipated heterogeneity in growth rate and virulence among Candida albicans AAF1 null mutants. Infect. Immun. 67:3193-3198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Rocha, C. R. C., K. Schroppel, D. Harcus, A. Marcil, D. Dignard, B. N. Taylor, D. Y. Thomas, M. Whiteway, and E. Leberer. 2001. Signaling through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic fungus Candida albicans. Mol. Biol. Cell 12:3631-3643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Rogers, P. D., and K. S. Barker. 2002. Evaluation of differential gene expression in fluconazole-susceptible and -resistant isolates of Candida albicans by cDNA microarray analysis. Antimicrob. Agents Chemother. 46:3412-3417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Sanglard, D., B. Hube, M. Monod, F. C. Odds, and N. A. R. Gow. 1997. A triple deletion of the secreted aspartyl proteinase genes SAP4, SAP5, and SAP6 of Candida albicans causes attenuated virulence. Infect. Immun. 65:3539-3546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Sanglard, D., F. Ischer, O. Marchetti, J. Entenza, and J. Bille. 2003. Calcineurin A of Candida albicans: involvement in antifungal tolerance, cell morphogenesis and virulence. Mol. Microbiol. 48:959-976. [DOI] [PubMed] [Google Scholar]
  • 71.Sarthy, A. V., T. Mcgonigal, M. Coen, D. J. Frost, J. A. Meulbroek, and R. C. Goldman. 1997. Phenotype in Candida albicans of a disruption of the BGL2 gene encoding a 1,3-β-glucosyltransferase. Microbiology 143:367-376. [DOI] [PubMed] [Google Scholar]
  • 72.Schaller, M., W. Schafer, H. C. Korting, and B. Hube. 1998. Differential expression of secreted aspartyl proteinases in a model of human oral candidosis and in patient samples from the oral cavity. Mol. Microbiol. 29:605-615. [DOI] [PubMed] [Google Scholar]
  • 73.Schmuke, J. J., V. J. Davisson, S. L. Bonar, K. Gheesling Mullis, and S. B. Dotson. 1997. Sequence analysis of the Candida albicans ADE2 gene and physical separation of the two functionally distinct domains of the phosphoribosylaminoimidazole carboxylase. Yeast 13:769-776. [DOI] [PubMed] [Google Scholar]
  • 74.Schweizer, A., S. Rupp, B. N. Taylor, M. Rollinghoff, and K. Schroppel. 2000. The TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence in Candida albicans. Mol. Microbiol. 38:435-445. [DOI] [PubMed] [Google Scholar]
  • 75.Selitrennikoff, C. P., L. Alex, T. K. Miller, K. V. Clemons, M. I. Simon, and D. A. Stevens. 2001. COS-I, a putative two-component histidine kinase of Candida albicans, is an in vivo virulence factor. Med. Mycol. 39:69-74. [DOI] [PubMed] [Google Scholar]
  • 76.Sentandreu, M., A. Nieto, A. Iborra, M. V. Elorza, J. Ponton, W. A. Fonzi, and R. Sentandreu. 1997. Cloning and characterization of CSP37, a novel gene encoding a putative membrane protein of Candida albicans. J. Bacteriol. 179:4654-4663. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Singh, P., S. Ghosh, and A. Datta. 2001. Attenuation of virulence and changes in morphology in Candida albicans by disruption of the N-acetylglucosamine catabolic pathway. Infect. Immun. 69:7898-7903. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Smith, D. J., M. Cooper, M. Detiani, C. Losberger, and M. A. Payton. 1992. The Candida albicans PMM1 gene encoding phosphomannomutase complements a Saccharomyces cerevisiae-SEC 53-6 mutation. Curr. Genet. 22:501-503. [DOI] [PubMed] [Google Scholar]
  • 79.Sonneborn, A., D. P. Bockmuhl, M. Gerads, K. Kurpanek, D. Sanglard, and J. F. Ernst. 2000. Protein kinase A encoded by TPK2 regulates dimorphism of Candida albicans. Mol. Microbiol. 35:386-396. [DOI] [PubMed] [Google Scholar]
  • 80.Staab, J. F., S. D. Bradway, P. L. Fidel, and P. Sundstrom. 1999. Adhesive and mammalian transglutaminase substrate properties of Candida albicans HWP1. Science 283:1535-1538. [DOI] [PubMed] [Google Scholar]
  • 81.Staab, J. F., and P. Sundstrom. 2003. URA3 as a selectable marker for disruption and virulence assessment of Candida albicans genes. Trends Microbiol. 11:69-73. [DOI] [PubMed] [Google Scholar]
  • 82.Sundstrom, P., J. E. Cutler, and J. F. Staab. 2002. Reevaluation of the role of HWP1 in systemic candidiasis by use of Candida albicans strains with selectable marker URA3 targeted to the ENO1 locus. Infect. Immun. 70:3281-3283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Timpel, C., S. Strahlbolsinger, K. Ziegelbauer, and J. F. Ernst. 1998. Multiple functions of pmt1p-mediated protein O-mannosylation in the fungal pathogen Candida albicans. J. Biol. Chem. 273:20837-20846. [DOI] [PubMed] [Google Scholar]
  • 84.Tripathi, G., C. Wiltshire, S. Macaskill, H. Tournu, S. Budge, and A. J. P. Brown. 2002. Gcn4 co-ordinates morphogenetic and metabolic responses to amino acid starvation in Candida albicans. EMBO J. 21:5448-5456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85.Tsuchimori, N., L. L. Sharkey, W. A. Fonzi, S. W. French, J. E. Edwards, and S. G. Filler. 2000. Reduced virulence of HWP1-deficient mutants of Candida albicans and their interactions with host cells. Infect. Immun. 68:1997-2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 86.Van Dijck, P., L. De Rop, K. Szlufcik, E. Van Ael, and J. M. Thevelein. 2002. Disruption of the Candida albicans TPS2 gene encoding trehalose-6-phosphate phosphatase decreases infectivity without affecting hypha formation. Infect. Immun. 70:1772-1782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.Vuralhan, Z., M. A. Morais, S.-L. Tai, M. D. W. Piper, and J. T. Pronk. 2003. Identification and characterisation of phenylpyruvate decarboxylase genes in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 69:4534-4541. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Warenda, A. J., S. Kauffman, T. P. Sherrill, J. A. Becker, and J. B. Konopka. 2003. Candida albicans septin mutants are defective for invasive growth and virulence. Infect. Immun. 71:4045-4051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 89.Weinberg, R. A., C. A. McWherter, S. K. Freeman, D. C. Wood, J. I. Gordon, and S. C. Lee. 1995. Genetic studies reveal that myristoyl CoA:protein N-myristoyltransferase is an essential enzyme in Candida albicans. Mol. Microbiol. 16:241-250. [DOI] [PubMed] [Google Scholar]
  • 90.Wilson, R. B., D. Davis, and A. P. Mitchell. 1999. Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions. J. Bacteriol. 181:1868-1874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Wysong, D. R., L. Christin, A. M. Sugar, P. W. Robbins, and R. D. Diamond. 1998. Cloning and sequencing of a Candida albicans catalase gene and effects of disruption of this gene. Infect. Immun. 66:1953-1961. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Yaar, L., M. Mevarech, and Y. Koltin. 1997. A Candida albicans Ras-related gene (CaRSR1) is involved in budding, cell morphogenesis and hypha development. Microbiology 143:3033-3044. [DOI] [PubMed] [Google Scholar]
  • 93.Yamada-Okabe, T., T. Mio, N. Ono, Y. Kashima, M. Matsui, M. Arisawa, and H. Yamada-Okabe. 1999. Roles of three histidine kinase genes in hyphal development and virulence of the pathogenic fungus Candida albicans. J. Bacteriol. 181:7243-7247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 94.Yamada-Okabe, T., and H. Yamada-Okabe. 2002. Characterization of the CaNAG3, CaNAG4, and CaNAG6 genes of the pathogenic fungus Candida albicans: possible involvement of these genes in the susceptibilities of cytotoxic agents. FEMS Microbiol. Lett. 212:15-21. [DOI] [PubMed] [Google Scholar]
  • 95.Yashimoto, A., K. Umezu, K. Kobayashi, and K. Tomita. 1978. Orotidylate decarboxylase (yeast). Methods Enzymol. 51:74-79. [DOI] [PubMed] [Google Scholar]
  • 96.Zagorec, M., J.-M. Buhler, I. Treich, T. Keng, L. Guarente, and R. Labbe-Bois. 1988. Isolation, sequence and regulation by oxygen of the yeast HEM13 gene coding for coproporphyrinogen oxidase. J. Biol. Chem. 263:9718-9724. [PubMed] [Google Scholar]
  • 97.Zaragoza, O., M. A. Blazquez, and C. Gancedo. 1998. Disruption of the Candida albicans TPS1 gene encoding trehalose-6-phosphate synthase impairs formation of hyphae and decreases infectivity. J. Bacteriol. 180:3809-3815. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Zhao, X. J., G. E. Mcelhaneyfeser, M. J. Sheridan, S. E. Broedel, and R. L. Cihlar. 1997. Avirulence of Candida albicans fas2 mutants in a mouse model of systemic candidiasis. Infect. Immun. 65:829-832. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Eukaryotic Cell are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES