Skip to main content
PLOS One logoLink to PLOS One
. 2016 Sep 8;11(9):e0162625. doi: 10.1371/journal.pone.0162625

Development of Recombinant Lactococcus lactis Displaying Albumin-Binding Domain Variants against Shiga Toxin 1 B Subunit

Petra Zadravec 1,2, Lucie Marečková 3, Hana Petroková 3, Vesna Hodnik 4,5, Milica Perišić Nanut 1, Gregor Anderluh 4,5, Borut Štrukelj 1,2, Petr Malý 3, Aleš Berlec 1,*
Editor: Oscar P Kuipers6
PMCID: PMC5015993  PMID: 27606705

Abstract

Infections with shiga toxin-producing bacteria, like enterohemorrhagic Escherichia coli and Shigella dysenteriae, represent a serious medical problem. No specific and effective treatment is available for patients with these infections, creating a need for the development of new therapies. Recombinant lactic acid bacterium Lactococcus lactis was engineered to bind Shiga toxin by displaying novel designed albumin binding domains (ABD) against Shiga toxin 1 B subunit (Stx1B) on their surface. Functional recombinant Stx1B was produced in Escherichia coli and used as a target for selection of 17 different ABD variants (named S1B) from the ABD scaffold-derived high-complex combinatorial library in combination with a five-round ribosome display. Two most promising S1Bs (S1B22 and S1B26) were characterized into more details by ELISA, surface plasmon resonance and microscale thermophoresis. Addition of S1Bs changed the subcellular distribution of Stx1B, completely eliminating it from Golgi apparatus most likely by interfering with its retrograde transport. All ABD variants were successfully displayed on the surface of L. lactis by fusing to the Usp45 secretion signal and to the peptidoglycan-binding C terminus of AcmA. Binding of Stx1B by engineered lactococcal cells was confirmed using flow cytometry and whole cell ELISA. Lactic acid bacteria prepared in this study are potentially useful for the removal of Shiga toxin from human intestine.

Introduction

Infections with Shiga toxin (Stx)-producing bacteria, such as Stx-producing Escherichia coli (STEC) and Shigella dysenteriae, cause diarrhea and hemorrhagic colitis in human, and may further develop into a life-threatening hemolytic uremic syndrome (HUS), characterized by microangiopathic hemolytic anemia, thrombocytopenia, and acute renal failure [1, 2]. Shiga toxin, the major virulence factor of STEC, can be produced as Stx1 variants (Stx1 and Stx1c), Stx2 variants (Stx2, Stx2c, Stx2d, Stx2e, Stx2f) or both variants in different combinations [3]. Stx produced by S. dysenteriae is almost identical to Stx1 produced by E. coli. All members of Stx family are composed of monomeric enzymatically active A subunit (StxA), which is non-covalently attached to pentameric B subunit (StxB). The latter is responsible for binding to globotriaosylceramide receptor (Gb3) on the cell surface, or to globotetraosylceramide (Gb4) receptor in the case of Stx2e [3].

Human infection with STEC is mainly associated with ingestion of contaminated food, and can quickly spread among humans causing massive outbreaks of STEC diseases. After ingestion, STEC pass through gastrointestinal (GI) tract, where they colonize the lower GI tract and release Stx into the gut lumen [1]. Stx is absorbed by the intestinal epithelium into the blood circulation and targets tissues expressing Gb3 receptor [4]. Once bound, the toxin is very effectively internalized into the cells by endocytosis and transported through the retrograde pathway, whereby active A subunit is cleaved by furin and translocated to cytosol, where it functions as a highly specific N-glycosidase, inhibiting protein synthesis and causing cell death [5, 6].

Currently, there is no specific treatment for patients with developed HUS. Recommended management relies on supportive therapy that includes fluid and electrolyte balance, nutritional support, management of hypertension and renal transplantation [4]. Because the conventional antibiotic treatment of STEC infections increases the risk of developing HUS by induction of Stx expression and toxin release into the gut, there is a need for the development of new therapies. Various potential therapeutic strategies are currently under development, and include compounds directed against STEC, Stx receptor analogues, receptor synthesis inhibitors, antitoxin antibodies, inhibitors of toxin transport, processing and function, natural products and also novel antimicrobial therapies (reviewed in [7, 8]). Monoclonal antibodies against Stx1 and Stx2 are currently furthest in development [7].

As an alternative to conventional monoclonal antibodies, more than 20 different types of small single-domain non-immunoglobulin (non-Ig) scaffolds are being used to produce binding proteins against more than a hundred different targets [9]. Compared to antibodies, engineered non-Ig scaffolds are stable, robust and soluble monomeric proteins, that lack disulfide bonds, are easily and inexpensively produced in large amounts in bacteria, exhibit effective tissue penetration, rapid distribution and elimination, can be easily modified by conjugation or gene fusion technology and can exert multivalency or multispecificity [9, 10]. Among them, a highly complex combinatorial library, derived from the three-helix bundle of the albumin-binding domain (ABD) scaffold of streptococcal protein G has been used successfully for the selection of human interferon gamma binders [11], interleukin (IL)-23 receptor antagonist [12] and binders of human prostate secretory protein 94 (PSP94) [13]. In this work we applied the ABD scaffold library for the selection of unique binders of Stx1B.

Probiotics, including E. coli Nissle 1917 [14], E. coli 1307 [15], and several Lactobacillus strains [16] were reported as effective inhibitors of growth of STEC. Lactic acid bacteria (LAB) are often used as probiotics and are, because of their safety, also considered for genetic engineering and delivery of therapeutic proteins to the human intestine. We have previously demonstrated effective display of two non-Ig scaffolds, Affibodies [17] and DARPins [18], on the surface of recombinant or nonrecombinant lactic acid bacteria (LAB), by using the C terminal part of the lactococcal AcmA protein (cA) containing the lysine motif (LysM) domain as the cell wall anchor [19–22]. Engineered probiotic LAB with surface displayed Stx-binding protein could be a promising candidate for treating infections caused by STEC or S. dysenteriae. A similar approach has already been used in the development of recombinant E. coli bacteria with an engineered oligosaccharide biosynthesis pathway that resulted in the production of Stx receptor mimic on the bacterial surface [23, 24].

The goal of the present study was to engineer recombinant LAB Lactococcus lactis capable of binding Stx1B, by displaying binding proteins against Stx1B on the surface of L. lactis. We chose StxB as a target for selecting binding proteins against Stx, because it is capable of binding to the receptor and is not toxic by itself. We have expressed, purified and characterized recombinant Stx1B, and used it for the development of ABD-derived binding proteins S1Bs against Stx1B. S1Bs were biochemically, biophysically and functionally characterized, displayed on the surface of L. lactis and their ability to bind Stx1B was confirmed.

Materials and Methods

Bacterial strains, media and culture conditions

The bacterial strains used in this study are listed in Table 1. E. coli strains DH5α, BL21 (DE3) and BL21 (DE3) BirA were grown at 37°C, unless otherwise stated, with aeration in lysogeny broth (LB) medium supplemented with 50 μg/mL kanamycin. L. lactis NZ9000 was grown in M-17 medium (Merck) supplemented with 0.5% glucose (GM-17) and 10 μg/mL of chloramphenicol at 30°C without aeration.

Table 1. Strains, plasmids, gene and primers used in this study.

Strain, plasmid, gene or primer Relevant features or sequence (5’– 3’) Reference
Strains
E. coli
 DH5α endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR F- Φ80dlacZΔM15 Δ(lacZYA-argF)U169, hsdR17(rK- mK+), λ– Invitrogen
 BL21 (DE3) F–ompT gal dcm lon hsdSB (rB- mB-) λ(DE3) Novagen
 BL21 (DE3) BirA BL21 (DE3) with biotin ligase gene Novagen
L. lactis NZ9000 MG1363 nisRK ΔpepN [28–31]
Plasmids
 pET28b(+) Kanr, E. coli expression vector Novagen
 pNZ8148 pSH71 derivative, PnisA, Cmr, nisin-controlled expression [28–31]
 pSDLBA3b pNZ8148 containing gene fusion of spUsp-LEIS, b-dom and cA [17]
 pET28-Stx1B pET28b containing Stx1B gene This work
 pET28- H6-TolA-Avi pET28b containing tolA gene with AviTag on C-terminus [12]
 pET28-H6-S1Bx-TolA-Avi pET28b containing gene fusion of different variants of S1B clones with TolA and AviTag This work
 pET28-H6-ABDwt-TolA-Avi pET28b containing gene fusion of ABDwt with TolA and AviTag
 pSD-S1B22 pNZ8148 containing gene fusion of Usp45 signal peptide, S1B22 and cA This work
 pSD-S1B26 pNZ8148 containing gene fusion of Usp45 signal peptide, S1B26 and cA This work
 pSD-ABDwt pNZ8148 containing gene fusion of Usp45 signal peptide, ABDwt and cA This work
 pSD-H6-ABDwt pNZ8148 containing gene fusion of Usp45 signal peptide, H6 tag, ABDwt and cA This work
Gene
 Stx1B CCATGGCAAAAAAAACATTATTAATAGCTGCATCGCTTTCATTTTTTTCAGCAAGTGCGCTGGCGACGCCTGATTGTGTAACTGGAAAGGTGGAGTATACAAAATATAATGATGACGATACCTTTACAGTTAAAGTGGGTGATAAAGAATTATTTACCAACAGATGGAATCTTCAGTCTCTTCTTCTCAGTGCGCAAATTACGGGGATGACTGTAACCATTAAAACTAATGCCTGTCATAATGGAGGGGGATTCAGCGAAGTTATTTTTCGTCTCGAG This work
Primer
 setB-rev ACCGCGGATCCAGGTAA [11, 12]
 EWT5-ABDforN1 TTCCTCCATGGGTATGAGAGGATCGCATCACCATCACCATCACCTGGCGGAAGCTAAAGTCTTAGCTAAC [13]
 EWT5-ABDforN2 TTCCTCCATGGGCAGCAGCCATCACCATCACCATCACCTGGCGGAAGCTAAAGTCTTAGCTAAC [13]
 ABD-F GGATCCCTGGCGGAAGCTAAAGTC This work
 S1B22-R GAATTCAGGTAAACGAGCTAAAATAGCATCTATC This work
 S1B26-R GAATTCAGGTAACGCAGCTAAAATCCAATC This work
 ABDwt-R GAATTCAGGTAATGCAGCTAAAATTTCATCTATC This work
 ABDH6-F AGGATCCCATCACCATCACCATCAC This work

Preparation of recombinant Stx1B subunit

A gene for Stx1B was designed (Table 1), synthesized de novo by ATG Biosynthetics (Merzhausen, Germany) and cloned to plasmid pET28b using NcoI/XhoI restriction sites, yielding pET28-Stx1B. Overnight culture of E. coli BL21 (DE3) harboring plasmid pET28-Stx1B was diluted (1:100) in 1 L of fresh LB medium and grown to optical density A600 = 3.5–4.0. Expression of fusion protein Stx1B with hexa-histidine (H6) tag was induced by addition of 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 3 h at 28°C. The culture was centrifuged at 5000 × g for 15 min and the pellet resuspended in 30 mL of equilibration/wash (Eq/W) buffer (50 mM NaH2PO4, 300 mM NaCl, pH 7.0). The cells were lysed with a cycle of freezing and thawing, and with 3 fold 5 min sonication with a UPS200S sonifier (Hielscher, Teltow, Germany). After cell lysis, the suspension was centrifuged at 15000 × g for 20 min and the supernatant stored. Inclusion bodies were dissolved in Eq/W buffers with increasing concentrations of guanidinium HCl (1M, 3M and 6M) for 6 h or overnight at 4°C, followed at each step by centrifugation and supernatant removal. Stx1B-H6 soluble in Eq/W with 6 M guanidinium HCl was isolated with BD Talon metal affinity resin (BD Biosciences) according to the manufacturer’s instructions, using batch/gravity-flow column purification and imidazole elution (elution buffer: 45 mM NaH2PO4, 270 mM NaCl, 5.4 M guanidinium HCl, 150 mM imidazole, pH 7.0). Fractions containing pure Stx1B were pooled and stored. We screened different refolding conditions according to [25–27]. Recombinant Stx1B was refolded by 100-fold rapid dilution in solubilization buffer (50 mM Tris-HCl with 0.5 M arginine and 0.01% Brij-35, pH 7.5).

Determination of molecular weight of Stx1B subunit

The molecular weight and oligomerization status of Stx1B were determined using analytical gel filtration chromatography (1.2 × 60 cm, 7 mL/h flow rate with 15 min fraction collection time) on a polyacrylamide gel Bio-Gel P-100 (Bio Rad, Hercules, USA), due to Stx1B cross-reactivity with a Superdex column (GE Healthcare), for size exclusion chromatography. Six proteins of 14.4–97 kDa (Amersham Low molecular weight Calibration Kit, GE Healthcare) were used as standards.

In vitro binding of Stx1B to globotriaosylceramide (Gb3) receptor

Binding of Stx1B to its natural receptor Gb3 was determined by enzyme-linked immunosorbent assay (Gb3 ELISA) as described [32]. Receptor Gb3 was purchased from Matreya LLC (PA, USA) and dissolved in chloroform/methanol (2:1). 100 μL of Gb3 solution with concentration 10 μg/mL was used to coat Nunc PolySorp Strips (Thermo Fisher Scientific) overnight in laminar flow to evaporate chloroform/methanol. After washing with phosphate buffer saline with 0.05% Tween 20 (PBST) and blocking with 2% bovine serum albumin (BSA) in PBST, 100 μL of serial twofold dilutions of recombinant Stx1B in triplicate (starting with 1 μg/mL in 0.2% BSA in PBST) were added to the wells and incubated for 1 h. Bound Stx1B-H6 was detected with primary THE™ His tag Antibody (GenScript, NJ, USA) (dilution 1:2000 in 0.2% BSA in PBST) and with horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody (Merck Millipore, Darmstadt, Germany) (dilution 1:5000 in 0.2% BSA in PBST). The color was developed by the addition of 100 μL substrate buffer (150 mM Na2HPO4, 50 mM citric acid, pH 6.0) and 100 μL 3,3',5,5'-tetramethylbenzidine (TMB) substrate (Sigma-Aldrich, MO, USA) for 15 min at room temperature. The reaction was terminated by the addition of 50 μL 2 M H2SO4 and absorbances were read at 450 nm using Infinite M1000 (Tecan, Salzburg, Austria). No Stx1B was added to 0.2% BSA in PBST in control wells (zero concentration), while all the other steps were performed as described above. All samples were measured in triplicates.

Internalization of recombinant Stx1B by HeLa cells

HeLa cells (American Type Culture Collection) were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% GlutaMAX and pen-strep in 24-wells plates on coverslips. Fluorescein isothiocyanate (FITC)-labelled Stx1B (10 μg/mL in 300 μL of fresh medium) was added to the cells and incubated for 1 h on 37°C. The cells were then washed with PBS, fixed with 4% paraformaldehyde (PFA) in PBS for 15 min and permeabilized with 0.1% triton X-100 in PBS for 10 min. Non-specific staining was blocked with 3% BSA in PBS for 1 h. Golgi apparatus (GA) was labelled with mouse monoclonal anti-human Golgin-97 primary antibody (0.4 μg/ml in 3% BSA for 1 h, Life Technologies, CA, USA) and with Alexa Fluor 555-conjugated donkey anti-mouse secondary antibody (1:1000 in 3% BSA for 1 h, A-31570, Life technologies). Coverslips were mounted with ProlongGold Antifade reagent with 4',6-diamidino-2-phenylindole (DAPI; Invitrogen). Immunostained cells were visualized with LSM-710 confocal microscope (Carl Zeiss, Germany), and images were acquired and processed using ZEN 2010 B SP1 software (Carl Zeiss).

Selection of Stx1B binders by ribosome display

The combinatorial DNA library of ABD protein was generated as described [11, 12], in vitro transcribed and the resulting mRNA was translated using E. coli extract (EasyXpress Protein Synthesis Mini Kit, QIAGEN, Germany). The translated products were used for the selection of Stx1B binders by ribosome display. Preselection of BSA binders was performed in wells coated with 3% BSA before the first round of the selection. The five rounds of ribosome display selections were performed in Maxisorp (NUNC, Denmark) microtiter plates coated with decreasing concentrations of recombinant Stx1B (round 1 and 2: 25 μg/mL, round 3: 10 μg/mL, round 4: 4 μg/mL, round 5: 1 μg/mL) and blocked with 3% BSA. All incubation and washing steps were performed as described [12] and after each round, mRNA was eluted from the bound ribosome complex with elution buffer (50 mM Tris-acetate, pH 7.5, 150 mM NaCl, 50 mM EDTA) containing 50 μg/mL of Sacharomyces cerevisiae RNA. Purified RNA was transcribed into cDNA using reverse transcription with setB-rev primer (Table 1). Double-stranded DNA was produced by PCR using EWT5–ABDforN1 and setB-rev primers (Table 1) and fused with T7 promoter, RBS and truncated tolA sequences for the next round of in vitro translation. After the last round of the selection the final PCR product was amplified with EWT5–ABDforN2 (Table 1) primer instead of the EWT5–ABDforN1 primer, and cloned to pET28-H6-TolA-Avi plasmid (Table 1) via NcoI/BamHI sites, yielding pET28-H6-S1B-TolA-Avi. The resulting plasmid mixture was transformed into E. coli DH5α, and plasmid DNA from randomly picked colonies was sequenced.

Sequence analysis and clustering of selected S1B binders

DNA sequencing of S1B variants was carried out by the Centre for DNA Sequencing of the Institute of Microbiology of the ASCR, v.v.i. (Prague, Czech Republic) or GATC Biotech (Constance, Germany). Amino acid sequences of selected clones were aligned and a similarity tree was constructed using Molecular Evolutionary Genetics Analysis tool (MEGA), version 6.0.6 (http://www.megasoftware.net/). Randomized sequences between residues 20 and 46 were compared, as the N-terminal amino acid positions 1–19 were non-randomized.

ELISA screening of Stx1B binders

S1B clones with unique (previously unreported) sequences were transformed into E. coli BL21 (DE3) BirA (Table 1) and expressed for 4 h in 2.5 mL cultures with the addition of 1 mM IPTG and 50 μM D-biotin. Bacteria were pelleted at 15000 × g for 5 min and resuspended in 0.01% PBST with 200 μg/mL lysozyme. Cells were lysed with three cycles of freezing at -80°C and thawing at 37°C for 30 min. Cell lysate was centrifuged for 15 min and 50 μL of supernatant was loaded to a PolySorp microtiter plate (Nunc), previously coated with 10 μg/mL of recombinant Stx1B and blocked with 1% BSA (Carl Roth GmbH, Karlsruhe, Germany). After 1 h incubation at RT, the plate was washed five times with PBST, and ABD-binders were detected with HRP-conjugated streptavidin (1:5000 in 1% BSA/PBST). The color was developed with the addition of 0.5 mg/mL o-phenylenediamine (OPD, Sigma-Aldrich, St. Louis, USA) and 0.01% H2O2 in 0.1 M citrate buffer (pH 5.0) for 5 min. The reaction was stopped with the addition of 2 M H2SO4 and absorbance read at 492 nm. Lysate containing the wild-type albumin binding domain (ABDwt) in fusion with TolA protein was loaded to wells coated with 10 μg/mL of human serum albumin (Abcam, Cambridge, UK) to serve as a positive control. Negative background was recorded in wells loaded with 1% BSA/ PBST without S1B-TolA lysate. All samples were measured in triplicates.

Expression and purification of selected H6-S1B-TolA-Avi variants

Selected H6-S1B-TolA-Avi variants were expressed in 200 mL cultures as described above. Cells were harvested by centrifugation at 5000 × g for 20 min, resuspended in 10 mL binding buffer (20 mM Na-phosphate, 500 mM NaCl, 10 mM imidazole, pH 7.4) and lysed by sonication for 3 min. Lysates were centrifuged at 10000 × g for 20 min and supernatants were kept. Fusion proteins were purified by fast protein liquid chromatography (Äkta Purifier, GE Healthcare) on 1 mL HisTrap HP columns (GE Healthcare) or BD Talon metal affinity resin (BD Biosciences, Palo Alto, USA) using batch/gravity-flow column purification and imidazole elution according to the manufacturer instructions. Eluted fractions were analyzed by SDS-PAGE, pooled and concentrated by ultrafiltration using Amicon Ultra (Merck Millipore; Darmstadt, Germany). Purified H6-S1B-TolA-Avi fusion proteins were dialyzed against PBS and used for ELISA tests, surface plasmon resonance analysis and microscale thermophoresis.

Assessment of binding of S1B variants to Stx1B by ELISA

The microtiter plate was coated overnight at 4°C with 10 μg/mL of recombinant Stx1B in coating buffer (100 mM Na-bicarbonate/carbonate, pH 9.6). Wells were washed with PBST and blocked with 1% BSA in PBST for 2 h at RT. Serially diluted H6-S1B-TolA-Avi fusion proteins or ABDwt control in 1% BSA/PBST were loaded for 1 h. Following washing, bound S1B clones were detected with the addition of HRP-conjugated streptavidin (dilution 1:5000 in 1% BSA/PBST). The color was developed with 0.5 mg/mL OPD and 0.01% H2O2 in 0.1 M citrate buffer (pH 5.0) for 5 min. The reaction was stopped by the addition of 2 M H2SO4 and absorbance read at 492 nm. All samples were measured in triplicates.

Assessment of binding of S1B variants to Stx1B by surface plasmon resonance (SPR)

SPR measurements were performed with Biacore T100 (GE Healthcare) at 25°C. In the first setup we tested the binding of S1B variants prepared in fusion with TolA spacer protein and AviTag to Stx1B captured on a Series S sensor chip CM5 (Biacore, GE Healthcare). CM5 sensor chip was activated using Amine coupling Kit (GE Healthcare) according to the manufacturer’s instructions. For immobilization of Stx1B standard PBS buffer (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4) was used as running buffer. Stx1B was diluted into 10 mM sodium acetate buffer, pH 5.0, to a final concentration of 20 μg/mL, and injected over the second flow cell. The final immobilization level was approximately 890 response units (RU). The first flow cell was empty and served as a reference cell to control the level of non-specific binding. All experiments were performed with running buffer PBS with 300 mM NaCl (300 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4, 0.005% P20). Each compound was injected for 2 min at a flow-rate of 20 μL/min, and dissociation was monitored for 3 min. Regeneration of the sensor surface was achieved with two 30 s pulses of 50 mM NaOH. The following concentrations were used for titration: 0, 15.625, 31.25, 62.5, 125, 250, 500, 1000, 2000 nM; concentration 62.5 nM was repeated at the end of the concentration series.

In the reverse setup H6-S1B22-TolA-Avi or H6-S1B26-TolA-Avi variants were immobilized on a sensor chip CM5. CM5 sensor chip activation and immobilization of H6-S1B-TolA-Avi variants was performed as described above, except that two injections were needed to reach the final immobilization level of approximately 1100 RU. All experiments were performed with running buffer PBS with 300 mM NaCl (300 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.4, 0.005% P20). Each compound was injected for 1 min at a flow-rate of 10 μL/min, and dissociation was monitored for 60 s. Regeneration of the sensor surface was achieved with 25 mM NaOH for 6 s at a flow-rate of 20 μL/min. The following concentrations were used for titration: 62.5, 125, 250, 500, 1000, 2000, 4000 nM and the concentration of 500 nM was repeated at the end of the concentration series. Each titration was performed in triplicate. The obtained data was evaluated using Biacore T100 Evaluation software. The sensorgrams were reference and blank subtracted and the Steady State Affinity model was applied to calculate the affinity constant (Kd). The average of three repeated experiments was used for final Kd determination.

Assessment of binding of S1B variants to Stx1B by microscale thermophoresis (MST)

Purified Stx1B in PBS buffer (pH 7.4) was fluorescently labelled according to the manufacturer’s instructions (L001™ Monolith NT.115 Protein Labelling Kit RED-NHS, NanoTemper Technologies GmbH, Germany). The stock solution of labelled Stx1B was diluted in PBS buffer with 300 mM NaCl and 0.1% Tween 20 to a final concentration of 10 nM. Sixteen serial dilutions of purified non-labelled S1B22 and S1B26 were prepared in standard PBS buffer, starting with concentrations of 35 μM and 45 μM, respectively. Serial dilutions of S1B variants were mixed 1:1 with a solution of 10 nM labelled Stx1B to a final volume of 20 μL per dilution. Prepared mixtures were incubated for 5 min at room temperature and centrifuged for 5 min at 15,000 g to remove any aggregates. The samples were filled into the Premium coated capillaries (NanoTemper Technologies GmbH, Germany). Measurements were carried out with the Monolith NT.115 instrument (NanoTemper Technologies GmbH) at 25°C using 90% LED power and 20% MST power. Data analysis was completed with NanoTemper analysis software using fluorescence change for Kd determination. The SDS-denaturation test was performed to confirm that the fluorescence change is the consequence of specific binding of ligand to the target and not due to loss of fluorescence caused by ligand-induced surface absorption or aggregation. The average of three repeated experiments was considered for final Kd calculation.

Fluorescence-based thermal shift assay (TSA)

The thermal stability of S1B proteins was tested in PBS and 50 mM Tris, 300 mM NaCl, pH 8.0 (T50N300) buffers with the addition of 5× Sypro Orange dye (Sigma-Aldrich, St. Luis, USA) to the 25 μL total volume. TSA was performed with the real-time PCR Detection System CFX touch (BIO-Rad Laboratories, Hercules, USA) according to [12]. The data were analyzed with CFX Manager Software and the melting temperatures (Tm) determined using the first derivative spectra.

Influence of S1B binders on internalization of Stx1B into HeLa cells

S1B22, S1B26 and ABDwt (final concentration 100 μg/ml) were preincubated with Alexa Fluor 488-labelled recombinant Stx1B (Alexa Fluor 488® Protein Labeling Kit, Thermo Fisher Scientific, Massachusetts, USA—final concentration 5 μg/ml) for 1 h in complete DMEM medium at 37°C. Stx1B, ABDwt, S1B22 or S1B26 were used alone as corresponding controls. Afterwards, the mixtures of protein and Alexa Fluor 488-Stx1B were added to HeLa cells grown in 24 well plates (flow cytometry) or on coverslips (fluorescence microscopy) and incubated for 1 h at 37°C. After incubation, the media were discarded and cells were washed with PBS and prepared for further analysis.

For flow cytometric analysis cells were detached by mild trypsinization (TripleSelect, Life Technologies) washed three times with PBS and measurements were performed on a BD FACS Calibur instrument (Beckton Dickinson, Franklin Lakes, NJ) as described in [18] using BD CellQuest Pro software for data acquisition and analysis (Beckton Dickinson).

For fluorescence microscopy the coverslips-grown cells were either labeled with PKH26 dye for general cell membrane labeling or stained with antibodies for GA labelling. Membrane labelling was performed with Red Fluorescent Cell Linker Kit containing PKH26 dye (Sigma-Aldrich, St. Louis, USA) following manufacturer’s instructions. Afterwards, the cells were fixed with 2% PFA and washed with PBS. For labeling with antibodies cells were first fixed in 2% PFA, permeabilized with 0.1% Triton X-100 and incubated for 1 h in 3% BSA in PBS for blocking of non-specific staining. For labeling of GA primary mouse monoclonal anti-Golgin-97 (CDFX) antibody (1:100 in 3% BSA in PBS, Santa Cruz Biotechnology, Dallas, USA, sc-59820) and polyclonal Goat anti-Mouse Secondary Antibody conjugated with Alexa Fluor 633 (1:1000 in 1% BSA in PBS, Thermo Fisher Scientific, A-21052) were used. Cells were washed three times with PBS after every of the above mentioned steps. After the last washing step cells were stained with DAPI (Sigma-Aldrich, St. Louis, USA) and mounted with Prolong Gold Antifade Reagent (Life technologies). Immunostained cells were visualized with LSM-710 confocal microscope equipped with ZEN 2010 B SP1 software (Carl Zeiss).

Molecular cloning and expression of S1B-cA variants in L. lactis

Genes of S1B variants without TolA spacer were amplified with Phusion polymerase (New England Biolabs, Beverly, MA) using pET28-H6-S1Bx-TolA-Avi template and ABD-F primer and the corresponding S1B-R primer (Table 1). The gene for ABDwt was amplified using pET28-H6-ABDwt-TolA-Avi template and ABD-F/ABDwt-R (Table 1) primer pair, while H6 tag was added with ABDH6-F/ABDwt-R primer. All PCR fragments were ligated to pJET 1.2 cloning vector and cloned into plasmid pSDLBA3b, using BamHI and EcoRI restriction enzymes (New England Biolabs). Plasmid DNA was isolated with NucleoSpin Plasmid kit (Macherey and Nagel, Düren, Germany), with an additional lysozyme treatment for L. lactis. Lactococci were transformed by electroporation using a Gene Pulser II apparatus (Bio-Rad, Hercules, CA) according to MoBiTec GmbH instructions (Goettingen, Germany). Plasmids constructed in the study are listed in Table 1. S1B-cA variants were expressed in L. lactis NZ9000 in 10 mL cultures. Bacterial suspensions were grown to an A600 of 0.8, followed by induction with 25 ng/mL nisin (Fluka) for 3 h [17, 18, 33, 34]. Resulting suspensions were stored at 4°C for flow cytometric analysis or whole cell ELISA test.

Flow cytometry and whole cell ELISA

For flow cytometric analyses, 10 μL of L. lactis suspensions were added to Tris-buffered saline (TBS) and centrifuged. Cells were resuspended in TBS with Alexa 488-labelled recombinant Stx1B (20 μg/mL) and incubated at RT with constant shaking at 100 rpm. All washings, centrifugation steps and measurements were performed as described [18, 35].

The whole cell ELISA was carried out according to [36] with a few modifications. L. lactis suspension with surface-displayed S1B variant or ABDwt was centrifuged and resuspended in PBS to an A600 of 1.0. 750 μL of the suspensions were washed twice in PBS and incubated with 500 μL of recombinant Stx1B (20 μg/mL in PBS) for 2 h, followed by additional washing with PBS. Bound toxin subunit was detected with the addition of 200 μL of Anti-Verotoxin I/SLT 1b (antiStx1B) primary antibody (diluted 1:20 in PBS, Abcam, Cambridge, UK) for 1 h, followed by washing and incubation with 200 μL of (HRP)-conjugated Goat anti-mouse IgG secondary antibody (diluted 1:500 in PBS, Merck Millipore, Darmstadt, Germany). All incubations were performed at RT in a tube rotator. After incubation with secondary antibody, cells were washed, first with PBS and then with substrate buffer (150 mM Na2HPO4, 50 mM citric acid, pH 6.0). Cells were finally resuspended in 1 mL of substrate buffer, and 100 μL of suspensions, or 1:5 dilutions in substrate buffer, were loaded on a microtiter plate. The color was developed with the addition of 100 μL TMB substrate and the reaction stopped after 15 min by the addition of 50 μL of 2 M sulphuric acid. Absorbances were read at 450 nm.

Statistical analyses

Statistical analyses were performed with GraphPad Prism 5.0 software. Student’s t test was used to compare the significance of differences between samples and control.

Results and Discussion

Production of recombinant Stx1B

Recombinant Shiga toxin 1B subunit (Stx1B) fusion protein with hexa histidine (H6) tag was produced in E. coli as a target for the selection of high affinity binders derived from ABD scaffold by using a novel procedure for its recombinant expression. The gene for Stx1B was synthesized and cloned to pET28b vector. Various expression conditions (growth at 37°C, 30°C and 25°C, induction at optical densities (A600) 0.5, 1, 2 and 3.5–4.0) were tested. The highest total amount of Stx1B-H6 expression was achieved by growing the bacteria at 37°C to A600 = 3.5–4.0, followed by induction with 1 mM IPTG for 3 h at 28°C. The majority of the fusion protein was produced in the form of inclusion bodies, which were dissolved in 6 M guanidinium HCl and efficiently purified with immobilized metal affinity chromatography (IMAC). We screened different refolding conditions and Stx1B-H6 was effectively solubilized by the rapid dilution method using 0.5 M arginine and 0.01% Brij-35-containing 50 mM Tris buffer, conditions similar to those reported by Oneda and Inouye [27] for another protein. The solubilized product was stored in Tris or PBS buffer for characterization.

Characterization of recombinant Stx1B

The molecular weight of recombinant Stx1B-H6 was determined by analytical gel filtration chromatography. It was eluted from calibrated column as one sharp symmetrical peak, with a molecular weight corresponding to the pentameric form of recombinant Stx1B.

The functionality of recombinant Stx1B was tested by its ability to bind to immobilized globotriosyl ceramide (Gb3) receptor in vitro, and by its internalization into HeLa cells, which naturally contain Gb3 on the surface. Strong, specific and concentration depended binding of recombinant Stx1B to immobilized Gb3 receptor was demonstrated with ELISA (Fig 1A). Stx1B was internalized into the HeLa cells 1 h after co-incubation and was transferred to GA where it co-localized with the GA marker Golgin-97 (Fig 1B), which is in accordance with a previous study [37]. These results showed that recombinant Stx1B was fully functional and suitable as a target for selection of novel high affinity binders.

Fig 1. Ability of recombinant Stx1B to bind to Gb3 receptor in vitro.

Fig 1

(A) Binding of serially diluted Stx1B to Gb3 as determined by ELISA using THE™ His tag antibody. A450: Absorbance at 450 nm. Error bars denote standard deviations. (B) Internalization of FITC-labelled Stx1B into HeLa cells. Golgi apparatus was detected with mouse anti-human Golgin-97 primary antibody and Alexa Fluor 555-conjugated donkey anti-mouse secondary antibody (red). DAPI staining was used to label nuclei (blue). Bars = 10 μm.

Ribosome display selection of Stx1B binders

Smaller antibody variants, i.e. single chain variable fragments (ScFv), against Stx1B were previously selected by screening a phage display library constructed from a naïve human repertoire [38]. However, it was previously observed that, similar to antibodies themselves, ScFvs are not suitable for surface display on lactococcal cells (unpublished data), especially in comparison to non-Ig scaffolds, such as DARPins and Affibodies, possibly due to their larger size and more complex folding. To obtain novel protein binders of Shiga toxin, a highly complex combinatorial library derived from streptococcal albumin-binding domain scaffold was therefore applied. This has been used successfully for selecting high-affinity binders of IFN-γ [11], for development of IL-23 receptor antagonists [12] and for generation of unique binders of human prostate cancer oncomarker [13].

To select unique binders of Stx1B we used the highly-complex combinatorial ABD library [11], [12], [13] and ribosome display. Ribosome display enables the selection of binding proteins by associating ribosome-translated proteins with their parent mRNA in a complex. The mRNA-protein hybrids are selected against an immobilized ligand in multiple selection steps. The mRNA is then reverse transcribed to cDNA and its sequence amplified via PCR [39]. In the present work five cycles of ribosome display selection were performed, yielding a collection of 17 unique Stx1B-binders designated as S1B binders (Fig 2A). The identified S1B binders were produced in E. coli as fusion proteins with TolA spacer containing AviTag on the C-terminus and a H6 tag on the N-terminus (H6-S1B-TolA-Avi), as reported previously [11–13]. The expression level of the corresponding fusion protein was tested by SDS PAGE and the binding capacity verified by ELISA (Fig 2B). Binders S1B9, S1B22 and S1B26 with TolA-Avi and H6 fusion were selected for further analysis. The S1B28 variant showed a lower level of expression, possibly due to an unintended mutation in a non-randomized part of sequence, while S1B23 bound BSA and was therefore not Stx1B-specific. Both variants were excluded from further characterization.

Fig 2. Sequence similarity analysis (A) and binding affinity (B) of 17 S1B binders selected after five rounds of ribosome display.

Fig 2

A: The sequence of the parental ABD wild-type domain was used as a root of the tree and is highlighted as a square, while S1B variants selected for more detailed analysis are highlighted as circles. B: S1B binders-containing cell lysates were incubated with immobilized Stx1B (grey bars) or BSA (white bars) and detected with HRP-conjugated streptavidin. Error bars denote standard deviations.

Production and characterization of selected S1B binders

Selected binders in fusion with TolA-Avi and H6 were produced in E. coli on a large scale, purified with IMAC or HisTrap FPLC and verified on SDS-PAGE electrophoresis, where low level of expression and some proteolytic degradation of S1B9 variant were observed (Fig 3A). Stx1B was immobilized and incubated with serial dilutions of selected S1B binders, detected with HRP-streptavidin. Gradual increase of the ELISA signal confirmed binding of S1B binders to recombinant Stx1B (Fig 3B). Variant S1B26 showed the strongest binding, while binding of S1B9 variant was the weakest, which may be the consequence of degradation noted above. Sequence similarity comparison of selected binders S1B9, S1B22 and S1B26 with parental non-mutated ABDwt is presented in Fig 3C.

Fig 3.

Fig 3

(A) SDS PAGE analysis of selected binders S1B9, S1B22 and S1B26 after purification from E. coli cell lysates, stained with Coomassie brilliant blue. (B) ELISA-determined binding of serially diluted biotinylated binders selected against immobilized recombinant Stx1B. The binding was detected by HRP-conjugated streptavidin. (C) Sequence similarity comparison of selected binders with parental non-mutated ABDwt. Randomized sequences between residues 20 and 46 were compared. Randomized positions are indicated in grey.

Based on ELISA tests and SDS PAGE analysis clones S1B22 and S1B26 were selected for further characterization of binding with surface plasmon resonance (SPR) and microscale thermophoresis (MST), and of stability with thermal shift assay (TSA).

Characterization of binding affinity of the selected S1B binders

The first setup of SPR affinity measurements included immobilization of Stx1B on the sensor chip surface and injecting S1B proteins over the surface. Binding was confirmed with different dilutions of both binders, S1B22 and S1B26. Nevertheless, we could not determine the binding constant (Kd) for tested interactions with any of the available binding models in Biacore T100 Evaluation software. This was probably due to a complex interaction between S1B variants and Stx1B, which is in pentameric form, and probably binds more than one S1B molecule. The binding mode between Stx1B and S1B binders could be investigated by structural analysis, such as molecular docking or by solving the structure of the complex. Fig 4 shows a representative response after S1B22, S1B26 and ABDwt, all in fusion with TolA-Avi and H6, were injected at 1 μM concentration over the immobilized Stx1B. A much higher sensor response was observed with S1B22 and S1B26 than with ABDwt.

Fig 4. SPR analysis of binding of S1B22, S1B26 and ABDwt in fusion with TolA-Avi and H6 at 1 μM concentration to immobilized recombinant Stx1B.

Fig 4

In contrast, by reversing the SPR setup, S1B22 and S1B26 in fusion with TolA-Avi and H6 were attached to the sensor chip surface and two-fold dilutions of recombinant Stx1B, starting with 4 μM concentration, were injected over the chip surface (Fig 5A). Affinity constants were calculated by applying the Steady State Affinity model (Fig 5B) and the average of three experiments was considered. The binding affinity of recombinant Stx1B to S1B22 was 0.70 ± 0.03 μM and, to S1B26, 1.00 ± 0.09 μM.

Fig 5. Determination of binding affinity of selected S1B variants to recombinant Stx1B by SPR analysis (A, B) and MST (C).

Fig 5

(A) Recombinant Stx1B at seven different concentrations was injected over the chip surface with immobilized H6-S1B22-TolA-Avi or H6-S1B26-TolA-Avi. (B) Steady state response (obtained in (A)) was plotted against Stx1B concentration and Steady State Affinity model was applied to calculate the affinity constant. (C) Sixteen serial dilution concentrations of H6-S1B22-TolA-Avi or H6-S1B26-TolA-Avi were mixed with fluorescently labelled Stx1B at 5 nM final concentration. Fluorescence change Kd fit in NanoTemper software was used to calculate Kd. Error bars denote standard deviations.

The binding affinity of S1B22 and S1B26 to fluorescently-labelled recombinant Stx1B in solution was confirmed by MST. The binding curves obtained from three repeat measurements for S1B22 and S1B26 are shown in Fig 5C. The commercial analysis software was used to plot and fit the change in initial fluorescence to yield Kd values in the micromolar range of 0.4 ± 0.05 μM for S1B22 and 0.6 ± 0.05 μM for S1B26.

Calculated affinities are lower than those reported for ScFvs against Stx1B [38]. However, the affinity of ABDs could be further improved by affinity maturation approach, in which a new combinatorial library would be constructed from the best binder sequence using error prone PCR and where the new library would be subjected to a second selection against the same target under conditions of increasing stringency [40].

Characterization of the stability of selected S1B binders

The thermal stabilities of binders S1B22 and S1B26 in fusion with TolA-Avi and H6 were investigated by the fluorescence-based thermal shift assay. The denaturation temperature (Tm) determined for binder S1B26 was 53°C in PBS buffer and 54°C in Tris-NaCl buffer. Tm for binder S1B22 could not be determined in any of the tested buffers, probably due to the presence of two tryptophanes and three prolines in the randomized part of S1B22, which are known to destabilize helical structure of proteins. The Tm value for parental wild-type ABD has been reported to be 58°C [12, 13].

Redirection of Stx1B transport in HeLa cells by selected S1B binders

S1B22 and S1B26 in fusion with TolA-Avi and H6 were tested for their ability to prevent binding of Stx1B to HeLa cells, or to interfere with retrograde transport of Stx1B to GA in HeLa cells. When fluorescently labelled Stx1B (Stx1B-Alexa Fluor 488) was mixed with S1B binders prior to incubation with HeLa cells, no decrease in mean fluorescence intensity (MFI) compared to the control (incubated with Stx1B-Alexa Fluor 488 alone) was observed with flow cytometry that would be consistent with inhibition of binding to HeLa cells. On the contrary, higher MFI was observed in cells incubated with mixtures of S1Bs and Stx1B-Alexa Fluor 488 (Fig 6A and 6B), indicating higher amount of bound Stx1B-Alexa Fluor 488 or different cell distribution of internalized toxin. ABDwt in fusion with TolA-Avi and H6 had no effect on internalization of Stx1B-Alexa Fluor 488 into HeLa cells (Fig 6A and 6B).

Fig 6. Influence of S1B binders on Stx1B transport into HeLa cells.

Fig 6

A, B: Flow cytometric analysis of HeLa cells demonstrating shift in fluorescence intensity (A) and mean fluorescence intensity (MFI; B) upon 1h incubation of HeLa cells with mixtures of S1B22, S1B26 or ABDwt (all in fusion with TolA-Avi and H6) and Alexa Fluor 488-labeled Stx1B. Cont: unstained HeLa cells. Stx1B: HeLa cells incubated with Stx1B-Alexa Fluor 488 alone. C, D: Fluorescence microscopy images of HeLa cells incubated with Alexa Fluor 488 labelled Stx1B (green) with or without pre-incubation with S1B22 and S1B26. DAPI staining (blue) was used to label nuclei. Cells were stained either with PKH26 membrane labeling dye (red; C) and Golgi apparatus was detected with mouse monoclonal Golgin-97 antibody and secondary polyclonal goat anti-mouse antibody conjugated with Alexa Fluor 633 (purple; D). Bars = 10 μm.

To investigate the effect of S1Bs into more details we performed fluorescence microscopy using membrane labelling marker PKH26 (Fig 6C) and marker for GA (Fig 6D). In cells incubated with Stx1B-Alexa Fluor 488 alone, or mixture of Stx1B-Alexa Fluor 488 and ABDwt, the majority of Stx1B-Alexa Fluor 488 was co-localized with the marker of GA 1 h after addition to HeLa cells (Fig 6D), as shown before with FITC-conjugated Stx1B (Fig 1B). When Stx1B-Alexa Fluor 488 was pre-incubated with S1B22 or S1B26 the distribution of Stx1B in HeLa cells was completely altered. Stx1B-Alexa Fluor 488 was partially co-localized with membrane dye, indicating localization at the cell membrane or in membrane bound vesicles, while the co-localization with the GA marker was completely lacking, indicating its absence from GA. S1B22 and S1B26 interfered with conventional internalization route of Stx1B into the HeLa cells, suggesting a possible inhibitory function of S1B variants on Stx1B retrograde transport. However, more analyses need to be performed to prove the exact mechanism of S1Bs on Stx1B trafficking.

Expression and surface display of selected S1B binders on L. lactis NZ9000

Genes for S1B22, S1B26, ABDwt and H6-ABDwt without tolA spacer or tags were amplified with PCR and cloned into the plasmid pSDLBA3b [17], which had been designed for the surface display of target proteins in fusion with Usp45 secretion signal [41] and the surface anchoring C-terminal domain of AcmA (cA), as reported [17, 18, 20–22, 33]. Fusion proteins were expressed in L. lactis by induction with nisin and visualized in the cell lysates by SDS PAGE and Coomassie brilliant blue staining (Fig 7A).

Fig 7.

