Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Nov 1.
Published in final edited form as: J Cell Biochem. 2016 May 26;117(11):2482–2495. doi: 10.1002/jcb.25541

Sulforaphane Inhibits c-Myc-Mediated Prostate Cancer Stem-Like Traits

Avani R Vyas 1, Michelle B Moura 1, Eun-Ryeong Hahm 1, Krishna Beer Singh 1, Shivendra V Singh 1,*
PMCID: PMC5014708  NIHMSID: NIHMS791868  PMID: 26990292

Abstract

Preventive and therapeutic efficiencies of dietary sulforaphane (SFN) against human prostate cancer have been demonstrated in vivo, but the underlying mechanism(s) by which this occurs is poorly understood. Here, we show that the prostate cancer stem cell (pCSC)-like traits, such as accelerated activity of aldehyde dehydrogenase 1 (ALDH1), enrichment of CD49f+ fraction, and sphere forming efficiency, are attenuated by SFN treatment. Interestingly, the expression of c-Myc, an oncogenic transcription factor that is frequently deregulated in prostate cancer cells, was markedly suppressed by SFN both in vitro and in vivo. This is biologically relevant, because the lessening of pCSC-like phenotypes mediated by SFN was attenuated when c-Myc was overexpressed. Naturally-occurring thio, sulfinyl, and sulfonyl analogs of SFN were also effective in causing suppression of c-Myc protein level. However, basal glycolysis, a basic metabolic pathway that can also be promoted by c-Myc overexpression, was not largely suppressed by SFN, implying that, in addition to c-Myc, there might be another SFN-sensitive cellular factor, which is not directly involved in basal glycolysis, but cooperates with c-Myc to sustain pCSC-like phenotypes. Our study suggests that oncogenic c-Myc is a target of SFN to prevent and eliminate the onset of human prostate cancer.

Keywords: SULFORAPHANE, c-MYC, PROSTATE CANCER STEM CELLS, CHEMOPREVENTION

INTRODUCTION

The potential benefit of sulforaphane (SFN) occurring naturally as the L-isomer of a glucoraphanin precursor in edible cruciferous vegetables like broccoli, for chemoprevention of prostate cancer, is substantiated by preclinical data [Fahey et al., 2001; Singh et al., 2009; Keum et al., 2009; Singh and Singh, 2012]. Epidemiological studies also suggest an inverse association between dietary intake of cruciferous vegetables and the risk of prostate cancer [Kolonel et al., 2000]. Mechanistic studies using cultured prostate cancer cells have shown that SFN treatment not only causes induction of carcinogen-metabolizing enzymes, but inhibits processes and pathways relevant to cancer development [Brooks et al., 2001; Singh et al., 2004; Xu et al., 2005; Hahm and Singh, 2010]. SFN treatment induces apoptotic cell death in prostate cancer cells, whereas normal prostate epithelial cells are resistant to this effect [Choi and Singh, 2005; Singh et al., 2005]. We also showed previously that the in vivo growth of PC-3 human prostate cancer cells was significantly inhibited upon oral administration of SFN [Singh et al., 2004]. In vivo efficacy of SFN and SFN-containing broccoli sprout for chemoprevention of prostate cancer was demonstrated in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) transgenic mice [Singh et al., 2009; Keum et al., 2009].

Demonstration of SFN's chemopreventive efficacy in the TRAMP model, coupled with its suppressive effect on androgen receptor (AR) expression and function, attracted interest in its clinical investigation [Myzak et al., 2006; Kim and Singh, 2009; Singh et al., 2009; Alumkal et al., 2015]. In a phase II study of men with recurrent prostate cancer (n = 20), oral administration of 200 μmol/day of SFN-enriched broccoli sprout for 20 weeks resulted in <50% decline in serum prostate-specific antigen (PSA) levels in 35% of the patients [Alumkal et al., 2015]. Because of promising preclinical and clinical findings [Singh et al., 2009; Alumkal et al., 2015] it is important to continue to probe into the molecular mechanisms underlying cancer chemoprevention by SFN.

Recent developments in our understanding of prostate cancer biology suggest that eradication of the prostate cancer stem-like cell (pCSC) population might be necessary for prevention and treatment of this disease [Jaworska et al., 2015]. Previous studies have shown inhibition of pCSC self-renewal following SFN treatment [Kallifatidis et al., 2011; Labsch et al., 2014], but the underlying mechanism is unclear. The present study provides experimental evidence for c-Myc downregulation in SFN-mediated suppression of pCSC self-renewal. The overall rationale for the study stemmed from prior observations showing depletion of pCSC population by c-Myc silencing [Goodyear et al., 2009; Civenni et al., 2013]. Moreover, downregulation of c-Myc following SFN treatment has been documented in colon cancer cells [Kaminski et al., 2010; Zeng et al., 2011].

MATERIALS AND METHODS

ETHICS STATEMENT

Archived paraffin-embedded adenocarcinoma specimens from our previously published study in TRAMP mice were used to determine the in vivo effect of SFN administration on c-Myc protein levels [Vyas et al., 2013]. The use and care of mice were in accordance with the University of Pittsburgh Institutional Animal Care and Use Committee guidelines.

REAGENTS

F-12K medium, fetal bovine serum and penicillin/streptomycin antibiotic mixture were purchased from Invitrogen-Life Technologies (now part of Thermo Fisher Scientific, Waltham, MA). RPMI 1640 medium was purchased from Cellgro-Mediatech (now part of Corning, Manassas, VA) whereas Dulbecco's Modified Eagle's Medium (DMEM) was from Corning. SFN and its naturally-occurring analogs, including iberverin, erucin, berteroin, iberin, alyssin, cheirolin, erysolin, and alyssin sulfone were purchased from LKT Laboratories (St. Paul, MN). Dimethyl sulfoxide (DMSO), cycloheximide, and 4',6-diamidino-2-phenylindole (DAPI) were purchased from Sigma-Aldrich (St. Louis, MO). Stock solution of each compound was stored at −20°C and diluted in culture media before use. An antibody directed against total c-Myc was purchased from Cell Signaling Technology (Danvers, MA); anti phospho-c-Myc [T58] antibody was purchased from Santa Cruz Biotechnology (Dallas, TX); human-specific anti-phospho-c-Myc [S62] antibody was purchased from Abnova (Taoyuan City, Taiwan); and anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) antibody was purchased from GeneTex (Irvine, CA). Chemiluminescence reagent was purchased from Perkin-Elmer (Waltham, MA). Plasmid for c-Myc was purchased from Addgene (Cambridge, MA). PE-Rat anti-human CD49f antibody (clone GoH3) was purchased from BD Biosciences (San Jose, CA). Kits for RNA isolation, RT2 First Strand for cDNA synthesis, and RT2 Profiler PCR array (human cancer stem cells) were purchased from Qiagen (Valencia, CA).

CELL LINES

LNCaP and PC-3 human prostate cancer cell lines were purchased from the American Type Culture Collection (Manassas, VA) and cultured according to the supplier's instructions. The C4-2 cell line was obtained from UroCor (Oklahoma City, OK). The Myc-CaP cell line derived from prostate adenocarcinoma of a Hi-Myc transgenic mouse [Watson et al., 2005] was a kind gift from Dr Charles L. Sawyers (Memorial Sloan Kettering Cancer Center, New York, NY). The Myc-CaP cells were cultured in DMEM supplemented with 4.5 g/L glucose, L-glutamine, sodium pyruvate, 10% fetal bovine serum, and 1% penicillin/streptomycin antibiotic mixture. Each cell line was maintained at 37°C in a humidified atmosphere of 95% air and 5% CO2. The LNCaP, C4-2, and PC-3 cell lines used for the experiments described herein were authenticated in 2011–2012 and found to be of human origin and without any inter-species cross-contamination. Stocks of these cells were authenticated again in February 2015.

WESTERN BLOTTING

After treatment of desired cell lines with DMSO (solvent control), SFN or its analogs, cell lysates were prepared as described by us previously [Xiao et al., 2003]. Immunoreactive bands were detected with the use of enhanced chemiluminescence reagent. To determine the effect of SFN on c-Myc protein stability, PC-3 cells were treated with DMSO or 20 μM of SFN for 24 hours, and then incubated with 10 μg/mL cycloheximide for 0, 30, 60, 90, and 120 minutes. After collection, the cells were subjected to immunoblot analysis for c-Myc protein.

IMMUNOFLUORESCENCE MICROSCOPY

For microscopic examination of c-Myc protein level by immunocytochemistry, LNCaP, PC-3 or Myc-CaP cells were cultured on coverslips in 12-well plates and processed for staining of c-Myc as described by us previously for other proteins [Vyas and Singh, 2014]. Images were captured at 100× objective magnification.

QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION (qRT-PCR)

Total RNA from DMSO-treated control cells, as well as SFN-treated cells, was isolated using RNeasy kit (Qiagen). First-strand cDNA was synthesized using Superscript Reverse Transcriptase (Invitrogen-Life Technologies) with oligo(dT)20 primer. Primers for c-Myc were as follows: forward primer 5'-GCCACGTCTCCACACATCAG-3'; reverse primer 5'-TGGTGCATTTTCGGTTGTTG-3'. The quantitative PCR was done using 2× SYBR Green master mix (Applied Biosystems; now part of Thermo Fisher Scientific) with 15-second denaturation at 95°C, 60-second annealing at 60°C, and 30-second extension at 72°C for 40 cycles. The primers and amplification conditions for qRT-PCR for cancer stemness-related genes were as follows: CD24 forward: CACGCAGATTTATTCCAGTGAAAC and CD24 reverse: GACCACGAAGAGACTGGCTGTT (60°C annealing, 40 cycles); DLL4 forward: AGGACCTCAAGGGTGACGAC and DLL4 reverse: GAAGTTGAACAGCCCGAGTC (60°C annealing, 40 cycles); and ITGA6 forward: ACGGTGTTTCCCTCAAAGAC and ITGA6 reverse: GAAGAAGCCACACTTCCACA (55°C annealing, 40 cycles). Relative gene expression was calculated by the method described by Livak and Schmittgen [2001].

CELL VIABILITY AND APOPTOSIS ASSAYS

The effect of SFN and its analogs on cell viability was determined by trypan blue dye exclusion assay, essentially as described by us previously [Xiao et al., 2004]. The pro-apoptotic effect of SFN was determined by DAPI assay [Xiao et al., 2004]. Briefly, cells were treated with DMSO or SFN for 8 hours and fixed with paraformaldehyde. After washing with phosphate-buffered saline (PBS), cells were stained with DAPI (50 ng/mL) for 7 minutes. Nuclear condensation and fragmentation were examined under a fluorescence microscope at 100× objective magnification.

STABLE TRANSFECTION

PC-3 cells were stably transfected with empty pcDNA3.1 vector, or the same vector encoding c-Myc (6 μg of plasmid DNA), using Fugene6 transfection reagent (Promega, Madison, WI). The c-Myc overexpressing clones were selected by culture in medium supplemented with 800 μg/mL of G418 for > 2 months. Overexpression of c-Myc in stably transfected PC-3 cells was confirmed by immunoblotting.

COLONY FORMATION ASSAY

Four hundred cells were seeded in 6-well plates and allowed to attach during overnight incubation. Cells were then treated with DMSO or SFN. Drug-containing media were changed every third day, and the cultures were maintained for 10 days. The cells were rinsed with PBS, fixed with 100% methanol for 5 minutes, and stained with a 0.5% crystal violet solution in 20% methanol for 30 minutes at room temperature. The cells were rinsed with water and air-dried. Colonies of more than 50 cells were counted.

MEASUREMENT OF EXTRACELLULAR ACIDIFICATION RATE (ECAR)

The ECAR (a measure of glycolysis) after 24-hour treatment of empty vector-transfected cells and c-Myc-overexpressing PC-3 cells with DMSO or 10 μM SFN was measured in real time using a Seahorse XF24 Extracellular Flux Analyzer essentially as described by us previously [Hahm et al., 2011]. The cell seeding density was 4×104 cells/well.

DETERMINATION OF ALDEHYDE DEHYDROGENASE 1 (ALDH1) ACTIVITY AND CD49f+ FRACTION

ALDH1 activity was determined using the ALDEFLUOR™ kit from STEMCELL Technologies (Vancouver, BC, Canada) as described by us previously [Kim et al., 2013]. Briefly, PC-3 cells were suspended in assay buffer containing ALDH1 substrate (BODIPY™-aminoacetaldehyde; BAAA) and incubated at 37°C for 30 minutes. As a control, half of the sample was transferred to a tube containing the ALDH1 inhibitor diethylaminobenzaldehyde (DEAB). Cells were re-suspended in assay buffer, and mixed with 1 μg/mL of propidium iodide. BAAA fluorescence was measured using a flow cytometer. For flow cytometric analysis of CD49f+ fraction, cells were treated with DMSO or SFN, and trypsinized. The cells were washed twice with PBS, and treated with 20 μL of PE-conjugated anti-CD49f antibody (BD Biosciences). Cells were incubated in the dark for 30 minutes at room temperature followed by washing with PBS. The CD49f-positive cells were analyzed using BD Accuri™ C6 flow cytometer.

PROSTATE SPHERE ASSAY

Cells were seeded in ultra-low attachment plates (Corning) at a density of 800–1000 cells/well in serum-free stem cell medium (DMEM:F12-Ham) containing 1% penicillin/streptomycin, B27 (1:50, Invitrogen-Life Technologies), 5 μg/mL insulin, 20 ng/mL epidermal growth factor (R&D Systems), 20 ng/mL basic fibroblast growth factor (STEMCELL Technologies) and 1% methyl cellulose (R&D Systems). SFN, at indicated concentrations, was added to the media on the day of cell seeding for the primary sphere assay. The primary spheres were removed from the plates, washed with PBS, gently pipetted, and then passed through a strainer to obtain single cells. Single cells from the primary spheres were then re-seeded in ultra-low attachment plates for the second generation sphere formation assay, without further treatment with SFN or DMSO.

RT2 PROFILER PCR ARRAY

PC-3 cells stably transfected with empty vector (PC-3/V) or c-Myc plasmid (PC-3/Myc) were treated with 2.5 μM SFN or DMSO for 24 hours. Total RNA was extracted using the RNeasy kit, followed by reverse transcription with RT2 First Strand kit. PCR array was performed according to the supplier's instructions (Qiagen). A panel of genes was selected, according to degree of statistical significance of the differential expression, for verification of microarray results.

IMMUNOHISTOCHEMISTRY

Immunohistochemistry for total c-Myc was performed as described previously for other proteins [Powolny et al., 2011]. Briefly, antigen retrieval was performed using citrate buffer solution (pH 6). Staining was performed using an Autostainer Plus (Dako-Agilent Technologies, Carpinteria, CA). The c-Myc antibody (Santa Cruz Biotechnology, Dallas, TX) dilution was 1:50. c-Myc protein expression was quantified using Aperio ImageScope software (Leica Biosystems), with the results expressed as H-score.

RESULTS

EFFECT OF SFN TREATMENT ON c-Myc PROTEIN LEVEL

We selected an androgen-sensitive cell line (LNCaP), an androgen-independent variant of LNCaP cells (C4-2), and an androgen-insensitive human prostate cancer cell line (PC-3) to determine the effect of SFN treatment on c-Myc protein level by western blotting (Fig. 1A). Level of total c-Myc protein was decreased upon SFN exposure in each cell line, albeit with different kinetics. For example, c-Myc protein suppression following SFN exposure was maximal at the 24-hour point in C4-2 cells, whereas the effect was transient in PC-3 cells, with maximum suppression detected at 16 hours (Fig. 1A). Similar to human prostate cancer cells, SFN treatment resulted in a marked decrease in c-Myc protein level in the Myc-CaP cell line derived from prostate adenocarcinoma of a Hi-Myc transgenic mouse (Fig. 1A). SFN-mediated suppression of c-Myc protein level in LNCaP, PC-3, and Myc-CaP cells was confirmed by immunocytochemistry (Fig. 1B). c-Myc protein was detected in both cytoplasmic and nuclear compartments in LNCaP cells whereas this protein was primarily localized in the nucleus of PC-3 and Myc-CaP cells (Fig. 1B). Nevertheless, a decrease in cytoplasmic and/or nuclear c-Myc protein level was clearly visible in each cell line after 24-hour treatment with SFN (Fig. 1B).

Fig. 1.

Fig. 1

Open in a new tab

SFN treatment suppresses c-Myc protein level in prostate cancer cells. A: Western blotting for total c-Myc protein using lysates from prostate cancer cells after treatment with DMSO (solvent control) or SFN. Number above band indicates fold change in c-Myc protein level relative to DMSO-treated control after normalization for loading control (GAPDH). B: Immunocytochemistry for c-Myc protein after 24-hour treatment with DMSO (control) or 20 μM SFN (objective magnification 100×). C: Western blotting for phosphorylated c-Myc (T58 and S62) using lysates from prostate cancer cells after treatment with DMSO (control) or SFN. Each experiment was repeated 2–3 times and the results were generally consistent, except for large variability in levels of phosphorylated c-Myc in the C4-2 cells and total c-Myc in PC-3 cells.

Phosphorylation at T58 and S62 is known to regulate c-Myc stability [Sears, 2004]. The effect of SFN treatment on levels of phospho-c-Myc was either inconsistent or cell line-specific (Fig. 1C). For example, the level of T58-phosphorylated c-Myc was decreased after treatment with SFN at both doses and at each time point in LNCaP cells (Fig. 1C). In contrast, SFN-treated PC-3 cells exhibited an increase in T58-phosphorylated c-Myc especially at the 20 μM dose (Fig. 1C). The Myc-CaP cells showed a transient increase, followed by a decline in phospho-T58-c-Myc levels post-SFN exposure (Fig. 1C). S62-phosphorylated c-Myc was transiently affected by SFN treatment and this effect was inconsistent in replicate experiments. Collectively, these results indicate that a change in protein stability may not fully explain c-Myc protein suppression by SFN exposure. Consistent with this notion, stability of c-Myc protein was not affected by SFN treatment at least in the PC-3 cell line (Fig. 2A). On the other hand, SFN treatment caused a marked decrease in c-Myc mRNA levels in LNCaP, C4-2 and Myc-CaP cells (Fig. 2B), as revealed by qRT-PCR. Thus, a decrease in c-Myc protein level after SFN treatment is likely due to its transcriptional repression.

Fig. 2.

Fig. 2

Open in a new tab

SFN treatment decreases c-Myc mRNA level in prostate cancer cells. A: Effect of SFN treatment on c-Myc protein stability. The results shown are mean ± SD of 3 independent experiments. Statistical significance was determined by Student's t test. B: qRT-PCR for c-Myc mRNA expression after 24-hour treatment of cells with DMSO (control) or specified concentrations of SFN. Experiment was performed twice in triplicate and representative data from one experiment are shown as mean ± SD (n = 3). *Significantly different (P < 0.05) compared to DMSO-treated control by unpaired Student's t test. C: Viability of prostate cancer cells after 8-hour exposure to DMSO (solvent control) or the indicated concentrations of SFN. D: Apoptosis induction in prostate cancer cells after 8-hour treatment with DMSO or the indicated concentrations of SFN. For data in panels C and D, each experiment was performed twice in triplicate and combined data are shown as mean ± SD (n = 6). *Significantly different (P < 0.05) compared to DMSO-treated control by one-way ANOVA with Dunnett's adjustment.

We determined cell viability (trypan blue dye exclusion assay) and apoptosis (DAPI assay) after 8-hour treatment of cells with SFN to rule out the possibility that c-Myc protein suppression was a reflection of reduced cell number and/or increased death. Cell viability inhibition following 8-hour exposure to SFN was minimal in PC-3, LNCaP, and C4-2 cells (Fig. 2C). Apoptosis induction after 8-hour treatment with SFN was highly variable in each cell line, but statistically not significant when compared to the solvent control (Fig. 2D). Based on these results, we conclude that c-Myc downregulation by SFN is not attributable to reduced viability/apoptosis at early time points. However, the possibility that c-Myc downregulation after 24-hour treatment with SFN is partly due to reduced cell viability/apoptosis induction cannot be ruled out.

EFFECT OF NATURALLY-OCCURRING ANALOGS OF SFN ON c-Myc PROTEIN LEVEL

SFN analogs that differ in alkyl chain length (propyl, butyl, pentyl) and/or oxidation state of the sulfur (sulfinyl, sulfonyl) occur naturally in different plants [Fahey et al., 2001]. It was of interest to determine whether c-Myc protein suppression was optimal with the 4-methylsulfinyl side chain found in SFN. Initially, we determined the effect of SFN analogs (chemical formulae shown in Fig. 3A) on Myc-CaP cell viability by trypanblue dye exclusion assay and the results are shown in Fig. 3B. Forty eight-hour exposure to each test compound resulted in a dose-dependent decrease in Myc-CaP cell viability (Fig. 3B). However, erysolin and alyssin sulfone were relatively more effective than SFN in inhibiting Myc-CaP cell viability (Fig. 3B). Each analog was effective in reducing c-Myc protein level (Fig. 3C).

Fig. 3.

Fig. 3

Open in a new tab

Naturally-occurring analogs of SFN decrease cell viability and c-Myc protein level in Myc-CaP cells. A: Chemical formulae of SFN and its analogs used in the present study. B: Effect of SFN analogs (48-hour treatment) on viability of Myc-CaP cells (trypan blue dye exclusion assay). Combined results from two independent experiments are shown as mean ± SD (n = 6). *Significantly different (P < 0.05) compared to DMSO-treated control by one-way ANOVA with Dunnett's adjustment. C: Western blots showing effect of SFN analogs (24-hour treatment) on c-Myc protein level in Myc-CaP cells. D: Basal ECAR in PC-3/V and PC-3/Myc cells after 24-hour treatment with DMSO (control) or 10 μM SFN. Combined results from two independent experiments are shown as mean ± SD (n = 4). Overexpression of c-Myc in PC-3/Myc cells was confirmed by western blotting as depicted in the inset. E: Colony formation in PC-3/V and PC-3/Myc cells after exposure to DMSO or SFN. Experiment was repeated twice and data from one experiment are shown. Data in each bar graph represent mean ± SD (n = 3). Statistical significance (P < 0.05) was tested by one-way ANOVA followed by Newman-Keuls multiple comparison test. *Significant compared to DMSO control for each cell type, and **significant (P < 0.05) between PC-3/V and PC-3/Myc cells.

EFFECT OF SFN TREATMENT AND/OR c-Myc OVEREXPRESSION ON ECAR

c-Myc is the primary regulator of glycolysis in tumor cells, as many components of the glycolytic machinery are its transcriptional targets [Dang et al., 2009]. We used the Seahorse XF24 Flux Analyzer to determine whether ECAR (a measure of glycolysis) is affected by SFN treatment and/or c-Myc overexpression in PC-3 cells. Overexpression of c-Myc in stably transfected PC-3/Myc cells was confirmed by western blotting (Fig. 3D, inset). Mean basal ECAR was slightly higher in PC-3/Myc cells relative to empty vector-transfected (PC-3/V) control cells, but the difference was not statistically significant (Fig. 3D). Similarly, SFN treatment had no impact on basal ECAR in PC-3/V and PC-3/Myc cells (Fig. 3D). These results indicate that SFN treatment does not affect glycolysis in the PC-3 cell line. On the other hand, c-Myc overexpression partially counteracted inhibition of colony formation by low concentrations of SFN (Fig. 3E).

EFFECT OF SFN TREATMENT ON pCSC PHENOTYPE

A role for Myc in self-renewal and maintenance of pCSC has been suggested previously [Goodyear et al., 2009; Civenni et al., 2013]. For example, Myc is highly expressed in prostate cancer cells with pCSC phenotype (prostate spheres from PC-3 cells) [Civenni et al., 2013]. Therefore, it was of interest to determine whether the pCSC fraction is affected by SFN treatment and/or c-Myc overexpression. Initially, un-transfected PC-3 cells and Myc-CaP cells were used to optimize the inhibitory effect of SFN on pCSC markers, including ALDH1 activity and the CD49f+ fraction. Flow histograms of ALDH1 activity, in the absence or presence of its inhibitor DEAB, are shown in Fig. 4A. Quantitation of ALDH1 activity showed dose-dependent inhibition in PC-3 and Myc-CaP cells upon treatment with SFN (Fig. 4A). SFN-mediated inhibition of pCSC was confirmed by analysis of the CD49f+ fraction (Fig. 4B) and prostate sphere formation assay (Fig. 4C). Notably, SFN treatment resulted in a dose-dependent and statistically significant decrease in 2nd-generation spheres, even without further drug treatment of the 1st-generation spheres (Fig. 4C). Compared to PC-3, the Myc-CaP cell line showed an increased fraction of pCSC markers, as observed ~10% enrichment in ALDH1 activity. The drug concentration needed for SFN-mediated inhibition of ALDH1 activity and sphere formation requires is markedly lower than that needed to induce apoptosis [Singh et al., 2004].

Fig. 4.

Fig. 4

Open in a new tab

SFN treatment inhibits self-renewal of pCSC. A: Representative flow histograms showing ALDH1 activity (BAAA fluorescence) and its quantitation (bar graph) in PC-3 cells or Myc-CaP cells after 72-hour (for PC-3) or 24-hour (for Myc-CaP) treatment with DMSO (control) or SFN. DEAB was used as a control (ALDH1 inhibitor). B: Quantitation of the CD49f+ population in PC-3 and Myc-CaP cells following 24-hour treatment with DMSO (control) or SFN. C: Representative images of 1st-generation prostate spheres after 2 days of treatment with DMSO (control) or SFN treatment (100× magnification, scale bar = 100 μm) and their quantitation (bar graphs). The 2nd-generation spheres were scored from single cells obtained from the 1st-generation spheres without further treatment (DMSO-control or SFN) 6 days after cell seeding. Each experiment was done at least twice, and the results from one such experiment are shown. The results shown are mean ± SD (n = 3). *Significantly different (P < 0.05) compared to control by one-way ANOVA with Dunnett's adjustment.

EFFECT OF c-Myc OVEREXPRESSION ON SFN-MEDIATED INHIBITION OF pCSC

As can be seen in Fig. 5A, c-Myc overexpression resulted in a marked increase in ALDH1 activity. ALDH1 activity was significantly decreased after SFN treatment of both PC-3/V and PC-3/Myc cells (Fig. 5B). In addition, c-Myc overexpression partially counteracted ALDH1 activity inhibition by SFN (Fig. 5B). The results for the CD49f+ (Fig. 5C) and prostate sphere analyses (Fig. 5D) were generally consistent, and revealed that c-Myc overexpression leads to: (a) an increase in the pCSC fraction, and (b) partial reduction in against SFN-mediated pCSC inhibition. For example, 2nd-generation prostate spheres were not detected with the 5 μM dose in PC-3/V cells (Fig. 5D). On the other hand, a small number of 2nd-generation prostate spheres were seen with the same SFN dose in PC-3/Myc cells (Fig. 5D). These results indicate that c-Myc protein suppression likely contributed, at least in part, to inhibition of pCSC-like traits by SFN.

Fig. 5.

Fig. 5

Open in a new tab

c-Myc overexpression partly attenuates SFN-mediated inhibition of pCSC. A: Representative flow histograms showing ALDH1 activity in PC-3/V and PC-3/Myc cells after 24-hour treatment with DMSO (control) or SFN. B: Quantitation of ALDH1 activity. C: The CD49f+ fraction in PC-3/V and PC-3/Myc cells after 24-hour treatment with DMSO (control) or SFN. D: Representative images of prostate spheres and their quantitation in PC-3/V and PC-3/Myc cells after 6 (1st-generation) or 12 days (2nd-generation) of DMSO (control) or SFN treatment (100× magnification, scale bar = 100 μm). Results in each bar graph represent mean ± SD (n = 3). Statistical significance of difference was tested by one-way ANOVA followed by Newman-Keuls multiple comparison test. *Significant (P < 0.05) compared to corresponding DMSO-treated control for each cell type. **Significant (P < 0.05) between PC-3/V and PC-3/Myc cells.

EFFECT OF SFN TREATMENT AND/OR c-Myc OVEREXPRESSION ON CANCER STEM CELL-RELATED GENES

To probe the molecular regulators that are downstream of c-Myc in SFN-mediated inhibition of pCSC, we compared expression of genes involved in cancer stem cell maintenance in PC-3/V and PC-3/Myc cells after 24-hour treatment with DMSO (solvent control) or SFN by qRT-PCR. The Venn diagram in Fig. 6A shows overlap of genes altered by c-Myc overexpression and/or SFN treatment relative to DMSO-treated PC-3/V cells (PC-3/V_DMSO). Table I lists genes for which expression was altered by c-Myc overexpression and/or SFN treatment. The magnitude of the gene expression change is shown by cluster analysis (Fig. 6B). A set of genes was identified using the cutoff of P < 0.05 (2-sided Student's t test) and fold-regulation change of ≥ 1.5. The genes upregulated by c-Myc overexpression, at P<0.05, included CD24, DLL4, FOXA2, GSK3B, ITGA6, JAK2, TWIST2 and ZEB2 (Fig. 6C). SFN treatment of PC-3/V cells (PC-3/V_SFN) resulted in statistically significant downregulation of CD24 (** P < 0.06), ITGA6 (* P < 0.05), and ZEB2 (* P < 0.05). Interestingly, SFN treatment was also able to reduce c-Myc-induced expression of some of these genes (Fig. 6C). Gene expression changes for CD24, DLL4, and ITGA6 were confirmed by qRT-PCR, after 24-hour treatment of PC-3/V and PC-3/Myc cells with DMSO (control) and 2.5 or 5 μM SFN (Fig. 7A). These results indicate that the mechanism of SFN-mediated inhibition of pCSC, downstream of c-Myc, likely involves multiple regulators.

Fig. 6.

Fig. 6

Open in a new tab

Effect of SFN treatment and/or c-Myc overexpression on expression of cancer stem cell-related genes in PC-3/V and PC-3/Myc cells. A: Venn diagram showing overlap of gene expression modulation in different groups. B: Cluster diagram indicating changes in gene expression. C: Bar graph showing fold regulation of designated genes compared to that in the PC-3/V_DMSO control group. Significant compared to control (* P < 0.05; ** P < 0.06 by Student's t test). #Significant (P < 0.05) difference between the indicated groups (PC-3/Myc_DMSO vs. PC-3/Myc_SFN).

Table I.

Modulation of gene expression by SFN treatment (24 h) in PC-3/V and PC-3/Myc cells

Gene PC-3/V_DMSO vs. PC-3/V_SFN PC-3/V_DMSO vs. PC-3/Myc_DMSO vs. PC-3/Myc_SFN PC-3/V_SFN vs.
P Fold P Fold P Fold P Fold
Cancer Stem Cell Markers
ABCB5 0.44 1.30 0.74 0.92 0.50 1.20 0.71 0.85
ALCAM 0.53 1.07 0.004 1.51 0.96 0.99 0.003 1.40
ALDH1A1 0.35 0.36 0.35 0.27 0.56 1.07 0.56 0.81
ATXN1 0.76 1.06 0.89 0.98 0.50 0.86 0.31 0.80
BMI1 0.06 0.84 0.03 0.87 0.80 0.98 0.94 1.01
CD24 0.05 0.20 <0.001 3.60 <0.05 0.68 <0.001 12.00
CD34 0.35 4.50 0.34 1.70 0.76 1.79 0.35 0.68
CD38 0.35 24.15 0.97 1.13 0.21 1.29 0.35 0.06
CD44 0.62 1.07 <0.05 0.75 0.92 1.00 0.02 0.70
ENG 0.01 0.77 <0.05 0.76 0.07 0.73 0.03 0.72
ETFA 0.96 0.99 <0.001 0.71 0.56 1.06 0.08 0.76
FLOT2 0.49 0.94 0.24 0.89 <0.05 0.85 0.03 0.81
GATA3 0.08 0.70 0.34 0.82 0.52 0.80 0.98 0.93
ITGA2 1.00 1.03 0.06 1.48 0.40 0.87 0.13 1.25
ITGA4 0.37 0.62 0.83 10.79 0.38 0.66 0.03 11.51
ITGA6 0.01 0.87 <0.001 1.75 0.12 0.82 0.002 1.64
ITGB1 0.85 1.02 0.93 1.01 0.12 0.94 0.10 0.93
KIT 0.58 1.00 0.52 0.86 0.41 1.68 0.61 1.43
MS4A1 0.33 0.50 0.34 0.40 0.29 2.13 0.28 1.69
MUC1 0.03 0.63 0.15 0.77 0.35 0.78 0.95 0.95
PECAM1 0.90 0.90 0.55 1.10 0.70 0.87 0.77 1.06
PROM1 0.75 1.24 <0.001 8.08 0.01 0.48 0.08 3.11
PTPRC 0.96 0.71 0.26 0.55 0.36 1.72 0.72 1.34
THY1 0.45 0.96 0.39 0.88 0.24 1.41 0.31 1.30
Proliferation
EGF 0.77 1.04 0.50 0.94 0.38 1.08 0.79 0.98
ERBB2 0.75 1.03 0.03 1.37 0.05 0.75 0.97 0.99
KITLG 0.66 1.05 <0.001 2.13 0.37 0.89 0.003 1.80
LIN28B 0.91 1.34 0.05 6.07 0.54 0.84 0.027 3.78
NOS2 0.41 1.18 0.15 1.70 0.83 1.32 0.46 1.91
Self-Renewal
BMP7 0.24 0.72 0.02 0.15 0.06 3.72 0.35 0.77
DNMT1 0.31 0.90 0.71 1.02 0.003 0.84 0.53 0.96
FGFR2 0.11 0.38 0.44 1.19 0.13 0.48 0.83 1.50
Pluripotency
KLF4 0.93 0.99 <0.001 2.75 0.62 0.97 <0.001 2.70
LIN28A 0.68 0.88 0.38 0.77 0.93 0.94 0.55 0.82
MYC 0.72 1.04 0.03 1.26 0.39 1.06 0.09 1.29
NANOG 0.92 1.77 0.72 1.87 0.29 0.86 0.70 0.90
POU5F1 0.44 0.81 0.84 1.14 0.69 0.93 0.20 1.31
SOX2 0.49 1.18 0.18 1.55 0.86 1.04 0.99 1.36
Asymmetric Division
FOXP1 0.55 0.92 0.01 1.75 0.06 0.72 0.03 1.37
HDAC1 0.21 0.92 0.002 1.47 0.11 0.86 0.002 1.37
MYCN 0.39 1.44 0.49 1.22 0.82 1.49 0.71 1.27
SIRT1 0.43 0.94 0.004 1.39 0.01 0.85 <0.001 1.26
WNT1 0.45 1.40 0.16 3.10 0.74 0.56 0.79 1.23
Migration & Metastasis
AXL 0.31 0.91 0.001 1.42 0.37 0.90 0.02 1.40
ID1 0.30 0.86 0.004 1.29 0.26 0.92 0.02 1.38
IL8 0.10 1.29 0.17 0.89 0.07 1.13 0.08 0.77
KLF17 0.50 1.14 0.18 0.75 0.12 0.74 0.007 0.49
PLAT 0.46 0.89 0.06 0.54 0.86 0.93 0.22 0.56
PLAUR 0.77 1.03 0.37 1.10 0.51 1.09 0.27 1.17
SNAI1 0.42 1.16 0.98 1.03 0.37 0.90 0.12 0.80
TWIST1 0.19 0.90 0.06 1.19 0.02 0.86 0.03 1.14
TWIST2 0.20 0.57 <0.001 784.17 0.47 1.22 <0.001 1689.23
ZEB1 0.64 0.95 0.14 1.27 0.11 0.90 0.04 1.20
ZEB2 0.003 0.77 <0.001 0.70 0.35 1.09 0.89 0.98
Loss of Stemness
DACH1 0.38 0.34 0.41 2.13 0.14 0.46 0.98 2.82
FOXA2 0.26 0.76 <0.001 4.50 <0.001 0.67 <0.001 3.94
Signal Transduction Pathways
Hippo Signalling
LATS1 0.35 0.90 0.58 0.95 0.19 0.88 0.44 0.93
MERTK 0.47 0.94 0.30 1.08 0.21 0.84 0.87 0.97
SAV1 0.08 0.85 <0.001 1.93 0.22 0.89 <0.001 2.02
TAZ 0.53 0.93 0.39 1.08 0.13 0.89 0.75 1.04
WWC1 0.53 0.95 0.27 1.17 0.77 0.99 0.02 1.23
YAP1 0.14 0.91 0.007 1.51 0.13 0.83 0.003 1.37
Signal Transduction Pathways
Hedgehog Signalling
PTCH1 0.49 0.91 0.06 1.56 0.25 0.77 0.17 1.32
SMO 0.60 0.93 0.14 0.75 0.20 0.75 0.02 0.61
Notch Signalling
DIL1 0.65 1.20 0.33 2.21 0.29 0.55 0.61 1.01
DLL4 0.52 0.58 <0.001 27.91 <0.001 0.28 <0.001 13.26
JAG1 0.35 0.86 0.04 1.42 0.43 0.88 0.06 1.44
MAML1 0.82 1.03 0.10 1.22 0.09 0.83 0.87 0.99
NOTCH1 0.89 1.00 0.06 1.24 0.85 1.01 0.02 1.25
NOTCH2 0.66 1.13 0.43 0.13 0.44 7.31 0.37 0.87
WNT Signalling
DKK1 0.22 0.80 0.10 0.81 0.08 0.79 0.20 0.80
EPCAM 0.17 0.81 <0.001 1.97 0.12 0.79 0.003 1.91
FZD7 0.01 0.83 <0.05 0.53 <0.05 0.80 <0.05 0.51
WNT1 0.45 1.40 0.16 3.10 0.74 0.56 0.79 1.23
PI3K/AKT/mTOR Signalling
ABCG2 0.24 0.69 <0.001 0.13 0.11 2.11 0.06 0.40
GSK3B 0.44 0.91 <0.001 1.66 0.003 0.90 <0.001 1.65
STAT/NFκB Signalling
IKBKB 0.16 0.85 0.54 0.95 0.001 0.75 0.04 0.84
JAK2 0.28 0.88 0.001 1.89 0.003 0.68 <0.001 1.47
NFKB1 0.46 0.94 0.01 1.28 0.03 0.85 0.04 1.15
Open in a new tab

Fig. 7.

