Skip to main content
PMC home page
Toxicological Sciences logoLink to Toxicological Sciences
. 2016 Apr 27;152(1):205–213. doi: 10.1093/toxsci/kfw077

Detection of Drug-Induced Acute Kidney Injury in Humans Using Urinary KIM-1, miR-21, -200c, and -423

Mira Pavkovic *,‖,✉, Cassianne Robinson-Cohen †, Alicia S Chua ‡, Oana Nicoara §, Mariana Cárdenas-González *, Vanesa Bijol , Krithika Ramachandran ‖, Lucy Hampson ‖|, Munir Pirmohamed ‖|, Daniel J Antoine ‖|, Gyorgy Frendl ‖‖, Jonathan Himmelfarb †, Sushrut S Waikar ‖, Vishal S Vaidya *,‖,#,1
PMCID: PMC5009468  PMID: 27122240

Abstract

Drug-induced acute kidney injury (AKI) is often encountered in hospitalized patients. Although serum creatinine (SCr) is still routinely used for assessing AKI, it is known to be insensitive and nonspecific. Therefore, our objective was to evaluate kidney injury molecule 1 (KIM-1) in conjunction with microRNA (miR)-21, -200c, and -423 as urinary biomarkers for drug-induced AKI in humans. In a cross-sectional cohort of patients (n = 135) with acetaminophen (APAP) overdose, all 4 biomarkers were significantly (P < .004) higher not only in APAP-overdosed (OD) patients with AKI (based on SCr increase) but also in APAP-OD patients without clinical diagnosis of AKI compared with healthy volunteers. In a longitudinal cohort of patients with malignant mesothelioma receiving intraoperative cisplatin (Cp) therapy (n = 108) the 4 biomarkers increased significantly (P < .0014) over time after Cp administration, but could not be used to distinguish patients with or without AKI. Evidence for human proximal tubular epithelial cells (HPTECs) being the source of miRNAs in urine was obtained first, by in situ hybridization based confirmation of increase in miR-21 expression in the kidney sections of AKI patients and second, by increased levels of miR-21, -200c, and -423 in the medium of cultured HPTECs treated with Cp and 4-aminophenol (APAP degradation product). Target prediction analysis revealed 1102 mRNA targets of miR-21, -200c, and -423 that are associated with pathways perturbed in diverse pathological kidney conditions. In summary, we report noninvasive detection of AKI in humans by combining the sensitivity of KIM-1 along with mechanistic potentials of miR-21, -200c, and -423.

Keywords: nephrotoxicity in patients, biomarker, acute kidney injury, microRNAs, KIM-1

Acute kidney injury (AKI) affects 1 in 5 hospitalized patients worldwide (Susantitaphong et al., 2013). A substantial proportion of AKI is attributed to drug-induced kidney injury (DIKI): 18–27% in hospitalized individuals with AKI (Taber and Pasko, 2008; Uchino et al., 2005). Furthermore, nephrotoxicity is a common reason for drug development failure both in the preclinical and clinical stages. In clinical settings, AKI is assessed by measurement of functional biomarkers like serum creatinine (SCr) that is known to have low sensitivity, specificity, and limited capability for early diagnosis (Vaidya et al., 2008). A delayed diagnosis hinders not only timely care of AKI patients but also prevents stratification of AKI patients for clinical trials of AKI treatment; therefore, there is an urgent need for new kidney injury biomarkers with improved characteristics.

In 2008, 7 urinary protein biomarkers were amongst the first batch qualified by the U.S. Food and Drug Administration and European Medicines Agency (EMA, 2009) for the assessment of DIKI in preclinical studies. Although these biomarkers, like kidney injury molecule-1 (KIM-1), outperformed traditional biomarkers in sensitivity and specificity in preclinical studies, successful regulatory qualification and implementation into clinical practice are still awaited (Dieterle and Sistare, 2010; Jensen, 2004; Murray et al., 2014). Another class of biomarkers that have recently emerged as promising candidates for detection of diverse cancer types, organ damages and other disease states are extracellular microRNAs (miRNAs) found stable in diverse body fluids and resistant to RNase-mediated degradation, pH variability and multiple freeze-thaw cycles (McDonald et al., 2011; Mitchell et al., 2008; Mraz et al., 2009; Weber et al., 2010). MiRNAs are approximately 20–25 nucleotides long, non-coding and evolutionarily conserved small RNAs that function intracellularly as post-transcriptional regulators of gene expression by binding to complementary sequences in the 3'-untranslated regions of target mRNAs (Krol et al., 2010). Our group described the methodology and application for the use of urinary miRNAs to differentiate AKI patients from healthy individuals (Ramachandran et al., 2013; Saikumar et al., 2012). In particular, we found urinary levels of miR-21, -200c, and -423 exhibited significantly high sensitivity and specificity in differentiating AKI patients admitted in the intensive care unit vs. patients with no evidence of AKI (Ramachandran, et al., 2013).

The objective here was to evaluate the performance of KIM-1, miR-21, -200c, and -423 for detecting drug-induced AKI in humans. Specifically the aims were: (1) to measure urinary KIM-1, miR-21, -200c, and -423 in a cross-sectional cohort of patients (n = 135) with acetaminophen (APAP) overdose and in a longitudinal cohort of patients (n = 108) with malignant mesothelioma receiving cytoreductive surgery with intraoperative cisplatin (Cp) therapy; (2) to identify the source of the miRNAs by performing in situ hybridization in human kidney sections and by conducting in vitro experiments using HPTECs following toxicity; and (3) to computationally predict the targets for the 3 candidate miRNAs and highlight the possibility of urinary miRNA profiles to reflect pathological events in the kidney.

MATERIALS & METHODS

Patients and Samples

All participants were patients or healthy volunteers recruited at the Brigham and Women’s Hospital Boston, Massachusetts or at the MRC Centre for Drug Safety Science, University of Liverpool, UK. The Institutional Review Board of both institutions approved the protocols for recruitment and sample collection, which was performed with informed consent of the participants.

APAP cohort

Urine samples from healthy volunteers (n = 65) and a cross-sectional study of individuals with APAP-overdosed (OD; n = 70) were enrolled from the MRC Center for Drug Safety Science BIOPAR NHS portfolio study. Approximately 60% of the APAP-OD patients (n = 43) had AKI defined by SCr concentrations > 1 mg/dl.

Cp mesothelioma cohort

Urine samples were collected at the Brigham and Women’s Hospital as part of a longitudinal study enrolling patients with malignant mesothelioma undergoing cytoreductive surgery with intraoperative heated Cp chemotherapy (n = 108). Sampling was performed prior therapy (Pre) and on 9 subsequent time points: 4, 8, 12, 24, 48, 72, 96, 120, and 144 h. Approximately 40% of the patients developed AKI (AKI Stage 1, AKI Stages 2 and 3) defined by AKI Network criteria (Mehta et al., 2007) at any time point. From the 108 enrolled patients, 2 were excluded because of incomplete data sets.

Biopsy samples

Paraffin-embedded kidney tissue samples were obtained from Brigham and Women Hospital’s Pathology department. The biopsy was performed in patients to ascertain a clinical diagnosis of acute tubular necrosis (ATN) after allograft rejection (n = 3). For comparison, kidney biopsy samples diagnosed as within normal limits (n = 3) were also included.

Urine Collection and Analysis

Urine was collected from spontaneous voids or from indwelling Foley catheters followed by centrifugation at 3000×g for 10 min and microscopic examination of the urine sediment (Olympus microscope). The urine supernatant was aliquoted and frozen within 4 h of collection at −80°C. No additives or protease inhibitors were added. Urinary creatinine concentrations were measured utilizing the commercially available Creatinine (urinary) Colorimetric Assay from Cayman Chemical (Ann Arbor, Michigan). Using the Magnetic Luminex Performance Assay (Human Kidney Biomarker Base Kit in conjunction with the Human TIM-1/KIM-1/HAVCR Kit; R&D Systems, Minneapolis, Minnesota), KIM-1 was measured in 50 µl urine supernatant according to the manufacturer’s instructions on a Bio-plex 200 (Bio-Rad; Hercules, California). KIM-1 concentrations (pg/ml) were normalized to urinary creatinine (UCr; mg/dl) to account for dilution effects of the hydration status and are reported as urinary levels in pg/mg UCr.

In Vitro Experiments

HPTECs which are passaged cells derived from normal human kidney tissue were purchased from Biopredic International (Rennes, France). Previously, we have shown that HPTECs possess characteristics of differentiated epithelial cells, such as polar architecture, junctional assembly, expression and activity of transporters, ability to synthesize enzymes like glutathione, and γ-glutamyl transferase up to passage 4 (Adler, et al., 2016). Thus, we consider them to be not only primary cells but also better than the immortalized cells derived from human (HK2), dog (MDCK), and pig (LLCPK1) in terms of mimicking human kidney tubular epithelial structure and function. The cells were cultured in DMEM/Hams-F12 with GlutaMAX medium supplemented with 100 IU/ml penicillin, 100 µg/ml streptomycin, 36 ng/ml hydrocortisone, 10 ng/m epidermal growth factor, 1% insulin-transferrin-selenium, and 4 pg/ml triiodothyronin on collagen coated tissue culture plates at 37 °C in a humidified 5% CO2 incubator. Cp and 4-aminophenol (Sigma-Aldrich; St Louis, Missouri) were diluted in medium with 0.5% DMSO with final concentrations of 10–1000 μM for dose-response experiments in 96-well plates. After 24 h cell viability was measured by Cell-Titer Glow assays (Promega; Madison, Wisconsin) and dose-response curves were generated using GraphPad Prism 6 (GraphPad Software Inc.; La Jolla, California). Calculated LD50 values correspond to previously published for these compounds and cells (Adler et al., 2016). For measurement of miRNAs in medium and in the cells itself, HPTECs were seeded in 6-well plates and treated with 85 and 100 μM Cp and 4-aminophenol, concentrations selected based on previously published LD50 values. After 24 h of treatment, medium was removed, centrifuged twice (10 min 1600×g then 10 min 16 000×g) and the resulting supernatant as well as the corresponding cells were used for total RNA isolation.

RNA Isolation and Measurement of miRNAs

RNA isolation

Two hundred microliters of urinary supernatant was used for isolation with the miRNeasy Serum/Plasma Kit from Qiagen (Valencia, California ) according to manufacturer’s instructions. Total RNA form 200 μl medium supernatant and HPTECs was isolated with the miRNeasy Mini Kit (Qiagen). Quality and quantity of the cellular RNA war assessed photometrically using a NanoDrop 8000 (Thermo Scientific; Wilmington, Delaware).

Reverse transcription and preamplification

1.5 µl of the eluted RNA (urinary and medium supernatant) or 10 ng cellular RNA were revers transcribed into cDNA using Qiagen’s miScript RTII kit. The prepared cDNA was diluted 5-fold and 5 µl of the diluted cDNA was then preamplified with Qiagen’s miScript PreAMP kit for urinary and medium samples. The preamplified cDNA was diluted 5-fold prior to qPCR detection.

qPCR

For urine samples, candidate miRNA evaluation was performed using custom 384-well plates preloaded with specific primer probes for miR-21, -200c, and -423 from Qiagen. For medium and cellular miRNAs same assays were used. This SYBR Green-based qPCR was performed according to manufacturer’s instructions with 2 μl diluted and pre-amplified cDNA in a total reaction volume of 10 μl. The thermal profile was as following: activation 15 s at 95 °C; 40 cycles of annealing/elongation with 15 s at 94 °C, 30 s at 60 °C, and 30 s at 72 °C. Finally, a melt curve analysis war included. For urine samples, the Ct of the positive qPCR control was subtracted from the Ct of the miRNA to get a ΔCt value for each sample. These ΔCt values were converted to linear scale by computing 2−ΔCt and normalized to UCr to calculate arbitrary urinary levels for each miRNA per sample (2−ΔCt/UCr). Medium and cellular miRNAs were normalized to the positive qPCR control and let-7f, respectively, according to the ΔΔCt method for calculating relative quantities (RQ, 2−ΔΔCt).

In Situ Hybridization

Kidney biopsy samples were fixed in neutral buffered formalin, trimmed and paraffin embedded followed by sectioning of the tissue block into approximately 5 µm thick sections. Standard H&E staining was used to assess the degree of injury. In situ hybridization was performed using double-digoxigenin labeled miRNA probes from Exiqon (Vedbaek, Denmark) according to the manufacturer’s instructions. For hybridization, miRNA probes (miR-21-5p: TCAACATCAGTCTGATAAGCTA, Tm 83 °C, 60 nM; miR-200c-3p: TCCATCATTACCCGGCAGTATTA, Tm 87 °C, 80 nM; miR-423-5p: AAAGTCTCGCTCTCTGCCCCTCA, Tm 94 °C, 60 nM) were incubated for one hour 30 °C below the RNA melting temperature which corresponds to the optimal hybridization temperature. Nuclear Fast RedM was used for counter staining (Sigma-Aldrich). Finally, sections were analyzed by light microscopy.

Target Analysis

Ingenuity Pathway Analysis (IPA, Ingenuity Systems, www.ingenuity.com) was employed to search for target mRNAs containing sequences complementary to those present in the miRNAs (so-called miRNA target analysis for identification of mRNAs potentially regulated by miRNAs) and for pathway analysis in general. The 2 following filter criteria were applied for target analysis: (1) experimentally observed and/or highly predicted target relation, i.e. sequence complementarity between mRNA and miRNA, and (2) known expression in the kidney. The final group of identified miRNA targets was further investigated with IPA’s Core Analysis to find associated pathways and diseases.

Statistical Analysis

Urinary levels of miRNAs and KIM-1 are expressed as median and interquartile range with 5th and 95th percentiles as whiskers. Statistical significance was calculated with log2 urinary levels by t-test considering a P-value cut-off adjusted for multiple comparisons (significant in APAP study: p < .004; significant in Cp study: P < .0014) using GraphPad Prism 6 (GraphPad Software Inc., California). Logistic regression models were used to evaluate associations of all 3 candidate miRNA biomarkers as well as KIM-1 with the odds of AKI, and to estimate area under the receiver operator curve (AUC-ROC). Regression models were adjusted for age and sex. Spearman correlation analysis (ρ and corresponding P-value) was performed to assess correlation between all biomarkers using data from all patients at all time points. Statistical analyses were performed using Stata 13.0 (StataCorp, College Station, Texas).

RESULTS

Detection of APAP-Induced AKI in a Cross-Sectional Study Using KIM-1 and Candidate miRNAs

Three groups of patients, 43 with APAP-OD and AKI and 27 without a clinical diagnosis of AKI, as well as 65 healthy volunteers were enrolled in the cross-sectional study (Table 1). Since APAP is primarily a liver toxicant, all APAP-OD patients had liver injury diagnosed by approximately 100-fold increased levels of alanine aminotransferase as compared with healthy volunteers (Table 1). Urinary levels of KIM-1, miR-21, -200c, and -423 were significantly (adjusted P-value cutoff: P < .004) higher in both APAP-OD patients with AKI compared with healthy controls and in APAP-OD patients without AKI diagnosis compared with healthy controls (Figs. 1A and B). Among patients with APAP-OD, higher urinary concentrations of each biomarker were associated with higher odds of AKI (Table 2). After adjustment for age and gender, every doubling of miR-21 concentration was associated with 1.31-fold higher odds of AKI (95%CI: 1.07, 1.60; P < 0.01). Every doubling of KIM-1 concentration was associated with 3.2-fold higher odds of AKI, (95% CI: 1.74, 5.82; P < .001). In predictive performance analyses, KIM-1 had the highest AUC-ROC (AUC = 0.84, 95%CI: 0.74, 0.94) while miR-21, -200c, and -423 had ROC-AUC’s between 0.64 and 0.71. A combination of miRNAs with KIM-1 did not substantively increase the predictive performance, as assessed by ROC-AUCs (Table 2).

TABLE 1.

Demographic and Clinical Characteristics of Patients From the Cross-Sectional APAP Cohort

Characteristic Healthy Volunteers (n = 65) APAP-OD (n = 27) APAP-OD with AKI (n = 43)
Age, years 34.9 ± 9.8 39.3 ± 15.9 39.8 ± 13.4
Sex, female 37 (56.9%) 17 (62.9%) 24 (55.8%)
D/LT N/A 3 (11.1%) 19 (44.2%)
ALT activity (U/l) 30 (24–33) 3597 (2251–6226) 4601 (2188–7673)
SCr (mg/dl) N/A 0.62 (0.54–0.70) 2.44 (1.33–3.04)
Open in a new tab

Data are means ± SD, n (%) or medians (25–75th interquartile range); APAP, acetaminophen; OD, overdose; ALT, alanine aminotransferase; SCr, serum creatinine; D/LT, deceased/liver transplantation.

FIG. 1.

FIG. 1

Open in a new tab

Urinary profiles of KIM-1, miR-21, -200c, and -423 in APAP-induced kidney injury. Levels of miR-21, -200c, and -423 and KIM-1 were measured in urine from healthy controls (n = 65) as well as in patients with an APAP-OD (n = 70). Within latter group approximately 62% of the patients developed clinically proven AKI (50% increase in SCr). MiRNA levels and KIM-1 concentrations were normalized to urinary creatinine. A, Both data sets were log2 transformed and presented as box plots (median with inter quartile range) with 5th and 95th percentile as whiskers. T-test was used for P-value calculation: *P < .004. B, Table with absolute levels as medians (interquartile range) of arbitrary miRNA levels (×10−2; 2−ΔCt normalized by UCr) or absolute KIM-1 concentration (pg/mg urinary creatinine). UCr, urinary creatinine.

TABLE 2.

Cross-Sectional Associations of Biomarkers with AKI, Among Participants with APAP-OD

Biomarker, Per Doubling AUCa (95% CI) OR Unadjusted (95% CI) ORb Adjusted (95% CI) AUCc KIM-1 Combined (95% CI)
miR-21 0.71 (0.58, 0.83) 1.30 (1.07, 1.59)** 1.31 (1.07, 1.60)** 0.84 (0.73, 0.94)
miR-200c 0.64 (0.51, 0.77) 1.27 (1.04,1.55) 1.27 (1.04, 1.57)* 0.85 (0.76, 0.95)
miR-423 0.68 (0.56, 0.81) 1.29 (1.07, 1.56)** 1.29 (1.07, 1.56)** 0.84 (0.74, 0.95)
KIM-1 0.84 (0.74, 0.94) 3.08 (1.71, 5.56)*** 3.18 (1.74, 5.82)*** —
Open in a new tab

Odds ratio presented per doubling of each biomarker.

aAUC-ROC;

bOdds ratio adjusted for age and gender;

cAdjusted for KIM-1 concentration and covariates in b.

***P < .001; **P < .01; *P < .05.

Performance of KIM-1 and Candidate miRNAs in a Longitudinal Study of Cp-Induced AKI

To evaluate early diagnostic and predictive capabilities we next measured candidate miRNAs and KIM-1 in a longitudinal cohort of patients (n = 106) with mesothelioma undergoing cytoreductive surgery with intraoperative Cp before and after Cp administration (Table 3). MiR-21, -200c, and 423 were high in mesothelioma patients at baseline before Cp-treatment as compared with levels from healthy, noncancer patients from the APAP study (Supplement Figure S1). After Cp treatment, we found that miR-21, -200c, -423 as well as KIM-1 significantly increased (adjusted P-value cutoff: P < .0014) in urine compared with levels before the treatment with each biomarker being high in patients with AKI diagnosis but also in patients without clinically proven AKI (Figure 2). At any given time point, however, none of the biomarkers were significantly different between patients with and without AKI and concentrations of biomarkers were not associated with the odds of AKI (Table 4). All miRNAs correlated highly with each other, whereas the correlation of miRNAs was weak with KIM-1 and SCr. The correlation of KIM-1 with SCr was also weak (Table 5).

TABLE 3.

Baseline Demographic and Clinical Characteristics of Patients from the Longitudinal Cp Cohort by AKI Status

Characteristic No Clinical AKI (n = 61) AKI Stage 1 (n = 30) AKI Stages 2 and 3 (n = 15)
Age, years 62.5 ± 10.5 64.9 ± 10.9 67.5 ± 10.6
Sex, female 18 (29.5%) 4 (13.3%) 3 (20%)
Race, White 57 (93.4%) 29 (96.7%) 15 (100%)
Race, Black 1 (1.6%) 1 (3.3%) N/A
Open in a new tab

Data are mean ± SD or n (%); AKI Stage 1, 50–100% increase of SCr over baseline at any time point; AKI Stages 2 and 3, >100% increase of SCr over baseline at any time point.

FIG. 2.

FIG. 2

Open in a new tab

KIM-1, miR-21, -200c, and -423 increase in the longitudinal Cp cohort in patients with and without clinical AKI. Levels of miR-21, -200c, and -423 as well as KIM-1 were measured in urine from patients (n = 108) before (Pre) and on 9 following time points after Cp treatment grouping patients based on their SCr dependent AKI status. Data sets were normalized to UCr, log2 transformed and presented as box plots (median with 25th and 75th percentiles) with 5th and 95th percentile as whiskers. T-test was used for P-value calculation to compare with the group baseline as well as within the two groups: *P < .0014. Broken lines represent the median level before treatment of No AKI developers.

TABLE 4.

Association of Biomarker Concentration Doublings at 4, 8, 12, and 24 h with AKI Status (Any Stage) at 48 h

Biomarker Time Point OR (95% CI) P-value
miR-21 4 h 0.92 (0.75, 1.12) 0.399
8 h 1.05 (0.87, 1.27) 0.612
12 h 1.20 (0.99, 1.45) 0.060
24 h 1.13 (0.94, 1.37) 0.200
miR-200 4 h 0.79 (0.65, 0.97) 0.022
8 h 0.94 (0.76, 1.17) 0.575
12 h 1.18 (0.96, 1.45) 0.120
24 h 1.06 (0.87, 1.30) 0.558
miR-423 4 h 0.79 (0.65, 0.97) 0.025
8 h 0.99 (0.81, 1.21) 0.929
12 h 1.13 (0.93, 1.38) 0.203
24 h 1.13 (0.91, 1.39) 0.267
KIM-1 4 h 1.10 (0.98, 1.23) 0.098
8 h 1.06 (0.94, 1.20) 0.341
12 h 0.85 (0.69, 1.05) 0.140
24 h 0.89 (0.73, 1.10) 0.288
SCr 4 h 1.18 (0.40, 3.54) 0.762
8 h 1.49 (0.50, 4.43) 0.478
12 h 3.35 (1.03, 10.95) 0.045
24 h 5.77 (2.01, 16.58) 0.001
Open in a new tab

TABLE 5.

Correlation of all Biomarkers Over all Groups and Time Points in the Cp Cohort

SCr KIM-1 miR-21 miR-200c miR-423
SCr ρ 1
P-value
KIM-1 ρ 0.1312 1
P-value <.001
miR-21 ρ −0.016 0.2388 1
p-value .6218 <.001
miR-200c ρ −0.0802 0.1381 0.8331 1
P-value .0132 <.001 <.001
miR-423 ρ −0.1381 0.1322 0.6989 0.8556 1
P-value <.0001 <.001 <.001 <.001
Open in a new tab

Expression Patterns of miR-21, -200c, and -423 in the Human Kidney

In an attempt to investigate the expression patterns of the candidate miRNAs in human kidney we conducted in situ hybridization based miRNA localization in kidney biopsy samples from patients with clinical diagnosis of ATN—pathologically characterized by tubular dilatation, cellular debris in tubular lumen and descendent tubular epithelia (Figure 3). Biopsy samples from patients without evidence of kidney damage served as controls (normal). miR-21 was not detectable in normal tissue, but found to increase significantly and co-localize with injured areas (Figure 3, black arrows). miR-200c was neither seen in controls nor in ATN kidneys, whereas miR-423 showed a very strong expression in both (Figure 3).