Fig 7

(A) SDS PAGE analysis of lysates of L. lactis cells expressing S1B22, S1B26, ABDwt and H6-ABDwt (ABDwtH), all in fusion with Usp45 secretion signal and the LysM-containing cA domain, and stained with Coomassie brilliant blue. ABD fusion proteins are high-lighted with arrows. (B) Flow cytometric analysis of ABD surface display, detection with FITC-conjugated human serum albumin. The MFI value of ABDwt was compared with that of the control using Student’s t test. *** p<0.001. Cont.: control containing empty plasmid pNZ8148.

Surface display of ABDs was confirmed for ABDwt and H6-ABDwt using flow cytometry. L. lactis cells expressing ABDwt on their surface bound FITC-conjugated HSA (Fig 7B), which also indicates the functionality of the displayed binder.

Evaluation of binding of Stx1B by recombinant L. lactis with surface displayed S1B binders

Binding of Stx1B by recombinant L. lactis with surface displayed S1B binders was evaluated by flow cytometry (Fig 8A) and whole cell ELISA (Fig 8B). With flow cytometry, we observed statistically significant binding of fluorescence-labelled Stx1B by L. lactis cells displaying S1B26 on their surface in comparison with control L. lactis cells expressing ABDwt. With whole cell ELISA binding of Stx1B by L. lactis cells displaying both S1B22 and S1B26 was confirmed, the strongest being with S1B26. On the basis of these results, S1B26 was selected as the most promising Stx1B binder for the display on the surface of L. lactis, even though S1B22 exhibited lower binding constants in SPR and MST, possibly due to the fusion with TolA-Avi and H6 in isolated S1Bs.

Fig 8. Flow cytometric (A) and whole-cell ELISA (B) analyses of binding of recombinant Stx1B by L. lactis cells displaying S1B variants or ABDwt on their surface.

Fig 8

(A) Alexa488-conjugated Stx1B was used for detection. MFI: Mean fluorescence intensity. (B) Mouse antiStx1B antibody and HRP-conjugated anti mouse antibody were used for detection of Stx1B. A450: Absorbance at 450 nm. Vertical bars denote standard deviation. MFI or A450 values of S1B binders were compared to those of the ABDwt control using Student’s t test. *: p<0.05, ** p<0.01, *** p<0.001.

Conclusion

Shiga toxin receptor analogues are an attractive option for treating infections with Shiga toxin-producing bacteria [8]. They place no stress on bacteria and do not induce Shiga toxin release. They bind the toxin in situ in the gastrointestinal tract, thereby preventing its activity. Engineered bacteria, such as recombinant E. coli producing a modified lipopolysaccharide mimicking the Shiga toxin receptor [23, 24], could substitute the polymer analogs. Probiotic food-grade LAB were previously shown to be able to inhibit Shiga toxin-producing bacteria by the production of lactic acid [16] and this could be exploited in creating a synergistic therapeutic effect.

In the present study we demonstrated for the first time functional display of ABD proteins on the surface of LAB L. lactis. This represents an additional class of alternative binding proteins successfully displayed on the surface of L. lactis, next to Affibodies [17] and DARPins [18]. LAB L. lactis capable of binding Stx1B by displaying on its surface ABD-derived Stx1B binding proteins were engineered and could be used for neutralization of Shiga toxin in the human intestine in the early stages of infections with Shiga toxin producing bacteria. Additionally, novel Stx1B binders on the basis of ABD scaffold can be used for basic research as a small non-immunoglobulin alternative to antibodies and with further modification could be developed for diagnostics.

Acknowledgments

We are grateful to Prof. Roger Pain for a critical reading of the manuscript, Petra Kadlčáková for excellent technical assistance during work in Prague, and Dr. Maja Štalekar and Dr. Simona Darovic for help with HeLa cells.

Data Availability

All relevant data are within the paper.

Funding Statement

This work was supported by Slovenian Research Agency grant P4-0127, by Slovene human resources development and scholarship fund, by Bilateral mobility project between Academy of Sciences of the Czech Republic and Slovenian Academy of Sciences and Arts (No. SAZU-16-01) and by BIOCEV CZ.1.05/1.1.00/02.0109 from the ERDF and the institutional research concept RVO: 86652036.

References

  • 1.Paton JC, Paton AW. Pathogenesis and diagnosis of Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev. 1998;11(3):450–79. , [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.O`Brien AD, Holmes RK. Shiga and Shiga-Like Toxins. Microbiol Rev. 1987;51(2):206–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Johannes L, Römer W. Shiga toxins—from cell biology to biomedical applications. Nat Rev Microbiol. 2010. 10.1038/nrmicro2279 [DOI] [PubMed] [Google Scholar]
  • 4.Keir LS, Marks SD, Kim JJ. Shigatoxin-associated hemolytic uremic syndrome: current molecular mechanisms and future therapies. Drug Des Devel Ther. 2012;6:195–208. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sandvig K, van Deurs B. Endocytosis, intracellular transport, and cytotoxic action of Shiga toxin and ricin. Physiol Rev. 1996;76(4):949–66. . [DOI] [PubMed] [Google Scholar]
  • 6.Sandvig K. Shiga toxins. Toxicon. 2001;39(11):1629–35. 10.1016/S0041-0101(01)00150-7 . [DOI] [PubMed] [Google Scholar]
  • 7.Melton-Celsa AR, O'Brien AD. New Therapeutic Developments against Shiga Toxin-Producing Escherichia coli. Microbiol Spectr. 2014;2(5). 10.1128/microbiolspec.EHEC-0013-2013 . [DOI] [PubMed] [Google Scholar]
  • 8.Rahal EA, Fadlallah SM, Nassar FJ, Kazzi N, Matar GM. Approaches to treatment of emerging Shiga toxin-producing Escherichia coli infections highlighting the O104:H4 serotype. Front Cell Infect Microbiol. 2015;5:24 10.3389/fcimb.2015.00024 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Skrlec K, Strukelj B, Berlec A. Non-immunoglobulin scaffolds: a focus on their targets. Trends Biotechnol. 2015;33(7):408–18. 10.1016/j.tibtech.2015.03.012 . [DOI] [PubMed] [Google Scholar]
  • 10.Gebauer M, Skerra A. Engineered protein scaffolds as next-generation antibody therapeutics. Curr Opin Chem Biol. 2009;13(3):245–55. 10.1016/j.cbpa.2009.04.627 . [DOI] [PubMed] [Google Scholar]
  • 11.Ahmad JN, Li J, Biedermannova L, Kuchar M, Sipova H, Semeradtova A, et al. Novel high-affinity binders of human interferon gamma derived from albumin-binding domain of protein G. Proteins. 2012;80(3):774–89. 10.1002/prot.23234 . [DOI] [PubMed] [Google Scholar]
  • 12.Kuchar M, Vankova L, Petrokova H, Cerny J, Osicka R, Pelak O, et al. Human interleukin-23 receptor antagonists derived from an albumin-binding domain scaffold inhibit IL-23-dependent ex vivo expansion of IL-17-producing T-cells. Proteins. 2014;82(6):975–89. 10.1002/prot.24472 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Mareckova L, Petrokova H, Osicka R, Kuchar M, Maly P. Novel binders derived from an albumin-binding domain scaffold targeting human prostate secretory protein 94 (PSP94). Protein Cell. 2015. 10.1007/s13238-015-0194-9 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Mohsin M, Guenther S, Schierack P, Tedin K, Wieler LH. Probiotic Escherichia coli Nissle 1917 reduces growth, Shiga toxin expression, release and thus cytotoxicity of enterohemorrhagic Escherichia coli. Int J Med Microbiol. 2015;305(1):20–6. 10.1016/j.ijmm.2014.10.003 . [DOI] [PubMed] [Google Scholar]
  • 15.Reissbrodt R, Hammes WP, dal Bello F, Prager R, Fruth A, Hantke K, et al. Inhibition of growth of Shiga toxin-producing Escherichia coli by nonpathogenic Escherichia coli. FEMS Microbiol Lett. 2009;290(1):62–9. 10.1111/j.1574-6968.2008.01405.x . [DOI] [PubMed] [Google Scholar]
  • 16.Ogawa M, Shimizu K, Nomoto K, Tanaka R, Hamabata T, Yamasaki S, et al. Inhibition of in vitro growth of Shiga toxin-producing Escherichia coli O157:H7 by probiotic Lactobacillus strains due to production of lactic acid. Int J Food Microbiol. 2001;68(1–2):135–40. . [DOI] [PubMed] [Google Scholar]
  • 17.Ravnikar M, Strukelj B, Obermajer N, Lunder M, Berlec A. Engineered Lactic Acid Bacterium Lactococcus lactis Capable of Binding Antibodies and Tumor Necrosis Factor Alpha. Appl Environ Microbiol. 2010;76(20):6928–32. 10.1128/aem.00190-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Zadravec P, Strukelj B, Berlec A. Improvement of LysM-mediated surface display of designed ankyrin repeat proteins (DARPins) in recombinant and nonrecombinant strains of Lactococcus lactis and Lactobacillus Species. Appl Environ Microbiol. 2015;81(6):2098–106. 10.1128/AEM.03694-14 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Zadravec P, Strukelj B, Berlec A. Heterologous surface display on lactic acid bacteria: non-GMO alternative? Bioengineered. 2015;6(3):179–83. 10.1080/21655979.2015.1040956 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Steen A. Cell Wall Attachment of a Widely Distributed Peptidoglycan Binding Domain Is Hindered by Cell Wall Constituents. J Biol Chem. 2003;278(26):23874–81. 10.1074/jbc.M211055200 [DOI] [PubMed] [Google Scholar]
  • 21.Buist G, Kok J, Leenhouts KJ, Dabrowska M, Venema G, Haandrikman AJ. Molecular cloning and nucleotide sequence of the gene encoding the major peptidoglycan hydrolase of Lactococcus lactis, a muramidase needed for cell separation. J Bacteriol. 1995;177(6):1554–63. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Steen A, Buist G, Horsburgh GJ, Venema G, Kuipers OP, Foster SJ, et al. AcmA of Lactococcus lactis is an N-acetylglucosaminidase with an optimal number of LysM domains for proper functioning. FEBS J. 2005;272(11):2854–68. 10.1111/j.1742-4658.2005.04706.x . [DOI] [PubMed] [Google Scholar]
  • 23.Paton AW, Morona R, Paton JC. A new biological agent for treatment of Shiga toxigenic Escherichia coli infections and dysentery in humans. Nat Med. 2000;6(3):265–70. [DOI] [PubMed] [Google Scholar]
  • 24.Pinyon RA, Paton JC, Paton AW, Botten JA, Morona R. Refinement of a therapeutic Shiga toxin-binding probiotic for human trials. J Infect Dis. 2004;189(9):1547–55. 10.1086/383417 . [DOI] [PubMed] [Google Scholar]
  • 25.Bondos SE, Bicknell A. Detection and prevention of protein aggregation before, during, and after purification. Anal Biochem. 2003;316(2):223–31. 10.1016/S0003-2697(03)00059-9 . [DOI] [PubMed] [Google Scholar]
  • 26.Tsumoto K, Ejima D, Kumagai I, Arakawa T. Practical considerations in refolding proteins from inclusion bodies. Protein Expr Purif. 2003;28(1):1–8. 10.1016/S1046-5928(02)00641-1 . [DOI] [PubMed] [Google Scholar]
  • 27.Oneda H, Inouye K. Refolding and recovery of recombinant human matrix metalloproteinase 7 (matrilysin) from inclusion bodies expressed by Escherichia coli. J Biochem. 1999;126(5):905–11. . [DOI] [PubMed] [Google Scholar]
  • 28.de Ruyter PG, Kuipers OP, de Vos WM. Controlled gene expression systems for Lactococcus lactis with the food-grade inducer nisin. Appl Environ Microbiol. 1996;62(10):3662–7. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kuipers OP, Beerthuyzen MM, Siezen RJ, De Vos WM. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis. Requirement of expression of the nisA and nisI genes for development of immunity. Eur J Biochem. 1993;216(1):281–91. . [DOI] [PubMed] [Google Scholar]
  • 30.Kuipers OP, de Ruyter PGGA, Kleerebezem M, de Vos WM. Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol. 1998;64(1):15–21. 10.1016/S0168-1656(98)00100-X [DOI] [Google Scholar]
  • 31.Mierau I, Kleerebezem M. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Appl Microbiol Biotechnol. 2005;68(6):705–17. 10.1007/s00253-005-0107-6 [DOI] [PubMed] [Google Scholar]
  • 32.Ashkenazi S, Cleary TG. Rapid method to detect shiga toxin and shiga-like toxin I based on binding to globotriosyl ceramide (Gb3), their natural receptor. J Clin Microbiol. 1989;27(6):1145–50. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Berlec A, Malovrh T, Zadravec P, Steyer A, Ravnikar M, Sabotic J, et al. Expression of a hepatitis A virus antigen in Lactococcus lactis and Escherichia coli and evaluation of its immunogenicity. Appl Microbiol Biotechnol. 2013;97(10):4333–42. 10.1007/s00253-013-4722-3 . [DOI] [PubMed] [Google Scholar]
  • 34.Berlec A, Zadravec P, Jevnikar Z, Strukelj B. Identification of candidate carrier proteins for surface display on Lactococcus lactis by theoretical and experimental analyses of the surface proteome. Appl Environ Microbiol. 2011;77(4):1292–300. 10.1128/AEM.02102-10 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Zadravec P, Mavric A, Bogovic Matijasic B, Strukelj B, Berlec A. Engineering BmpA as a carrier for surface display of IgG-binding domain on Lactococcus lactis. Protein Eng Des Sel. 2014;27(1):21–7. 10.1093/protein/gzt059 . [DOI] [PubMed] [Google Scholar]
  • 36.Lindholm A, Smeds A, Palva A. Receptor binding domain of Escherichia coli F18 fimbrial adhesin FedF can be both efficiently secreted and surface displayed in a functional form in Lactococcus lactis. Appl Environ Microbiol. 2004;70(4):2061–71. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Kim JH, Lingwood CA, Williams DB, Furuya W, Manolson MF, Grinstein S. Dynamic measurement of the pH of the Golgi complex in living cells using retrograde transport of the verotoxin receptor. J Cell Biol. 1996;134(6):1387–99. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Neri P, Shigemori N, Hamada-Tsutsumi S, Tsukamoto K, Arimitsu H, Shimizu T, et al. Single chain variable fragment antibodies against Shiga toxins isolated from a human antibody phage display library. Vaccine. 2011;29(33):5340–6. 10.1016/j.vaccine.2011.05.093 . [DOI] [PubMed] [Google Scholar]
  • 39.Lipovsek D, Pluckthun A. In-vitro protein evolution by ribosome display and mRNA display. J Immunol Methods. 2004;290(1–2):51–67. 10.1016/j.jim.2004.04.008 . [DOI] [PubMed] [Google Scholar]
  • 40.Richter A, Eggenstein E, Skerra A. Anticalins: exploiting a non-Ig scaffold with hypervariable loops for the engineering of binding proteins. FEBS Lett. 2014;588(2):213–8. 10.1016/j.febslet.2013.11.006 . [DOI] [PubMed] [Google Scholar]
  • 41.Dieye Y, Usai S, Clier F, Gruss A, Piard JC. Design of a protein-targeting system for lactic acid bacteria. J Bacteriol. 2001;183(14):4157–66. 10.1128/JB.183.14.4157-4166.2001 . [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES