Abstract
The extracellular matrix protein nephronectin (Npnt), also called POEM, is considered to play critical roles as an adhesion molecule in development and functions of various tissues, such as the kidneys, liver, and bone. In the present study, we examined the molecular mechanism of Npnt gene expression and found that vitamin D3 (1α,25‐dihydroxyvitamin D3,VD 3) strongly enhanced Npnt mRNA expression in MC3T3‐E1 cells from a mouse osteoblastic cell line. The VD 3‐induced increase in Npnt expression is both time‐ and dose‐dependent and is mediated by the vitamin D receptor (VDR).
Keywords: 1α,25‐dihydroxyvitamin D3; nephronectin; vitamin D receptor
Abbreviations
- JAK
janus kinase
- MAM
meprin A5 protein and receptor protein‐tyrosine phosphatase μ
- MAPK
mitogen‐activated protein kinase
- Npnt
nephronectin
- RANKL
receptor activator of nuclear factor kappa‐β ligand
- RGD
Arg‐Gly‐Asp
- RXR
retinoic acid receptor
- STAT
signal transducer and activator of transcription
- TGF‐β
transforming growth factor‐β
- TNF‐α
tumor necrosis factor‐α
- VD3
1α,25‐dihydroxyvitamin D3
- VDRE
vitamin D response elements
- VDR
vitamin D receptor
Nephronectin (Npnt), an extracellular matrix protein, is known to be involved in the development and functions of various tissues 1, 2. This protein, which acts as an adhesion molecule, consists of five epidermal growth factor (EGF)‐like domains, an Arg‐Gly‐Asp (RGD) cell binding motif, and a meprin A5 protein and receptor protein‐tyrosine phosphatase μ (MAM) domain 1, 2. Npnt interacts with integrins, especially α8β1 integrins, and plays a crucial role during the early steps of kidney morphogenesis through its own RGD motif 2. Ablation of Npnt was reported to induce kidney agenesis or hypoplasia, as well as delocalization of the arrector pili muscle associated with the hair follicle bulge in the epidermis 3, 4.
The active form of vitamin D3 (1α,25‐dihydroxyvitamin D3; VD3) plays a crucial role in regulating calcium and phosphate homeostasis in several target tissues including the kidneys, small intestine, and bone 5. The functions of VD3 in bone include both stimulation and inhibition of mineralization, and in vitro studies have revealed that VD3 regulates osteoblast‐lineage cell growth and function depending on cell source and the initial state of differentiation 5, 6. On the other hand, VD3 also regulates the expression of receptor activator of nuclear factor‐κβ ligand (RANKL), which stimulates bone resorption through osteoclast activation 7. The biological functions of VD3 are mediated by its binding to the vitamin D receptor (VDR), a nuclear transcription factor that forms a heterodimer with the retinoid X receptor (RXR) and binds to vitamin D responsible elements (VDRE) in regulatory regions that are functionally linked to specific target genes 8, 9.
In our previous studies, we found that Npnt expression is downregulated by cytokines, such as TGF‐β, TNFα, and oncostatin M, via MAPK, JAK/STAT, and NF‐κβ pathways in MC3T3‐E1 cells 10, 11, 12. The present study clearly shows that VD3 upregulates the expression of Npnt in both a time‐ and dose‐dependent manner via the VDR.
Results and Discussion
In this study, we initially examined regulation of the expression of Npnt by VD3, as well as by its agonistic analogs EB1089 and calcipotriol, in MC3T3‐E1 cells. Treatment with 100 ng·mL−1 of each those reagents for 24 h sharply increased the expression of Npnt mRNA (Fig. 1). In addition, VD3 treatment increased Npnt gene expression in C2C12 cells from a mouse myoblast cell line and in STC‐1 cells from a mouse intestinal cell line, whereas no such increase was seen in HEK293 cells from a human embryonic kidney cell line (Fig. S1).
Figure 1.