FIG. 3.

FIG. 3

Open in a new tab

Localization of miR-21, -200c, and 423 in human kidney biopsies from patients with ATN. Pathological examination of the biopsy samples was performed with standard H&E stained sections. Using in situ hybridization, the expression patterns of miR-21, -200c, and -423 were assessed in kidney biopsies from normal controls and patients diagnosed with ATN. In situ hybridization settings were proven with U6 as positive control, having an abundant nuclear expression, and a scrabbled probe, not complementary to any known miRNA sequence, used as negative control. Star, tubular casts; arrow, positive miR-21 signal. For in situ: blue, positive probe staining; pink, counter staining; H&E pictures taken with 10× others with 20x objective; representative images of n = 3 controls and n = 3 ATN patients.

Release of miR-21, -200c, and -423 by HPTECs in Response to Toxicity

Within the nephron the primary target of Cp and APAP toxicity are the proximal tubules and therefore miRNA expressions were measured in HPTECs after treatment with Cp and 4-aminophenol (4-AP; degradation product of APAP). Following 24h of exposure to 85 µM of Cp and 100 µM of 4-AP the viability of the cells was decreased by approximately 50% and all 3 miRNAs significantly (P < .05) increased in the cell culture media (Figs. 4A and B). In the cells, the 3 miRNAs were minimally decreased after Cp treatment (Figure 4C). The increase in medium not only mimic the in vivo findings and strengthen the hypothesis of kidney proximal tubular epithelial cells to be the source for miR-21, -200c, and -423 release in urine after toxicity but also demonstrates the utility of these candidate miRNAs for screening nephrotoxic agents in vitro.

FIG. 4.

FIG. 4

Open in a new tab

HPTECs release miR-21, -200c, and -423 following toxicity. HPTECs were treated with Cp and 4-aminophenol (APAP degradation product) for 24 h followed by measurement of viability and miR-21, -200c, and -423. A, Dose-response curves after 24 h treatment with 0, 10, 31.6, 100, 316, and 1000 μM Cp and 4-aminophenol, respectively. Data are presented as means with standard deviation of percentage viability compared with the 0.5% DMSO treated control with fitted nonlinear dose–response curves (n = 3–6). Levels of miR-21, -200c, and -423 in the medium supernatant (B) as well as in the cells (C) after 24h treatment with 85 μM Cp and 100 μM 4-aminophenol, respectively. Data are presented as mean with SD (n = 3–4) of relative quantities (RQ, 2−ΔΔCt). 1-way ANOVA with Dunnett’s test was used for P-value calculation: *P < .05, **P < .01, and ***P < .001.

Mechanistic Implication of miR-21, -200c, and -423

MiRNAs function as intracellular regulators of gene expression, thus we hypothesized that the urinary miRNA profile might reflect affected pathways in the injured kidney. To test this hypothesis, IPA was used to find mRNA targets for miR-21, -200c, and -423. In total, 1102 mRNA targets were identified mostly associated with pathways also known to be perturbed in different pathological conditions in the kidney (Figure 5A). The top pathway and associated pathological condition was found to be MYC-mediated apoptosis signaling and renal necrosis/cell death, respectively. In addition, a deeper insight into the targets associated with renal necrosis/cell death as major feature of AKI, revealed that miR-21, -200c, and -423 have several overlapping targets including genes well-known in apoptosis like cyclin-dependent kinase inhibitor 1 (p21) or B-cell lymphoma 2 (Figure 5B).

FIG. 5.

FIG. 5

Open in a new tab

Target prediction analysis of miRNA biomarker candidates. IPA was used to identify mRNA targets of the 3 miRNAs (experimentally verified and highly predicted based on sequence complementarity). A, Within the pool of 1102 identified targets, IPA’s Core Analysis tool revealed associated pathways and pathological conditions. Bases on the ratio of genes found in the pool vs. genes related to the specific pathways or diseases, top 5 associated pathways and pathological conditions of the kidney were listed. B, All 49 targets associated with Renal Necrosis/Cell Death were plotted as network with the 3 miRNAs revealing overlapping targets as well as a complex interaction between the targets.

DISCUSSION

Using a multidimensional approach to examine the association of candidate biomarkers with drug-induced AKI, we evaluated urinary KIM-1, miR-21, -200c, and -423 among AKI patients, enrolled in a cross-sectional as well as longitudinal study. All 4 biomarkers were higher in patients with APAP-OD, relative to healthy subjects and were highest among patients with APAP-OD and diagnosed AKI. In longitudinal analyses, all biomarkers were elevated postCp treatment, regardless of future AKI status.

The poor performance of urinary miRNAs and KIM-1 to predict AKI may reflect the inadequacy of a SCr-based definition for AKI (Waikar et al., 2012). Although in preclinical studies renal histopathological examination is the gold standard for AKI diagnosis, in clinical assessments SCr remains widely used. In fact, moderate performances of new AKI biomarker candidates are frequently seen in clinical studies, where AKI is mostly defined based on increased SCr levels (Vanmassenhove et al., 2013). Several studies have demonstrated that patients who were SCr negative but biomarker positive are at risk for short- as well as long-term morbidity and mortality (Coca et al., 2014; Haase et al., 2011). Haase et al. (2012) suggested to term this condition subclinical AKI, because it is not clinically detectable with existing routine diagnostics (SCr, blood urea nitrogen); however, tubular damage markers such as KIM-1 and NGAL suggest injury (Haase et al., 2012).

In a preclinical study, both miR-21 and KIM-1 accurately reflected AKI diagnosed by histopathology but not when diagnosed by SCr (Supplementary Figure S2; Pavkovic et al., 2014, 2015). In clinical settings renal biopsies are not readily available, thus the evaluation of novel biomarkers becomes hindered by the inadequacy of SCr-based definitions of the outcome. Finding a solution to this paradox in clinical AKI biomarker evaluation is challenging. However, in the case of drug-induced AKI, the treatment with the nephrotoxic drug per se can be used for comparison.

Our results confirmed previous reports that KIM-1 has high sensitivity and specificity for tubular injury. A meta-analysis including data from 2979 patients concluded that urinary KIM-1 may be a promising biomarker for early detection of AKI also in clinical settings (Shao et al., 2014). A recently published study using a very small number of patients (n = 22) with solid tumors receiving Cp treatment showed a comparable increase of KIM-1 in urine after treatment, as seen here, whereas SCr was not increased (Tekce et al., 2015). The exploration of KIM-1’s function revealed interesting features involved in phagocytosis and regeneration (Ichimura et al., 2008; Yang et al., 2015), but limited information was added to the mechanism of initiation of AKI.

In contrast, miRNAs bear the potential to fill this gap since it is estimated that over 50% of all protein-coding genes are regulated by miRNAs (Krol et al., 2010). Applying IPA for the 3 candidate miRNAs studied here, the top pathological kidney conditions found to be associated with the targets was renal necrosis highlighting the previously mentioned possibility of urinary miRNA profiles to mirror molecular perturbations in the kidney. MiR-21 has been extensively explored since it is ubiquitously expressed in mammalian organs; it is enriched in the kidney where it is involved in diverse physiological as well as pathophysiological processes (Landgraf et al., 2007; Ma and Qu, 2013). In the context of AKI, miR-21 is described as a negative regulator in the apoptosis of tubular epithelial cells but also as involved in progression of fibrosis via SMADs after TGFβ activation (Li et al., 2013). In a mouse model of Alport nephropathy it was shown that since miR-21 is further involved in metabolism and FA oxidation, inhibition of miR-21 probably enhanced PPARα/RXR activity and improved mitochondrial function. Thus it was deemed protective against TGF-β-induced fibrogenesis and inflammation in kidneys (Gomez et al., 2015). MiR-200c has been mainly investigated in the context of cancer where it was found to regulate epithelial–mesenchymal transition via downregulation of ZEB1 and AKT resulting in an upregulation of E-cadherin (Bracken et al., 2015; Wang et al., 2013). In addition, miR-200c is involved in cell growth and cell cycle progression by suppressing the expression of CDK2 in renal carcinoma cell lines and xenografts (Wang et al., 2015). MiR-423 has been less well-studied but has been shown to increase proliferation and cell growth by targeting Trefoil factor 1 and p21 in gastric and hepatocellular cancer, respectively (Lin et al., 2011; Liu et al., 2014). Furthermore, miR-423 is part of a miRNA signature associated with lupus nephritis (Te et al., 2010). Overall, target prediction analysis and current knowledge about the function of the 3 miRNAs support our hypothesis of urinary miRNAs profiles as reflection of intrarenal processes.

Using human kidney biopsy samples, miR-423 was found expressed in the whole kidney cortex ie, in tubular and glomerular structures whereas miR-200c could not be detected and miR-21 seemed to be expressed in injured areas of the kidney from patients with ATN. An expression in normal human kidneys was shown previously for miR-21 and -200c using PCR (Bao et al., 2014), thus the lack of detection here could be due to the low technical sensitivity of in situ hybridization. Expression of all 3 miRNAs was detected in HPTECs. For miR-21, contrary to the in situ hybridization results, decreased expression was seen in HPTECs after treatment with Cp. This discrepancy could be due to the in vitro system per se or the different kind of AKI (ATN after allograft rejection) in the kidney biopsy samples. However, we found all 3 miRNAs increased in cell medium after Cp or 4-AP treatment, probably mimicking the in vivo situation.

Our study has several limitations. First, the longitudinal cohort consisted of patients with malignant mesothelioma. As such, an impact of concomitant cancer, rather than the Cp-treatment per se, on the miRNA profile in urine cannot be excluded. In fact, miR-21 expression in cancerous tissue was described as part of a 6-miRNA signature to predict survival in patients with malignant mesothelioma (Kirschner et al., 2015). A direct comparison of all biomarker profiles in urine from both studies demonstrated high levels of miR-21, -200c, and -423 in cancer patients (Supplementary Figure S1). Second, miRNA candidates were selected based on a cross-sectional discovery approach with healthy volunteers versus AKI patients from the intensive care unit having different etiologies. Since AKI is a clinical condition with various etiologies the existence of one single, universal AKI biomarker seems unlikely. A more focused discovery approach using a case-control cohort of patients with drug-induced kidney toxicity has the potential to yield more sensitive and specific biomarkers for drug-induced AKI.

In summary, we show that KIM-1 along with miR-21, -200c, and -423 can be non-invasive as well as specific urinary biomarkers for the detection of drug-induced AKI in patients. Based on their kidney expression and target analysis, miR-21, -200c, and -423 could add information about the affected molecular pathways in the kidney during AKI.

SUPPLEMENTARY DATA

Supplementary data are available online at http://toxsci.oxfordjournals.org/.

Supplementary Data
supp_152_1_205__index.html (787B, html)

ACKNOWLEDGEMENTS

We thank Dr Susanne Ramm, Cory Gerlach, and Vidya Chandrasekaran for extraordinary scientific and technical support. Further, we thank Dana-Farber/Harvard Cancer Center in Boston, Massachusetts, for the use of the Specialized Histopathology Core, which provided sectioning and H&E staining services. L.H., M.P., and D.J.A. would like to acknowledge support from the Medical Research Council.

FUNDINGS

M.P. is a recipient of a research fellowship from the Deutsche Forschungsgemeinschaft (DFG). The Specialized Histopathology Core at the Dana-Farber/Harvard Cancer Center is supported in part by the NCI Cancer Center Support Grant no. NIH 5 P30 CA06516. D.J.A. would like to acknowledge additional support from the Wellcome Trust and the Royal Society International Exchange Scheme. Work in the Vaidya laboratory was supported by Outstanding New Environmental Sciences (ONES) award from NIH/NIEHS (ES017543), Innovation in Regulatory Science Award from Burroughs Wellcome Fund (BWF-1012518) and a collaborative research agreement with Biogen (A24378).

REFERENCES

  1. Adler M., Ramm S., Hafner M., Muhlich J. L., Gottwald E. M., Weber E., Jaklic A., Ajay A. K., Svoboda D., Auerbach S., et al. (2016). A quantitative approach to screen for nephrotoxic compounds in vitro. J. Am. Soc. Nephrol. 27, 1015–1028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bao H., Hu S., Zhang C., Shi S., Qin W., Zeng C., Zen K., Liu Z. (2014). Inhibition of miRNA-21 prevents fibrogenic activation in podocytes and tubular cells in IgA nephropathy. Biochem. Biophys. Res. Commun. 444, 455–460. [DOI] [PubMed] [Google Scholar]
  3. Bracken C. P., Khew-Goodall Y., Goodall G. J. (2015). Network-based approaches to understand the roles of miR-200 and other microRNAs in cancer. Cancer Res. 75, 2594–2599. [DOI] [PubMed] [Google Scholar]
  4. Coca S. G., Garg A. X., Thiessen-Philbrook H., Koyner J. L., Patel U. D., Krumholz H. M., Shlipak M. G., Parikh C. R., Consortium T. A. (2014). Urinary biomarkers of AKI and mortality 3 years after cardiac surgery. J. Am. Soc. Nephrol. 25, 1063–1071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dieterle F, Sistare F. (2010). Biomarkers of acute kidney injury In Biomarkers: In Medicine, Drug Discovery, and Enviromental Health (Vaidya V. S., Bonventre J. V., Eds.), pp. 237–263. Wiley & Sons, Inc, Hoboken, NJ. [Google Scholar]
  6. EMA. (2009). Final conclusions of the pilot joint EMEA/FDA VXDA experience on qualification of nephrotoxicity biomarkers. Available at: www.emea.europa.eu Doc.ref. EMEA/679719/2008 Rev. 1 (Committee for medicinal products for human use).
  7. Gomez I. G., MacKenna D. A., Johnson B. G., Kaimal V., Roach A. M., Ren S., Nakagawa N., Xin C., Newitt R., Pandya S., et al. (2015). Anti-microRNA-21 oligonucleotides prevent Alport nephropathy progression by stimulating metabolic pathways. J. Clin. Invest. 125, 141–156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Haase M., Devarajan P., Haase-Fielitz A., Bellomo R., Cruz D. N., Wagener G., Krawczeski C. D., Koyner J. L., Murray P., Zappitelli M., et al. (2011). The outcome of neutrophil gelatinase-associated lipocalin-positive subclinical acute kidney injury. A multicenter pooled analysis of prospective studies. J. Am. Coll. Cardiol. 57, 1752–1761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Haase M., Kellum J. A., Ronco C. (2012). Subclinical AKI–an emerging syndrome with important consequences. Nat. Rev. Nephrol. 8, 735–739. [DOI] [PubMed] [Google Scholar]
  10. Ichimura T., Asseldonk E. J., Humphreys B. D., Gunaratnam L., Duffield J. S., Bonventre J. V. (2008). Kidney injury molecule-1 is a phosphatidylserine receptor that confers a phagocytic phenotype on epithelial cells. J. Clin. Invest. 118, 1657–1668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Jensen O. N. (2004). Modification-specific proteomics: Characterization of post-translational modifications by mass spectrometry. Curr. Opin. Chem. Biol. 8, 33–41. [DOI] [PubMed] [Google Scholar]
  12. Kirschner M. B., Cheng Y. Y., Armstrong N. J., Lin R. C., Kao S. C., Linton A., Klebe S., McCaughan B. C., van Zandwijk N., Reid G. (2015). MiR-score: A novel 6-microRNA signature that predicts survival outcomes in patients with malignant pleural mesothelioma. Mol. Oncol. 9, 715–726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Krol J., Loedige I., Filipowicz W. (2010). The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet. 11, 597–610. [DOI] [PubMed] [Google Scholar]
  14. Landgraf P., Rusu M., Sheridan R., Sewer A., Iovino N., Aravin A., Pfeffer S., Rice A., Kamphorst A. O., Landthaler M., et al. (2007). A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 129, 1401–1414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Li Y. F., Jing Y., Hao J., Frankfort N. C., Zhou X., Shen B., Liu X., Wang L., Li R. (2013). MicroRNA-21 in the pathogenesis of acute kidney injury. Protein Cell 4, 813–819. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lin J., Huang S., Wu S., Ding J., Zhao Y., Liang L., Tian Q., Zha R., Zhan R., He X. (2011). MicroRNA-423 promotes cell growth and regulates G(1)/S transition by targeting p21Cip1/Waf1 in hepatocellular carcinoma. Carcinogenesis 32, 1641–1647. [DOI] [PubMed] [Google Scholar]
  17. Liu J., Wang X., Yang X., Liu Y., Shi Y., Ren J., Guleng B. (2014). miRNA423-5p regulates cell proliferation and invasion by targeting trefoil factor 1 in gastric cancer cells. Cancer Lett. 347, 98–104. [DOI] [PubMed] [Google Scholar]
  18. Ma L., Qu L. (2013). The function of microRNAs in renal development and pathophysiology. J. Genet. Genomics 40, 143–152. [DOI] [PubMed] [Google Scholar]
  19. McDonald J. S., Milosevic D., Reddi H. V., Grebe S. K., Algeciras-Schimnich A. (2011). Analysis of circulating microRNA: Preanalytical and analytical challenges. Clin. Chem. 57, 833–840. [DOI] [PubMed] [Google Scholar]
  20. Mehta R. L., Kellum J. A., Shah S. V., Molitoris B. A., Ronco C., Warnock D. G., Levin A., Acute Kidney Injury N. (2007). Acute Kidney Injury Network: Report of an initiative to improve outcomes in acute kidney injury. Crit. Care 11, R31.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mitchell P. S., Parkin R. K., Kroh E. M., Fritz B. R., Wyman S. K., Pogosova-Agadjanyan E. L., Peterson A., Noteboom J., O'Briant K. C., Allen A., et al. (2008). Circulating microRNAs as stable blood-based markers for cancer detection. Proc. Natl. Acad. Sci. U S A 105, 10513–10518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Mraz M., Malinova K., Mayer J., Pospisilova S. (2009). MicroRNA isolation and stability in stored RNA samples. Biochem. Biophys. Res. Commun. 390, 1–4. [DOI] [PubMed] [Google Scholar]
  23. Murray P. T., Mehta R. L., Shaw A., Ronco C., Endre Z., Kellum J. A., Chawla L. S., Cruz D., Ince C., Okusa M. D., and., et al. (2014). Potential use of biomarkers in acute kidney injury: Report and summary of recommendations from the 10th Acute Dialysis Quality Initiative consensus conference. Kidney Int. 85, 513–521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Pavkovic M., Riefke B., Frisk A. L., Groticke I., Ellinger-Ziegelbauer H. (2015). Glomerulonephritis-induced changes in urinary and kidney MicroRNA profiles in rats. Toxicol. Sci. 145, 348–359. [DOI] [PubMed] [Google Scholar]
  25. Pavkovic M., Riefke B., Gutberlet K., Raschke M., Ellinger-Ziegelbauer H. (2014). Comparison of the MesoScale Discovery and Luminex multiplex platforms for measurement of urinary biomarkers in a cisplatin rat kidney injury model. J. Pharmacol. Toxicol. Methods 69, 196–204. [DOI] [PubMed] [Google Scholar]
  26. Ramachandran K., Saikumar J., Bijol V., Koyner J. L., Qian J., Betensky R. A., Waikar S. S., Vaidya V. S. (2013). Human miRNome profiling identifies microRNAs differentially present in the urine after kidney injury. Clin. Chem. 59, 1742–1752. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Saikumar J., Hoffmann D., Kim T. M., Gonzalez V. R., Zhang Q., Goering P. L., Brown R. P., Bijol V., Park P. J., Waikar S. S., and. et al. (2012). Expression, circulation, and excretion profile of microRNA-21, -155, and -18a following acute kidney injury. Toxicol. Sci. 129, 256–267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Shao X., Tian L., Xu W., Zhang Z., Wang C., Qi C., Ni Z., Mou S. (2014). Diagnostic value of urinary kidney injury molecule 1 for acute kidney injury: A meta-analysis. PloS One 9, e84131.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Susantitaphong P., Cruz D. N., Cerda J., Abulfaraj M., Alqahtani F., Koulouridis I., Jaber B. L. and Acute Kidney Injury Advisory Group of the American Society of, N. (2013). World incidence of AKI: A meta-analysis. Clin. J. Am. Soc. Nephrol. 8, 1482–1493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Taber S. S., Pasko D. A. (2008). The epidemiology of drug-induced disorders: The kidney. Exp. Opin. Drug Saf. 7, 679–690. [DOI] [PubMed] [Google Scholar]
  31. Te J. L., Dozmorov I. M., Guthridge J. M., Nguyen K. L., Cavett J. W., Kelly J. A., Bruner G. R., Harley J. B., Ojwang J. O. (2010). Identification of unique microRNA signature associated with lupus nephritis. PloS One 5, e10344.. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Tekce B. K., Uyeturk U., Tekce H., Uyeturk U., Aktas G., Akkaya A. (2015). Does the kidney injury molecule-1 predict cisplatin-induced kidney injury in early stage? Ann. Clin. Biochem. 52, 88–94. [DOI] [PubMed] [Google Scholar]
  33. Uchino S., Kellum J. A., Bellomo R., Doig G. S., Morimatsu H., Morgera S., Schetz M., Tan I., Bouman C., Macedo E., et al. Beginning, and Ending Supportive Therapy for the Kidney, I. (2005). Acute renal failure in critically ill patients: A multinational, multicenter study. Jama 294, 813-8.. [DOI] [PubMed] [Google Scholar]
  34. Vaidya V. S., Ferguson M. A., Bonventre J. V. (2008). Biomarkers of acute kidney injury. Annu. Rev. Pharmacol. Toxicol. 48, 463–493. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Vanmassenhove J., Vanholder R., Nagler E., Van Biesen W. (2013). Urinary and serum biomarkers for the diagnosis of acute kidney injury: An in-depth review of the literature. Nephrol. Dial. Transplant. 28, 254–273. [DOI] [PubMed] [Google Scholar]
  36. Waikar S. S., Betensky R. A., Emerson S. C., Bonventre J. V. (2012). Imperfect gold standards for kidney injury biomarker evaluation. J. Am. Soc. Nephrol. 23, 13–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wang X., Chen X., Han W., Ruan A., Chen L., Wang R., Xu Z., Xiao P., Lu X., Zhao Y., et al. (2015). miR-200c Targets CDK2 and Suppresses Tumorigenesis in Renal Cell Carcinoma. Mol. Cancer Res. 13, 1567–1577. [DOI] [PubMed] [Google Scholar]
  38. Wang X., Chen X., Wang R., Xiao P., Xu Z., Chen L., Hang W., Ruan A., Yang H., Zhang X. (2013). microRNA-200c modulates the epithelial-to-mesenchymal transition in human renal cell carcinoma metastasis. Oncol. Rep. 30, 643–650. [DOI] [PubMed] [Google Scholar]
  39. Weber J. A., Baxter D. H., Zhang S., Huang D. Y., Huang K. H., Lee M. J., Galas D. J., Wang K. (2010). The microRNA spectrum in 12 body fluids. Clin. Chem. 56, 1733–1741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Yang L., Brooks C. R., Xiao S., Sabbisetti V., Yeung M. Y., Hsiao L. L., Ichimura T., Kuchroo V., Bonventre J. V. (2015). KIM-1-mediated phagocytosis reduces acute injury to the kidney. J. Clin. Invest. 125, 1620–1636. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Data
supp_152_1_205__index.html (787B, html)
supp_kfw077_toxsci-16-0013-File007.pdf (520.6KB, pdf)

Articles from Toxicological Sciences are provided here courtesy of Oxford University Press

RESOURCES