Fig. 7

Open in a new tab

c-Myc overexpression increases mRNA levels of cancer stem cell-related genes. A: qRT-PCR of CD24, DLL4, and ITGA6 mRNA after 24-hour treatment with DMSO (control) or the specified concentrations of SFN. The results shown are mean ± SD (n = 3). *Significantly different (P < 0.05) compared to corresponding DMSO-treated control or ** between PC-3/V and PC-3/Myc by one-way ANOVA with Newman-Keuls multiple comparison test. B: Immunohistochemical images for c-Myc protein expression in representative sections of prostate adenocarcinoma from a control and SFN-treated TRAMP mouse (40× objective magnification, scale bar = 50 μm). C: Quantitation of c-Myc protein staining in TRAMP tumors. The results shown are mean ± SD (n = 5). Statistical analysis was performed using Student's t-test.

EFFECT OF SFN ADMINISTRATION ON c-Myc PROTEIN LEVEL IN TRAMP ADENOCARCINOMA

We performed immunohistochemistry to determine whether SFN administration to TRAMP mice affects c-Myc protein expression in prostate adenocarcinoma. Fig. 7B depicts immunohistochemical images for c-Myc protein expression in TRAMP tumor sections. Although the expression of c-Myc protein in the tumor sections was not uniform, the mean H-score in non-necrotic adenocarcinoma from SFN-treated mice was about 43% lower in comparison with control. This difference was not significant, due to the large variability and small sample size (Fig. 7C). Nevertheless, these results showed a trend for a decrease in c-Myc protein level in the tumors after SFN administration in TRAMP mice. Because a very mild regimen with 3 times/week SFN administration was employed in this study [Vyas et al., 2013], it is possible that a more intense schedule (e.g. daily treatment) is required to detect a significant decrease in c-Myc protein level in vivo.

DISCUSSION

Literature data suggest that c-Myc, which plays an important role in cellular metabolism and proliferation [Dang et al., 2009; Koh et al., 2010], is a valid target for prevention and treatment of prostate cancer. For example, overexpression of Myc has been shown to induce prostate intraepithelial neoplasia in association with Nkx3.1 loss in mouse luminal epithelial cells [Iwata et al., 2010]. The c-Myc oncogene is amplified in metastatic prostate cancer, and nuclear Myc overexpression seems to be an early event in prostate carcinogenesis [Jenkins et al., 1997; Gurel et al., 2008; Koh et al., 2010]. Moreover, molecular similarities exist in Myc-driven murine prostate cancer and the human disease [Zhang et al., 2000; Ellwood-Yen et al. 2003]. The present study reveals that c-Myc protein level is markedly decreased following SFN treatment in both androgen-sensitive (LNCaP) and androgen-independent (PC-3 and C4-2) human prostate cancer cells. In PC-3 cells, SFN-mediated downregulation of c-Myc appears to be transient, whereas in LNCaP and C4-2 cells, the effect is sustained for at least 24-hours post-treatment. Because Myc-CaP cells are also sensitive to growth inhibition and c-Myc downregulation by SFN, it is reasonable to postulate that c-Myc-driven prostate cancer is inhibited by this class of dietary bioactive compounds. Further work is needed to systematically explore this possibility.

The present study reveals that expression of c-Myc mRNA is decreased after treatment with SFN in LNCaP, C4-2, and Myc-CaP cells. Although the c-Myc promoter contains binding sites for several transcription factors, promoter deletion analysis has revealed a critical role for AP-1 and E2F1 in its transcriptional regulation [Elliott et al., 2001; Vartanian et al., 2011]. Because SFN treatment has been shown to activate both AP-1 and E2F1 in prostate cancer cells [Xu et al., 2006; Choi et al., 2007], their involvement in c-Myc mRNA suppression by SFN is highly unlikely. The possibility that SFN targets certain microRNA (e.g. let-7a) [Sampson et al., 2007] to suppress c-Myc expression cannot be excluded. Additional experimentation is necessary to explore this possibility.

SFN-mediated downregulation of c-Myc protein has been observed previously in human colon cancer cell lines [Kaminski et al., 2010; Zeng et al., 2011], but the functional relevance of this effect was not thoroughly studied. Because many glycolysis mediators are transcriptional targets of c-Myc [Dang et al., 2009], we suspected a decrease in glycolysis in SFN-treated cells. However, at least at a 10-μM dose, basal ECAR is not affected in PC-3 cells after 24-hour SFN treatment. Additionally, c-Myc overexpression does not significantly increase ECAR in the PC-3 cell line. Consistent with literature data [Goodyear et al., 2009; Civenni et al., 2013], however, we found enrichment of the pCSC fraction when c-Myc is overexpressed, as evidenced by increases in ALDH1 activity, the CD49f+ fraction, and sphere forming efficiency. SFN-mediated inhibition of pCSC has been demonstrated previously [Kallifatidis et al., 2011; Labsch et al., 2014], but the mechanism for this pharmacological effect was not explored. The present study reveals that c-Myc downregulation may be partly responsible for inhibition of pCSC by SFN. It also shows that c-Myc overexpression partially counteracts SFN-mediated inhibition of the pCSC phenotype and colony formation efficiency. Consistent with this observation, SFN reduces induction of cancer stemness-related genes in c-Myc-overexpressing PC-3/Myc cells. Furthermore, some of these genes are downregulated when PC-3/V cells, which do not overexpress c-Myc, are exposed to SFN.

It is interesting to note that the SFN-treated PC-3/V cells exhibited a trend toward decreased TWIST2 expression (not statistically significant) when compared to the DMSO-treated control group. On the other hand, ~1000-fold increase in TWIST2 expression was detected DMSO-treated PC-3/Myc cells, which overexpress c-Myc, when compared to DMSO-treated PC-3/V cells. Twist2 has been shown to contribute to breast cancer progression by promoting self-renewal of cancer stem-like cells [Fang et al., 2011], and more recently, to promote self-renewal of liver cancer stem-like cells by regulating CD24 [Liu et al., 2014]. Unlike certain other molecules (e.g., CD24, DLL4, FOXA2, GSK3B, and JAK2), however, TWIST2 overexpression in PC-3/Myc cells is not reversed by SFN treatment. Our interpretation of these results is that while c-Myc overexpression undoubtedly increases TWIST2 expression, it is not responsible for the inhibition of pCSC-like traits by SFN treatment.

We have previously shown that SFN treatment induces apoptotic cell death in prostate cancer cells [Singh et al., 2004; Singh et al., 2005]. SFN administration to TRAMP mice also resulted in an increased number of apoptotic bodies in prostate adenocarcinoma, but the difference from control was not found to be statistically significant [Singh et al., 2009]. In cellular systems, SFN-induced apoptosis is mediated by both intrinsic (mitochondria-mediated) and extrinsic (death receptor-mediated) caspase pathways [Singh et al., 2005]. It is interesting to note that overexpression of c-Myc sensitizes cancer cells to apoptosis induction by different stimuli [Hoffman and Liebermann, 2008]. The mechanism by which c-Myc overexpression influences apoptosis is quite complex, and involves both intrinsic and extrinsic caspase pathways. It would be interesting, in future, to determine whether the proapoptotic effect of SFN is affected by c-Myc overexpression.

In conclusion, the present study reveals that c-Myc protein is susceptible to downregulation by SFN treatment in both androgen-responsive and androgen-independent human prostate cancer cells. The primary underlying mechanism of SFN-mediated downregulation of c-Myc appears to be its transcriptional repression. The present study also demonstrates that SFN has the ability to eliminate the pCSC fraction, at least in part, by down regulating c-Myc.

ACKNOWLEDGMENTS

This work was supported by the grant RO1 CA115498-09 awarded by the National Cancer Institute at the National Institutes of Health (S.V. Singh). This research used the Flow Cytometry Facility and Tissue and Research Pathology Services that are supported, in part, by a grant from the National Cancer Institute at the National Institutes of Health (P30 CA047904).

Footnotes

Conflict of Interest Statement: None of the authors has any conflict of interest.

REFERENCES

  1. Alumkal JJ, Slottke R, Schwartzman J, Cherala G, Munar M, Graff JN, Beer TM, Ryan CW, Koop DR, Gibbs A, Gao L, Flamiatos JF, Tucker E, Kleinschmidt R, Mori M. A phase II study of sulforaphane-rich broccoli sprout extracts in men with recurrent prostate cancer. Invest New Drugs. 2015;33:480–489. doi: 10.1007/s10637-014-0189-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Brooks JD, Paton VG, Vidanes G. Potent induction of phase 2 enzymes in human prostate cells by sulforaphane. Cancer Epidemiol Biomarkers Prev. 2001;10:949–954. [PubMed] [Google Scholar]
  3. Choi S, Lew KL, Xiao H, Herman-Antosiewicz A, Xiao D, Brown CK, Singh SV. D,L-Sulforaphane-induced cell death in human prostate cancer cells is regulated by inhibitor of apoptosis family proteins and Apaf-1. Carcinogenesis. 2007;28:151–162. doi: 10.1093/carcin/bgl144. [DOI] [PubMed] [Google Scholar]
  4. Choi S, Singh SV. Bax and Bak are required for apoptosis induction by sulforaphane, a cruciferous vegetable-derived cancer chemopreventive agent. Cancer Res. 2005;65:2035–2043. doi: 10.1158/0008-5472.CAN-04-3616. [DOI] [PubMed] [Google Scholar]
  5. Civenni G, Malek A, Albino D, Garcia-Escudero R, Napoli S, Di Marco S, Pinton S, Sarti M, Carbone GM, Catapano CV. RNAi-mediated silencing of Myc transcription inhibits stem-like cell maintenance and tumorigenicity in prostate cancer. Cancer Res. 2013;73:6816–6827. doi: 10.1158/0008-5472.CAN-13-0615. [DOI] [PubMed] [Google Scholar]
  6. Dang CV, Le A, Gao P. MYC-induced cancer cell energy metabolism and therapeutic opportunities. Clin Cancer Res. 2009;15:6479–6483. doi: 10.1158/1078-0432.CCR-09-0889. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Elliott MJ, Dong YB, Yang H, McMasters KM. E2F-1 up-regulates c-Myc and p14ARF and induces apoptosis in colon cancer cells. Clin Cancer Res. 2001;7:3590–3597. [PubMed] [Google Scholar]
  8. Ellwood-Yen K, Graeber TG, Wongvipat J, Iruela-Arispe ML, Zhang J, Matusik R, Thomas GV, Sawyers CL. Myc-driven murine prostate cancer shares molecular features with human prostate tumors. Cancer Cell. 2003;4:223–238. doi: 10.1016/s1535-6108(03)00197-1. [DOI] [PubMed] [Google Scholar]
  9. Fahey JW, Zalcmann AT, Talalay P. The chemical diversity and distribution of glucosinolates and isothiocyanates among plants. Phytochemistry. 2001;56:5–51. doi: 10.1016/s0031-9422(00)00316-2. [DOI] [PubMed] [Google Scholar]
  10. Fang X, Cai Y, Liu J, Wang Z, Wu Q, Zhang Z, Yang CJ, Yuan L, Ouyang G. Twist2 contributes to breast cancer progression by promoting an epithelial-mesenchymal transition and cancer stem-like cell self-renewal. Oncogene. 2011;30:4707–4720. doi: 10.1038/onc.2011.181. [DOI] [PubMed] [Google Scholar]
  11. Goodyear SM, Amatangelo MD, Stearns ME. Dysplasia of human prostate CD133hi sub-population in NOD-SCIDS is blocked by c-myc anti-sense. Prostate. 2009;69:689–698. doi: 10.1002/pros.20918. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Gurel B, Iwata T, Koh CM, Jenkins RB, Lan F, Dang CV, Hicks JL, Morgan J, Cornish TC, Sutcliffe S, Isaacs WB, Luo J, De Marzo AM. Nuclear MYC protein overexpression is an early alteration in human prostate carcinogenesis. Mod Pathol. 2008;21:1156–1167. doi: 10.1038/modpathol.2008.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Hahm ER, Moura MB, Kelley EE, Van Houten B, Shiva S, Singh SV. Withaferin A-induced apoptosis in human breast cancer cells is mediated by reactive oxygen species. PLoS One. 2011;6:e23354. doi: 10.1371/journal.pone.0023354. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Hahm ER, Singh SV. Sulforaphane inhibits constitutive and interleukin 6 induced activation of signal transducer and activator of transcription 3 in prostate cancer cells. Cancer Prev Res. 2010;3:484–494. doi: 10.1158/1940-6207.CAPR-09-0250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Hoffman B, Liebermann DA. Apoptotic signaling by c-MYC. Oncogene. 2008;27:6462–6472. doi: 10.1038/onc.2008.312. [DOI] [PubMed] [Google Scholar]
  16. Iwata T, Schultz D, Hicks J, Hubbard GK, Mutton LN, Lotan TL, Bethel C, Lotz MT, Yegnasubramanian S, Nelson WG, Dang CV, Xu M, Anele U, Koh CM, Bieberich CJ, De Marzo AM. MYC overexpression induces prostatic intraepithelial neoplasia and loss of Nkx3.1 in mouse luminal epithelial cells. PLoS One. 2010;5:e9427. doi: 10.1371/journal.pone.0009427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jaworska D, Król W, Szliszka E. Prostate cancer stem cells: Research advances. Int J Mol Sci. 2015;16:27433–27449. doi: 10.3390/ijms161126036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jenkins RB, Qian J, Lieber MM, Bostwick DG. Detection of c-myc oncogene amplification and chromosomal anomalies in metastatic prostatic carcinoma by fluorescence in situ hybridization. Cancer Res. 1997;57:524–531. [PubMed] [Google Scholar]
  19. Kallifatidis G, Labsch S, Rausch V, Mattern J, Gladkich J, Moldenhauer G, Büchler MW, Salnikov AV, Herr I. Sulforaphane increases drug-mediated cytotoxicity toward cancer stem-like cells of pancreas and prostate. Mol Ther. 2011;19:188–195. doi: 10.1038/mt.2010.216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kaminski BM, Loitsch SM, Ochs MJ, Reuter KC, Steinhilber D, Stein J, Ulrich S. Isothiocyanate sulforaphane inhibits protooncogenic ornithine decarboxylase activity in colorectal cancer cells via induction of the TGF-β/Smad signaling pathway. Mol Nutr Food Res. 2010;54:1486–1496. doi: 10.1002/mnfr.201000105. [DOI] [PubMed] [Google Scholar]
  21. Keum YS, Khor TO, Lin W, Shen G, Kwon KH, Barve A, Li W, Kong AN. Pharmacokinetics and pharmacodynamics of broccoli sprouts on the suppression of prostate cancer in transgenic adenocarcinoma of mouse prostate (TRAMP) mice: Implication of induction of Nrf2, HO-1 and apoptosis and the suppression of Akt-dependent kinase pathway. Pharm Res. 2009;26:2324–2331. doi: 10.1007/s11095-009-9948-5. [DOI] [PubMed] [Google Scholar]
  22. Kim SH, Sehrawat A, Singh SV. Dietary chemopreventative benzyl isothiocyanate inhibits breast cancer stem cells in vitro and in vivo. Cancer Prev Res. 2013;6:782–790. doi: 10.1158/1940-6207.CAPR-13-0100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kim SH, Singh SV. D,L-Sulforaphane causes transcriptional repression of androgen receptor in human prostate cancer cells. Mol Cancer Ther. 2009;8:1946–1954. doi: 10.1158/1535-7163.MCT-09-0104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Koh CM, Bieberich CJ, Dang CV, Nelson WG, Yegnasubramanian S, De Marzo AM. MYC and prostate cancer. Genes Cancer. 2010;1:617–628. doi: 10.1177/1947601910379132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Kolonel LN, Hankin JH, Whittemore AS, Wu AH, Gallagher RP, Wilkens LR, John EM, Howe GR, Dreon DM, West DW, Paffenbarger RS. Vegetables, fruits, legumes and prostate cancer: A multiethnic case-control study. Cancer Epidemiol Biomarkers Prev. 2000;9:795–804. [PubMed] [Google Scholar]
  26. Labsch S, Liu L, Bauer N, Zhang Y, Aleksandrowicz E, Gladkich J, Schönsiegel F, Herr I. Sulforaphane and TRAIL induce a synergistic elimination of advanced prostate cancer stem-like cells. Int J Oncol. 2014;44:1470–1480. doi: 10.3892/ijo.2014.2335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Liu AY, Cai Y, Mao Y, Lin Y, Zheng H, Wu T, Huang Y, Fang X, Lin S, Feng Q, Huang Z, Yang T, Luo Q, Ouyang G. Twist2 promotes self-renewal of liver cancer stem-like cells by regulating CD24. Carcinogenesis. 2014;35:537–545. doi: 10.1093/carcin/bgt364. [DOI] [PubMed] [Google Scholar]
  28. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  29. Myzak MC, Hardin K, Wang R, Dashwood RH, Ho E. Sulforaphane inhibits histone deacetylase activity in BPH-1, LnCaP and PC-3 prostate epithelial cells. Carcinogenesis. 2006;27:811–819. doi: 10.1093/carcin/bgi265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Powolny AA, Bommareddy A, Hahm ER, Normolle DP, Beumer JH, Nelson JB, Singh SV. Chemopreventative potential of the cruciferous vegetable constituent phenethyl isothiocyanate in a mouse model of prostate cancer. J Natl Cancer Inst. 2011;103:571–584. doi: 10.1093/jnci/djr029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, Petrelli NJ, Dunn SP, Krueger LJ. MicroRNA let-7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007;67:9762–9770. doi: 10.1158/0008-5472.CAN-07-2462. [DOI] [PubMed] [Google Scholar]
  32. Sears RC. The life cycle of C-Myc: From synthesis to degradation. Cell Cycle. 2004;3:1133–1137. [PubMed] [Google Scholar]
  33. Singh AV, Xiao D, Lew KL, Dhir R, Singh SV. Sulforaphane induces caspase-mediated apoptosis in cultured PC-3 human prostate cancer cells and retards growth of PC-3 xenografts in vivo. Carcinogenesis. 2004;25:83–90. doi: 10.1093/carcin/bgg178. [DOI] [PubMed] [Google Scholar]
  34. Singh SV, Singh K. Cancer chemoprevention with dietary isothiocyanates mature for clinical translational research. Carcinogenesis. 2012;33:1833–1842. doi: 10.1093/carcin/bgs216. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Singh SV, Srivastava SK, Choi S, Lew KL, Antosiewicz J, Xiao D, Zeng Y, Watkins SC, Johnson CS, Trump DL, Lee YJ, Xiao H, Herman-Antosiewicz A. Sulforaphane-induced cell death in human prostate cancer cells is initiated by reactive oxygen species. J Biol Chem. 2005;280:19911–19924. doi: 10.1074/jbc.M412443200. [DOI] [PubMed] [Google Scholar]
  36. Singh SV, Warin R, Xiao D, Powolny AA, Stan SD, Arlotti JA, Zeng Y, Hahm ER, Marynowski SW, Bommareddy A, Desai D, Amin S, Parise RA, Beumer JH, Chambers WH. Sulforaphane inhibits prostate carcinogenesis and pulmonary metastasis in TRAMP mice in association with increased cytotoxicity of natural killer cells. Cancer Res. 2009;69:2117–2125. doi: 10.1158/0008-5472.CAN-08-3502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Vartanian R, Masri J, Martin J, Cloninger C, Holmes B, Artinian N, Funk A, Ruegg T, Gera J. AP-1 regulates cyclin D1 and c-MYC transcription in an AKT-dependent manner in response to mTOR inhibition: Role of AIP4/Itch-mediated JUNB degradation. Mol Cancer Res. 2011;9:115–130. doi: 10.1158/1541-7786.MCR-10-0105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Vyas AR, Hahm ER, Arlotti JA, Watkins S, Stolz DB, Desai D, Amin S, Singh SV. Chemoprevention of prostate cancer by D,L-sulforaphane is augmented by pharmacological inhibition of autophagy. Cancer Res. 2013;73:5985–5995. doi: 10.1158/0008-5472.CAN-13-0755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Vyas AR, Singh SV. Functional relevance of D,L-sulforaphane-mediated induction of vimentin and plasminogen activator inhibitor-1 in human prostate cancer cells. Eur J Nutr. 2014;53:843–852. doi: 10.1007/s00394-013-0588-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Watson PA, Ellwood-Yen K, King JC, Wongvipat J, LeBeau MM, Sawyers CL. Context-dependent hormone-refractory progression revealed through characterization of a novel murine prostate cancer cell line. Cancer Res. 2005;65:11565–11571. doi: 10.1158/0008-5472.CAN-05-3441. [DOI] [PubMed] [Google Scholar]
  41. Xiao D, Srivastava SK, Lew KL, Zeng Y, Hershberger P, Johnson CS, Trump DL, Singh SV. Allyl isothiocyanate, a constituent of cruciferous vegetables, inhibits proliferation of human prostate cancer cells by causing G2/M arrest and inducing apoptosis. Carcinogenesis. 2003;24:891–897. doi: 10.1093/carcin/bgg023. [DOI] [PubMed] [Google Scholar]
  42. Xiao D, Choi S, Johnson DE, Vogel VG, Johnson CS, Trump DL, Lee YJ, Singh SV. Diallyl trisulfide-induced apoptosis in human prostate cancer cells involves c-Jun N-terminal kinase and extracellular-signal regulated kinase-mediated phosphorylation of Bcl-2. Oncogene. 2004;23:5594–5606. doi: 10.1038/sj.onc.1207747. [DOI] [PubMed] [Google Scholar]
  43. Xu C, Shen G, Chen C, Gélinas C, Kong AN. Suppression of NF-κB and NF-κB-regulated gene expression by sulforaphane and PEITC through IκBα, IKK pathway in human prostate cancer PC-3 cells. Oncogene. 2005;24:4486–4495. doi: 10.1038/sj.onc.1208656. [DOI] [PubMed] [Google Scholar]
  44. Xu C, Shen G, Yuan X, Kim JH, Gopalkrishnan A, Keum YS, Nair S, Kong AN. ERK and JNK signaling pathways are involved in the regulation of activator protein 1 and cell death elicited by three isothiocyanates in human prostate cancer PC-3 cells. Carcinogenesis. 2006;27:437–445. doi: 10.1093/carcin/bgi251. [DOI] [PubMed] [Google Scholar]
  45. Zhang X, Lee C, Ng P-Y, Rubin M, Shabsigh A, Buttyan R. Prostatic neoplasia in transgenic mice with prostate-directed overexpression of c-myc oncoprotein. Prostate. 2000;43:278–285. doi: 10.1002/1097-0045(20000601)43:4<278::aid-pros7>3.0.co;2-4. [DOI] [PubMed] [Google Scholar]
  46. Zeng H, Trujillo ON, Moyer MP, Botnen JH. Prolonged sulforaphane treatment activates survival signaling in nontumorigenic NCM460 colon cells but apoptotic signaling in tumorigenic HCT116 colon cells. Nutr Cancer. 2011;63:248–255. doi: 10.1080/01635581.2011.523500. [DOI] [PubMed] [Google Scholar]

RESOURCES