Npnt mRNA expression increased by treatment with VD 3. MC3T3‐E1 cells were treated with 100 ng·mL−1 of VD 3, EB1089, or calcipotriol for 24 h. Total cellular RNA was extracted, and mRNA levels for Npnt and Gapdh were examined using quantitative real‐time PCR analysis. Results are shown as the mean ± SD of three samples. *P < 0.05, Student's t test, relative to the level at 0 ng·mL−1.
In the above described experiments, MC3T3‐E1 cells were treated with different concentrations of VD3 for 24 h and we observed a significant increase in Npnt mRNA expression, when the VD3 concentration was greater than 10 ng·mL−1 when compared to the unstimulated control (Fig. 2A). The time‐dependent effects of VD3 on Npnt mRNA expression was then further examined using a fixed concentration of 100 ng·mL−1. When the cells were treated for at least 12 h, a significant increase in Npnt mRNA expression was seen and occurred in a time‐dependent manner, which increased more than up to 15‐fold after 24 h (Fig. 2B).
Figure 2.

Effects of VD 3 on Npnt mRNA expression. (A) Dose‐dependent effects of VD 3 on Npnt mRNA expression. MC3T3‐E1 cells were treated with 0, 0.1, 1, 10, 100, or 1000 ng·mL−1 of VD 3 for 24 h. Total cellular RNA was extracted, and mRNA levels for Npnt and Gapdh were examined using quantitative real‐time PCR analysis. Results are shown as the mean ± SD of three samples. *P < 0.05, Student's t test as compared to the level with 0 ng·mL−1 of VD 3. (B) Time‐course analysis of effects of VD 3 on Npnt mRNA expression. MC3T3‐E1 cells were treated with 100 ng·mL−1 of VD 3 for 3, 6, 12, or 24 h. Results are shown as the mean ± SD from three samples. *P < 0.05, Student's t test, relative to the level with 0 ng·mL−1 of VD 3 at each time point.
To investigate the mechanism that governs regulation of Npnt expression through the VDR in osteoblasts, MC3T3‐E1 cells were treated with a small interfering RNA (siRNA) targeting VDR. First, we noted significant decreases in VDR mRNA and protein levels in MC3T3‐E1 cells after the treatment with VDR siRNA (Fig. 3A), which decreased Npnt gene expression (Fig. 3B), suggesting that Npnt gene expression is regulated by the VDR.
Figure 3.

siRNA‐mediated knockdown of the VDR reduced Npnt gene expression in osteoblasts mediated by VD 3. VDR siRNA was introduced to MC3T3‐E1 cells and incubation was performed for 48 h. After extracting total cellular RNA and protein, mRNA samples for Npnt and Gapdh VDRs were examined using quantitative real‐time PCR, and protein samples for those VDRs and β‐actin were examined by western blotting. (A) VDR expression was suppressed by introducing VDR siRNA. Results are shown as the mean ± SD of three samples. *P < 0.05, Student's t test, relative to the level without VDR siRNA. (B) VD 3‐induced Npnt gene expression was downregulated by VDR siRNA. Results are shown as the mean ± SD of three samples. *P < 0.05, Student's t test, relative to the level without VDR siRNA.
On the basis of our results, we propose a model of increased Npnt mRNA expression induced by VD3 through the VDR (Fig. 4). VD3 binding to the VDR forms a heterodimer with the retinoid X receptor (RXR), which may bind to VDRE in hypothetical regulatory regions of the Npnt gene to regulate its expression. Although Tsukasaki et al. 11 hypothesized that putative VDRE can be detected by a transcriptional factor search program (alibaba) and are located upstream of the transcriptional starting site of the Npnt gene (− 133 to − 112 and − 663 to − 642), no evidence of VDRE for the Npnt gene has been detected yet (data not shown).
Figure 4.

Proposed model of increased Npnt mRNA expression induced by VD 3 through the VDR. VD 3 binding to the VDR forms a heterodimer with RXR, which may bind to VDRE in the hypothetical regulatory regions of the Npnt gene to regulate its expression.
Kahai et al. 13 demonstrated that one of the physiological functions of Npnt is the enhancement of osteoblast differentiation via EGF‐like domains, which activates the ERK‐MAPK signaling pathway. On the other hand, the anabolic and catabolic functions of VD3 in bone that occur via osteoblast differentiation are associated with VD3 and VDR‐dependent changes in gene expression 5. To determine the relationship between osteoblast differentiation and VD3‐induced Npnt gene expression, Npnt siRNA‐treated MC3T3‐E1 cells were treated with/without BMP‐2 or VD3. Unexpectedly, VD3‐induced Npnt gene induction did not affect osteoblast differentiation of MC3T3‐E1 cells (Fig. S2). Additional studies are required to determine the precise physiological and functional roles of Npnt gene expression by VD3.
In conclusion, our results show that VD3 stimulates Npnt gene expression in both time‐ and dose‐dependent manners via the VDR.
Materials and methods
Cell cultures
MC3T3‐E1 cells were maintained in MEMα with L‐glutamine and phenol red medium (Wako Pure Chemical Industries, Ltd., Osaka, Japan; Cat. No. 135‐15175), supplemented with 10% fetal bovine serum (FBS) (Life Technologies, Rockville, MD, USA; Cat. No. 10437) and 1% penicillin‐streptomycin at 37 °C in a CO2 incubator (5% CO2, 95% air). For the experiments, cells were plated at 3.8 × 105 cells/well in six‐well plates (Thermo Scientific Inc., Waltham, MA, USA; Cat. No. 140675). C2C12 cells were maintained in DMEM (Wako Pure Chemical Industries, Ltd.; Cat. No. 044‐29765) supplemented with 15% FBS and 1% penicillin–streptomycin at 37 °C in a CO2 incubator. HEK293 and STC‐1 cells were maintained in DMEM supplemented with 10% FBS and 1% penicillin–streptomycin at 37 °C in a CO2 incubator.
Reagents
1α,25‐dihydroxyvitamin D3 (VD3) (Calcitoriol; Cat. No. 71820) was purchased from Cayman Chemical Company, Ann Arbor, MI, USA. EB1089 (Cat. No. 3993) was purchased from Tocris Bioscience (Bristol, UK) and calcipotriol (Cat. No. C4369‐10MG) was purchased from Sigma‐Aldrich 14, and recombinant human bone morphogenetic protein‐2 (BMP‐2) (Cat. No. 355‐BM) was purchased from R&D Systems (Minneapolis, MN, USA).
Quantitative real‐time PCR
Total RNA was extracted using TRIzol reagent (Life Technologies; Cat. No. 15596018), then reverse transcribed using SuperScript III (Life Technologies; Cat. No. 18080‐044). Quantitative real‐time PCR was performed using a Fast SYBR Green Master Mix (Applied Biosystems, Carlsbad, CA, USA; Cat. No.1411119) with the following specific PCR primers: mouse glyceraldehyde 3‐phosphate dehydrogenase (Gapdh), 5′‐AAATGGTGAAGGTCGGTGTG‐3′ and 5′‐TGAAGGGGTCGTTGATGG‐3′; and mouse nephronectin (Npnt), 5′‐CACGAGTAATTACGGTTGACAACAG‐3′ and 5′‐CTGCCGTGGAATGAACACAT‐3′; human glyceraldehyde 3‐phosphate dehydrogenase (Gapdh), 5′‐GCACCGTCAAGGCTGAGAAC‐3′ and 5′‐TGGTGAAGACGCCAGTGGA‐3′; and human nephronectin (Npnt), 5′‐CCAAATGCTGAGCTCACTGAA‐3′ and 5′‐CACCGCCACACTAGGACATTA‐3′.
Quantitative real‐time PCR assays were also performed using TaqMan Fast Universal PCR Master Mix (Applied Biosystems; Cat. No.1501411) with the following specific assay IDs: Vdr, Mn00437297; and Gapdh, Mn03302249g1.
siRNA knockdown of gene expression
MC3T3‐E1 cells at 50% confluence were seeded and transfected with 10 pmol·cm−2 of the culture surface area of the siRNA pool (Stealth siRNA; Life Technologies) using Lipofectamine RNAi MAX reagent (Cat. No.1662469; Life Technologies) in OPTI‐MEM (Cat. No. 31985‐070; Life Technologies). The following IDs were used for Vdr siRNAs; MSS238646, MSS238647, and MSS238682, and those for Npnt siRNAs; MSS272952, MSS272953, and MSS272954.
Western blotting
Protein samples were collected using Sample Buffer Solution with Reducing Reagent (6×) for SDS/PAGE (Nacalai Tesque, Kyoto, Japan; Cat. No. 09499‐14) with a cell scraper (Corning Incorporated, Corning, NY, USA; Cat. No. 3010), then electrophoresed onto a 10% SDS polyacrylamide gel and blotted onto a PVDF membrane. The PVDF membrane was soaked in TBST solution for 24 h at 4 °C, after which the blots were incubated with primary (dilution; 1 : 100) and secondary (dilution; 1 : 100) antibodies for 1 h. The primary antibody for VDR (Cat. No.sc‐13133) was purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA; Cat. No.sc‐13133). The secondary antibody was an anti‐(mouse IgG) horseradish peroxidase linked antibody and purchased from GE Healthcare (Chicago, IL, USA; Cat. No. NA931VS). To visualize the locations of the antigenic bands, peroxidase reactions were developed using ECL prime western blotting detection reagent (GE Healthcare).
Alkaline phosphatase activity
Alkaline phosphatase (ALP) activity was determined as a marker of osteoblast differentiation. After removing culture medium, cell layers were washed with PBS, then sonicated in 50 mm Tris‐HCl (pH 7.5) containing 0.1% Triton X‐100. ALP activity in the lysates was determined following incubation with the substrate, p‐nitrophenylphosphate, in buffer (pH 10) containing 0.1 m 2‐amino‐2‐methyl‐1‐propanol and 2 mm MgCl2. The reaction was terminated by adding NaOH and values were determined at 405 nm.
Author contributions
AY, RA, MT, NM, DC, KM, TS, MT, MY, TI and RK conceived and designed the experiments. KH, AY and TK performed the experiments. KH, AY and RK analyzed the data. DS, YS, RN and MI contributed reagents/materials/analysis tools. KH, AY and RK wrote the manuscript.
Supporting information
Fig. S1. Dose‐dependent effects of VD3 on Npnt mRNA expression in (A) C2C12, (B) HEK293, and (C) STC‐1 cells after treatment with 0, 10, 100, or 1000 ng·mL−1 for 24 h.
Fig. S2. VD3‐induced Npnt gene induction does not affect osteoblast differentiation of MC3T3‐E1 cells.
Acknowledgements
We are grateful for the helpful assistance of Prof. H. Itabe, Mr. M. W. Myers, and Mr. Y. Matsuura. We also express our gratitude to Mr. M. Hiranuma for his encouragement of our work. This study was supported in part by the Project to Establish Strategic Research Center for Innovative Dentistry by the Ministry of Education, Culture, Sports, Science and Technology of Japan, and Grants‐in‐Aid for Scientific Research from the Japan Society for the Promotion of Science.
References
- 1. Morimura N, Tezuka Y, Watanabe N, Yasuda M, Miyatani S, Hozumi N and Tezuka Ki K (2001) Molecular cloning of POEM: a novel adhesion molecule that interacts with alpha8beta1 integrin. J Biol Chem 276, 42172–42181. [DOI] [PubMed] [Google Scholar]
- 2. Brandenberger R, Schmidt A, Linton J, Wang D, Backus C, Denda S, Muller U and Reichardt LF (2001) Identification and characterization of a novel extracellular matrix protein nephronectin that is associated with integrin alpha8beta1 in the embryonic kidney. J Cell Biol 154, 447–458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Linton JM, Martin GR and Reichardt LF (2007) The ECM protein nephronectin promotes kidney development via integrin alpha8beta1‐mediated stimulation of Gdnf expression. Development 134, 2501–2509. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Fujiwara H, Ferreira M, Donati G, Marciano DK, Linton JM, Sato Y, Hartner A, Sekiguchi K, Reichardt LF and Watt FM (2011) The basement membrane of hair follicle stem cells is a muscle cell niche. Cell 144, 577–589. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Meyer MB, Benkusky NA, Lee CH and Pike JW (2014) Genomic determinants of gene regulation by 1,25‐dihydroxyvitamin D3 during osteoblast‐lineage cell differentiation. J Biol Chem 289, 19539–19554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Bikle DD (2012) Vitamin D and bone. Curr Osteoporos Rep 10, 151–159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Takahashi N, Udagawa N and Suda T (1999) A new member of tumor necrosis factor ligand family, ODF/OPGL/TRANCE/RANKL, regulates osteoclast differentiation and function. Biochem Biophys Res Commun 256, 449–455. [DOI] [PubMed] [Google Scholar]
- 8. Kommagani R, Whitlatch A, Leonard MK and Kadakia MP (2010) p73 is essential for vitamin D‐mediated osteoblastic differentiation. Cell Death Differ 17, 398–407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Pike JW, Lee SM and Meyer MB (2014) Regulation of gene expression by 1,25‐dihydroxyvitamin D3 in bone cells: exploiting new approaches and defining new mechanisms. Bonekey Rep 3, 482. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Miyazono A, Yamada A, Morimura N, Takami M, Suzuki D, Kobayashi M, Tezuka K, Yamamoto M and Kamijo R (2007) TGF‐beta suppresses POEM expression through ERK1/2 and JNK in osteoblasts. FEBS Lett 581, 5321–5326. [DOI] [PubMed] [Google Scholar]
- 11. Tsukasaki M, Yamada A, Suzuki D, Aizawa R, Miyazono A, Miyamoto Y, Suzawa T, Takami M, Yoshimura K, Morimura N et al (2011) Expression of POEM, a positive regulator of osteoblast differentiation, is suppressed by TNF‐alpha. Biochem Biophys Res Commun 410, 766–770. [DOI] [PubMed] [Google Scholar]
- 12. Kurosawa T, Yamada A, Takami M, Suzuki D, Saito Y, Hiranuma K, Enomoto T, Morimura N, Yamamoto M, Iijima T et al (2015) Expression of nephronectin is inhibited by oncostatin M via both JAK/STAT and MAPK pathways. FEBS Open Bio 5, 303–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Kahai S, Lee SC, Seth A and Yang BB (2010) Nephronectin promotes osteoblast differentiation via the epidermal growth factor‐like repeats. FEBS Lett 584, 233–238. [DOI] [PubMed] [Google Scholar]
- 14. Segovia‐Mendoza M, Diaz L, Gonzalez‐Gonzalez ME, Martinez‐Reza I, Garcia‐Quiroz J, Prado‐Garcia H, Ibarra‐Sanchez MJ, Esparza‐Lopez J, Larrea F and Garcia‐Becerra R (2015) Calcitriol and its analogues enhance the antiproliferative activity of gefitinib in breast cancer cells. J Steroid Biochem Mol Biol 148, 122–131. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Fig. S1. Dose‐dependent effects of VD3 on Npnt mRNA expression in (A) C2C12, (B) HEK293, and (C) STC‐1 cells after treatment with 0, 10, 100, or 1000 ng·mL−1 for 24 h.
Fig. S2. VD3‐induced Npnt gene induction does not affect osteoblast differentiation of MC3T3‐E1 cells.
