Abstract
Objective:
We aimed to evaluate the relationship between IL-6-174G>C, -572G>C and -597G>A polymorphisms and development of coronary artery diseases in a Chinese population.
Methods:
A total of 275 patients with coronary artery disease and 296 healthy control subjects were collected between January 2013 and November 2014. The IL-6 genotyping for -174G>C, -592G>C and -597G>A polymorphic sites was determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) according to the manufacturer instructions.
Results:
Using unconditional regression analysis, we observed that the AC and CC genotypes of IL-6 -592A>C were associated with the increased risk of developing coronary artery disease when compared with the AA genotype, and the adjusted ORs (95%CI) were 1.63(1.12-2.38) and 2.70(1.57-4.67), respectively. Additionally, the C allele of IL-6 -592A>C (OR=1.65, 95%CI=1.29-2.11) was correlated with a higher risk of developing coronary artery disease in comparison to the A allele. However, no relationship was found between IL-6-174G>C and -597G>A polymorphisms and coronary artery disease susceptibility.
Conclusion:
This study suggests that IL-6 -592G>C polymorphism is correlated with the risk of coronary artery disease. More well-designed prospective studies based on large sample size, multiple SNPs or haplotypes are required to confirm the current findings.
KEY WORDS: Interleukin-6, -174G>C, -572G>C, -597G>A, Polymorphism, Coronary artery disease
INTRODUCTION
Coronary artery disease, namely coronary atherosclerotic heart disease, has become a challenging problem which severely threatens public health. Coronary artery disease is related with high morbidity and mortality worldwide, and the number of individuals in China suffering from CAD shows a tendency to increase.1 Even though improvements in early detection have reduced the mortality rates of coronary artery disease in recent years, prevention of coronary artery disease is always a main public health concern.
The pathogenesis of coronary artery disease occurs over a long period of time, involves many environmental and lifestyle factors, including hypertension, hyperlipaemia, diabetes, tobacco smoking, obesity and family history of atherosclerosis.2,3 Additionally, hereditary factors play an important role in the risk of coronary artery disease susceptibility, and previous published studies have revealed that many genetic factors play an important role in the development of this diseases, such as B-cell lymphoma 2 2, aldehyde dehydrogenase 2, cholesteryl ester transfer protein, interleukin-10 (IL-10) and scavenger receptor class B type 1.4-9
Molecular mechanisms underlying inflammation-correlated diseases included DNA damage, disruption of the immune response and alternation of normal cell microenvironment, which were all closely related with disequilibrium of inflammatory cytokines. Interleukin-6 (IL-6) is such a multifunctional pro-inflammatory cytokine produced by activated T cells, B cells, monocytes as well as cancerous cells. Since single nucleotide polymorphisms of IL-6 gene promoter may affect the expression and secretion of IL-6, and subsequently the altered circulating levels might result in relevant biological responses, the IL-6 polymorphism has been regarded as a crucial modulator in pathogenesis of various diseases, such as ischemic stroke, osteoporosis, dyslipidemia, hypertension and cardiovascular diseases.10-14
Currently, although several studies have investigated the correlation between IL-6 polymorphisms and development of cardiovascular disease, but the conclusions are conflicting.15-19 We carried out a study to evaluate the relationship between IL-6-174G>C, -572G>C and -597G>A polymorphisms and development of coronary artery disease in a Chinese population.
METHODS
This is a case-control study conducted between January 2013 and November 2014. Two hundred seventy five patients with coronary artery disease were enrolled from the First Hospital of Shanxi Medical University. All the new patients with coronary artery diseases were diagnosed using coronary angiography. The diagnosis of coronary artery disease was as follows: luminal stenosis above 50% in one of the main coronary arteries (left main coronary stenosis, anterior descending branch, circumflex coronary artery and right coronary artery) or their branch retinal arteries, and exhibiting stable angina, unstable angina pectoris and acute myocardial infarction. Patients who had a history of percutancous coronary intervention or coronary artery bypass graft intervention, congenital heart disease, rheumatic valvular heart disease, cardiomyopathy, severe heart failure, end-stage renal and liver disease, serious infections, malignant tumor, thyroid disease, connective tissue disease or immune system diseases were excluded
A total of 296 healthy control subjects were also enrolled from individuals who visited outpatient clinics at the First Hospital of Shanxi Medical University during the same time period. The control subjects were confirmed to be free of coronary artery diseases and other cardiovascular diseases, end-stage renal and liver disease, serious infections, malignant tumor, thyroid disease and immune system diseases.
The baseline variables of coronary artery disease patients and control subjects, including age, gender, tobacco smoking, alcohol consumption and body mass index (BMI) as well as family history of coronary artery diseases, were collected with a self-designed questionnaire. The clinical data of coronary artery disease patients and control subjects, including hypertension, type 2 diabetes mellitus, total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-c) as well as high-density lipoprotein cholesterol (HDL-c), were collected from medical records. The study was carried out with the permission of the ethics committee of the First Hospital of Shanxi Medical University. A written informed consent was obtained from all the subjects before enrollment into this study. The ethical standards adopted for this study were in agreement with the standards of the Declaration of Helsinki.
DNA extraction and genotyping
Five blood samples were collected from each investigated subject. The peripheral blood was kept in tube with EDTA and stored at -20°C until using. The extraction of the genomic DNA was done from the peripheral blood using QIAamp DNA Blood Mini Kit (QIAGEN, USA) following the manufacturer’s recommendation. The IL-6 genotyping for -174G>C, -592G>C and -597G>A polymorphic sites was determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) according to the manufacturer instructions. The primers, restriction enzymes and PCR digested fragments shown in Table-I.
Table-I.
Primers, restriction enzymes and PCR digested fragments of IL-6-174G>C, -572G>C and -597G>A
| IL-6 | Primers(5’-3’) | Restriction enzymes | Digested fragments |
|---|---|---|---|
| -174G>C | TGACTTCAGCTTTACTCTTTGT CTGATTGGAAACCTTATTAAG |
NlaIII | GG: 164bp and 59bp GC: 164bp, 111bp, 59bp and 53bp CC: 111bp, 59bp and 53bp |
| -572G>C | GAGACGCCTTGAAGTAACTG AACCAAAGATGTTCTGAACTGA |
BsrBI | GG: 122bp and 60bp GC: 182bp, 122bp and 60bp |
| -592G>A | CTCCTCTAAGTGGGCTGAAG CAAGCCTGGGATTATGAAGA |
RsaI | GG: 412bp GA:412bp, 236bp and 176bp AA: 236bp and 176bp |
PCR was performed in a 25 μl reaction mixture containing 10.5μl ddH2O, 12.5μl PCR MIX, 0.375μl of each primer (10pmol/μl), 0.25μl Taq enzyme (5U/μl) and 1μl DNA template (50ng/μl). The PCR condition was set at initial denaturation at 94°C for 3 minutes, followed by 35 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 60 seconds, and a final elongation of 5 mins at 72°C. Qualitative and quantitative estimation of DNA was carried out with agarose gel electrophoresis and spectrophotometric estimation.
Statistical analysis
The differences within demographic, lifestyle and genotype frequencies between the two groups were analyzed using chi-square tests (χ2test) or student t test. The correlation between IL-6-174G>C, -572G>C and -597G>A genotype polymorphisms and susceptibility to coronary artery disease was evaluated using unconditional logistic regression analysis. Whether the IL-6-174G>C, -572G>C and -597G>A genotype frequencies were in agreement with the Hardy-Weinberg equilibrium was evaluated using chi-square tests. The results were estimated using Odds ratio (ORs) along with 95% Confidence Intervals (CI), and the results were adjusted for possible confounder. All the statistical analysis was done using IBM SPSS Statistics for Windows, Version 20.0. (Armonk, NY: IBM Corp).P-value <0.05 was regarded as statistically significant.
RESULTS
The demographic, lifestyle and clinical characteristics of the study participants are presented in Table-II. By comparison with the control subjects, coronary artery disease patients were more likely to have higher age (t=1.78, P=0.04), higher BMI (t=3.09, P=0.001), have a family history of coronary artery disease (χ2=5.45, P=0.02), suffer from hypertension (χ2=20.16, P<0.001) and type 2 diabetes mellitus (χ2=10.01, P<0.001), and have higher level of TC (t=5.39, P<0.001) and LDL-c (t=4.31, P<0.001) as well as lower level of HDL-c (t=9.38, P<0.001). The controls and patients were comparable in respect to gender (χ2=2.45, P=0.12), tobacco smoking (χ2=0.18, P=0.67), alcohol consumption (χ2=0.08, P=0.77) and TG (t=1.35, P=0.09) level.
Table-II.
The demographic, lifestyle and clinical characteristics of study subjects.
| Variables | Patients n=275 | % | Controls n=296 | % | χ2 test or t test | P value |
|---|---|---|---|---|---|---|
| Age, years | 62.64±8.43 | 61.43±7.85 | 1.78 | 0.04 | ||
| Gender | ||||||
| Females | 86 | 31.27 | 111 | 37.50 | ||
| Males | 189 | 68.73 | 185 | 62.50 | 2.45 | 0.12 |
| BMI, kg/m2 | 26.41±2.56 | 25.75±2.54 | 3.09 | 0.001 | ||
| Tobacco smoking | ||||||
| No | 92 | 33.45 | 104 | 35.14 | ||
| Yes | 183 | 66.55 | 192 | 64.86 | 0.18 | 0.67 |
| Alcohol consumption | ||||||
| No | 87 | 31.64 | 97 | 32.77 | ||
| Yes | 188 | 68.36 | 199 | 67.23 | 0.08 | 0.77 |
| Family history of coronary artery disease | ||||||
| No | 230 | 83.64 | 267 | 90.20 | ||
| Yes | 45 | 16.36 | 29 | 9.80 | 5.45 | 0.02 |
| Hypertension | ||||||
| No | 147 | 53.45 | 212 | 71.62 | ||
| Yes | 128 | 46.55 | 84 | 28.38 | 20.16 | <0.001 |
| Type 2 diabetes mellitus | ||||||
| No | 205 | 74.55 | 252 | 85.14 | ||
| Yes | 70 | 25.45 | 44 | 14.86 | 10.01 | 0.002 |
| TC, mmol/L | 4.64±1.15 | 4.08±1.32 | 5.39 | <0.001 | ||
| TG, mmol/L | 1.52±1.19 | 1.64±0.93 | 1.35 | 0.09 | ||
| LDL-c, mmol/L | 2.84±0.95 | 2.48±1.04 | 4.31 | <0.001 | ||
| HDL-c, mmol/L | 1.23±0.26 | 1.46±0.32 | 9.38 | <0.001 |
BMI: body mass index; TC: total cholesterol; TG: triglyceride; LDL-c: low-density lipoprotein cholesterol; HDL-c: high-density lipoprotein cholesterol.
The genotype distributions of IL-6-174G>C, -592G>C and -597G>A are shown in Table-III. The genotype distributions of IL-6-174G>C (χ2=1.24, P=0.27) and -592G>C (χ2=2.40, P=0.12) were comparable between coronary artery disease patients and control subjects, whereas a significant difference was observed between coronary artery disease patients and control subjects in respect to IL-6 -592G>C (χ2=15.87, P<0.001) (Table-III). Using chi-square test, we observed that the genotype distributions of IL-6-174G>C, -592G>C and -597G>A were in agreement with the HWE in both coronary artery disease patients (P values were 0.55, 0.79 and 0.71 for IL-6-174G>C, -592G>C and -597G>A, respectively) and control subjects (P values were 0.68, 0.89 and 0.51 for IL-6-174G>C, -592G>C and -597G>A, respectively).
Table-III.
Genotype frequencies of IL-6-174G>C, -592G>C and -597G>A in the two study groups
| Variables IL-6 | Patients n=275 | % | Controls n=296 | % | χ2 test | P value | P for HWE | |
|---|---|---|---|---|---|---|---|---|
| Patients | Controls | |||||||
| -174G>C | ||||||||
| GG | 256 | 93.09 | 282 | 95.27 | ||||
| GC | 19 | 6.91 | 14 | 4.73 | ||||
| CC | 0 | 0.00 | 0 | 0.00 | 1.24 | 0.27 | 0.55 | 0.68 |
| -592A>C | ||||||||
| AA | 87 | 31.64 | 135 | 45.61 | ||||
| AC | 134 | 48.73 | 129 | 43.58 | ||||
| CC | 55 | 20.00 | 32 | 10.81 | 15.87 | <0.001 | 0.79 | 0.89 |
| -597G>A | ||||||||
| GG | 263 | 95.64 | 274 | 92.57 | ||||
| GA | 12 | 4.36 | 22 | 7.43 | ||||
| AA | 0 | 0.00 | 0 | 0.00 | 2.40 | 0.12 | 0.71 | 0.51 |
HWE: Hardy-Weinberg equilibrium.
The relationship between IL-6-174G>C, -592G>C and -597G>A polymorphisms and development of coronary artery diseases is described in Table-IV. Using unconditional regression analysis, we observed that the AC and CC genotypes of IL-6 -592A>C were associated with the increased risk of developing coronary artery disease when compared with the AA genotype, and the adjusted ORs (95%CI) were 1.63(1.12-2.38) and 2.70(1.57-4.67), respectively. Additionally, the C allele of IL-6 -592A>C (OR=1.65, 95%CI=1.29-2.11) was correlated with an elevated risk of developing coronary artery disease in comparison to the A allele. However, no relationship was found between IL-6-174G>C and -597G>A polymorphisms and coronary artery disease susceptibility.
Table-IV.
Relationship between IL-6-174G>C, -592G>C and -597G>A polymorphisms and development of coronary artery disease
| Variables | Patients n=275 | % | Controls n=296 | % | OR(95%CI)1 | P value |
|---|---|---|---|---|---|---|
| IL-6-174G>C | ||||||
| GG | 256 | 93.09 | 282 | 95.27 | 1.0 (Ref.) | - |
| GC | 19 | 6.91 | 14 | 4.73 | 1.49 (0.69-3.29) | 0.26 |
| CC | 0 | 0.00 | 0 | 0.00 | - | - |
| Allele | ||||||
| G | 531 | 96.55 | 578 | 97.64 | 1.0 (Ref.) | - |
| C | 19 | 3.46 | 14 | 2.37 | 1.48(0.69-3.22) | 0.27 |
| -592A>C | ||||||
| AA | 86 | 31.27 | 135 | 45.61 | 1.0 (Ref.) | - |
| AC | 134 | 48.73 | 129 | 43.58 | 1.63(1.12-2.38) | 0.01 |
| CC | 55 | 20.00 | 32 | 10.81 | 2.70(1.57-4.67) | <0.001 |
| Allele | ||||||
| A | 306 | 55.64 | 399 | 67.40 | 1.0 (Ref.) | - |
| C | 244 | 44.36 | 193 | 32.60 | 1.65(1.29-2.11) | <0.001 |
| -597G>A | ||||||
| GG | 263 | 95.64 | 274 | 92.57 | 1.0 (Ref.) | - |
| GA | 12 | 4.36 | 22 | 7.43 | 0.57(0.25-1.23) | 0.12 |
| AA | 0 | 0.00 | 0 | 0.00 | - | - |
| Allele | ||||||
| G | 538 | 97.82 | 570 | 96.28 | 1.0 (Ref.) | - |
| A | 12 | 2.18 | 22 | 3.72 | 0.58(0.26-1.23) | 0.13 |
Ajusted for age, gender, BMI, family history of coronary artery disease, hypertension, type 2 diabetes mellitus, TC, LDL-c and HDL-c. OR: odds ratio; CI: confidence interval.
DISCUSSION
Coronary artery disease is the one of the leading causes of death, and is a serious public health problem worldwide. So far, the identified factors correlated with coronary artery disease were environment, ethnicity, family history and genetic mutation. Currently, many studies have shown that chronic inflammation could be a potential role in the development of cardiovascular diseases.14,20-24 The continuous condition of inflammation produces chronic damage promoting development and progression of certain types of cardiovascular diseases.21-24 In our study, we found that the IL-6 gene polymorphisms is the risk factor of coronary artery disease susceptibility, and we observed that IL-6 -592A>C polymorphism was correlated with higher risk of coronary artery disease in the Chinese population.
The IL-6 gene, located at chromosome 7p21-24, is composed of 4 introns and 5 exons. IL-6 could be considered as a major regulator of cardiovascular disease initiation and progression through circulating levels alternation. Al Shahi et al. carried out a study with 20 acute coronary syndrome patients and 50 stable coronary artery disease patients, and discovered that the higher plasma levels of IL-6 was associated with the pathogenesis of atherosclerosis.25 Eiras et al. reported that epicardial adipose tissue of coronary artery diseases was associated with higher levels of IL-6 mRNA than that of non-coronary artery disease patients.26 Another study was carried out in The Netherlands, and reported that plasma levels of IL-6 was significant higher in coronary artery disease compared to healthy controls.27
Genetic polymorphisms can change the structure and quantity of the gene product, ultimately affecting the function of the product.28 The IL-6 genetic polymorphisms may influence the expression and function of IL-6 protein, and thus affect the susceptibility to cardiovascular diseases. Previous studies have investigated the association between IL-6 genetic polymorphisms and development of cardiovascular diseases, but the results are conflicting.14,16,18,22,29 Li et al. carried out a study in Chinese population, and discovered that the CC genotype of IL-6-174G/C and the GG genotype ofIL-6-572C/G are correlated with elevated risk of coronary artery disease.16 Wang et al. carried out a study with 402 patients with coronary artery disease and 402 control individuals, and reported a significant association between IL-6 -174G>C polymorphism and coronary artery disease susceptibility, whereas no association was observed between IL-6-572C/G and this disease.18
A Chinese study found a significant correlation between IL-6 -174G>C genomic variation and onset of cardiovascular events in patients receiving hemodialysis, but no correlation was observed in IL-6-572C/G genomic variation and risk of this disease.22 Gigante et al. carried out a study in two large populations, and reported that IL-6 haplotypes could regulate the circulating levels of inflammatory biomarkers and affect the susceptibility to coronary artery disease.29 Buraczynska et al. reported that C allele of the IL-6 -174G>C was correlated with a significantly higher risk of cardiovascular disease compared to the G allele.14 Our study indicated that a significant relationship between IL-6-572C/G genetic polymorphism and coronary artery disease susceptibility. The discrepancies of the above mentioned studies may be attributed to differences in populations, disease status of coronary artery disease or sample size.
Limitations of the study
First, study subjects were selected from only one hospital, which may cause selection bias. However, the genotype frequencies of IL-6-174G>C, -592G>C and -597G>A confirmed with the HWE, which suggests the genotype frequencies has representative of the general population. Second, our study may overlook the possibility of gene-gene interactions. Third, the sample size of our study is relatively small, which may limit the statistical power to find differences between groups. Further investigations with more sample size are needed to confirm our findings.
CONCLUSION
This study suggests that IL-6 -592G>C polymorphism is correlated with the risk of coronary artery disease. More well-designed prospective study based on large sample size, multiple SNPs or haplotypes are required to confirm the current findings.
Authors’ Contributions
YHM, JYP & LJY designed, performed the study, statistical analysis & editing of manuscript.
YHM did data collection and manuscript writing.
REFRENCES
- 1.Cheng TO. Rising incidence of coronary artery disease in China in parallel with rising ’normal’ plasma cholesterol levels. Atherosclerosis. 2004;173(2):371. doi: 10.1016/j.atherosclerosis.2003.12.007. [DOI] [PubMed] [Google Scholar]
- 2.Zidi W, Allal-Elasmi M, Zayani Y, Zaroui A, Guizani I, Feki M, et al. Metabolic Syndrome, Independent Predictor for Coronary Artery Disease. Clin Lab. 2015;61(10):1545–1552. doi: 10.7754/clin.lab.2015.150219. [DOI] [PubMed] [Google Scholar]
- 3.Duval S, Long KH, Roy SS, Oldenburg NC, Harr K, Fee RM, et al. The Contribution of Tobacco Use to High Health Care Utilization and Medical Costs in Peripheral Artery Disease: A State-Based Cohort Analysis. J Am Coll Cardiol. 2015;66(14):1566–1574. doi: 10.1016/j.jacc.2015.06.1349. [DOI] [PubMed] [Google Scholar]
- 4.Xuan Y, Wang LN, Wei PM, Zhi H, Lu ZH. B-cell lymphoma 2 rs17757541 C>G polymorphism was associated with an increased risk of coronary artery disease in a Chinese population. Int J Clin Exp Pathol. 2015;8(11):15147–15154. [PMC free article] [PubMed] [Google Scholar]
- 5.Wang BJ, Liu J, Geng J, Zhang Q, Hu TT, Xu B. Association between three interleukin-10 gene polymorphisms and coronary artery disease risk: a meta-analysis. Int J Clin Exp Med. 2015;8(10):17842–1755. [PMC free article] [PubMed] [Google Scholar]
- 6.Koopal C, Geerlings MI, Muller M, de Borst GJ, Algra A, van der Graaf Y, Visseren FL, SMART Study Group The relation between apolipoprotein E (APOE) genotype and peripheral artery disease in patients at high risk for cardiovascular disease. Atherosclerosis. 2016 Jan 11;246:187–192. doi: 10.1016/j.atherosclerosis.2016.01.009. [DOI] [PubMed] [Google Scholar]
- 7.Zhang LL, Wang YQ, Fu B, Zhao SL, Kui Y. Aldehyde dehydrogenase 2 (ALDH2) polymorphism gene and coronary artery disease risk: a meta-analysis. Genet Mol Res. 2015;14(4):18503–18514. doi: 10.4238/2015.December.23.38. [DOI] [PubMed] [Google Scholar]
- 8.Goodarzynejad H, Boroumand M, Behmanesh M, Ziaee S, Jalali A. Cholesteryl ester transfer protein gene polymorphism (I405V) and premature coronary artery disease in an Iranian population. Bosn J Basic Med Sci. 2016;16(2):114–120. doi: 10.17305/bjbms.2015.942. doi:10.17305/bjbms.2016.942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Goodarzynejad H, Boroumand M, Behmanesh M, Ziaee S, Jalali A. The rs5888 single nucleotide polymorphism in scavenger receptor class B type 1 (SCARB1) gene and the risk of premature coronary artery disease: a case-control study. Lipids Health Dis. 2016;15(1):7. doi: 10.1186/s12944-016-0176-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Song HJ, Zhou XH, Guo L, Tian FL, Guo XF, Sun YX. Association of phosphodiesterase 4D gene and interleukin-6 receptor gene polymorphisms with ischemic stroke in a Chinese hypertensive population. Genet Mol Res. 2015;14(4):19396–19403. doi: 10.4238/2015.December.29.50. [DOI] [PubMed] [Google Scholar]
- 11.Yan L, Hu R, Tu S, Cheng WJ, Zheng Q, Wang JW, et al. Meta-analysis of association between IL-6 -634C/G polymorphism and osteoporosis. Genet Mol Res. 2015;14(4):19225–19232. doi: 10.4238/2015.December.29.32. [DOI] [PubMed] [Google Scholar]
- 12.Pohjanen VM, Koivurova OP, Niemelä SE, Karttunen RA, Karttunen TJ. Role of Helicobacter pylori and interleukin 6 -174 gene polymorphism in dyslipidemia: a case-control study. BMJ Open. 2016;6(1):e009987. doi: 10.1136/bmjopen-2015-009987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Ma H, Sun G, Wang W, Zhou Y, Liu D, Tong Y, et al. Association Between Interleukin-6 -572 C>G and -174 G>C Polymorphisms and Hypertension: A Meta-analysis of Case-control Studies. Medicine (Baltimore) 2016;95(2):e2416. doi: 10.1097/MD.0000000000002416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Buraczynska M, Zukowski P, Drop B, Baranowicz-Gaszczyk I, Ksiazek A. Effect of G(-174)C polymorphism in interleukin-6 gene on cardiovascular disease in type 2 diabetes patients. Cytokine. 2016;79:7–11. doi: 10.1016/j.cyto.2015.12.004. doi:10.1016/j.cyto.2015.12.004. [DOI] [PubMed] [Google Scholar]
- 15.Elsaid A, Abdel-Aziz AF, Elmougy R, Elwaseef AM. Association of polymorphisms G(-174)C in IL-6 gene and G(-1082)A in IL-10 gene with traditional cardiovascular risk factors in patients with coronary artery disease. Indian J Biochem Biophys. 2014;51(4):282–292. [PubMed] [Google Scholar]
- 16.Li L, Li E, Zhang LH, Jian LG, Liu HP, Wang T. IL-6-174G/C and IL-6-572C/G polymorphisms are associated with increased risk of coronary artery disease. Genet Mol Res. 2015;14(3):8451–8457. doi: 10.4238/2015.July.28.12. doi:10.4238/2015.July.28.12. [DOI] [PubMed] [Google Scholar]
- 17.Sun GQ, Wu GD, Meng Y, Du B, Li YB. IL-6 gene promoter polymorphisms and risk of coronary artery disease in a Chinese population. Genet Mol Res. 2014;13(3):7718–7724. doi: 10.4238/2014.September.26.9. [DOI] [PubMed] [Google Scholar]
- 18.Wang K, Dong PS, Zhang HF, Li ZJ, Yang XM, Liu H. Role of interleukin-6 gene polymorphisms in the risk of coronary artery disease. Genet Mol Res. 2015;14(2):3177–3183. doi: 10.4238/2015.April.10.29. doi:10.4238/2015.April.10.29. [DOI] [PubMed] [Google Scholar]
- 19.Yang HT, Wang SL, Yan LJ, Qian P, Duan HY. Association of interleukin gene polymorphisms with the risk of coronary artery disease. Genet Mol Res. 2015;14(4):12489–12496. doi: 10.4238/2015.October.16.16. [DOI] [PubMed] [Google Scholar]
- 20.Mormile R. Multiple sclerosis and susceptibility to cardiovascular diseases: Implications of ethnicity-related interleukin-17A gene polymorphism? Med Hypotheses. 2015;85(3):365–366. doi: 10.1016/j.mehy.2015.06.006. [DOI] [PubMed] [Google Scholar]
- 21.Qi X, Bai F, You C, Guo X, Shi L, Hu Z. High-resolution melting technology for detecting genetic polymorphisms of IL-1βand IL-1Ra in patients with coronary artery disease. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi. 2015;31(6):816–820. [PubMed] [Google Scholar]
- 22.Song Y, Gu HD, He Y, Wang JW. Role of IL-6 polymorphism on the development of cardiovascular events and coronary artery disease in patients receiving hemodialysis. Genet Mol Res. 2015;14(1):2631–2637. doi: 10.4238/2015.March.30.23. doi:10.4238/2015.March.30.23. [DOI] [PubMed] [Google Scholar]
- 23.Wang S, Dai YX, Chen LL, Jiang T, Zheng MQ, Li CG, et al. Effect of IL-1β, IL-8, and IL-10 polymorphisms on the development of myocardial infarction. Genet Mol Res. 2015;14(4):12016–12021. doi: 10.4238/2015.October.5.14. doi:10.4238/2015.October.5.14. [DOI] [PubMed] [Google Scholar]
- 24.Zou L, Zhao H, Gong X, Jiang A, Guan S, Wang L, et al. The association between three promoter polymorphisms of IL-1 and stroke: a meta-analysis. Gene. 2015;567(1):36–44. doi: 10.1016/j.gene.2015.04.054. [DOI] [PubMed] [Google Scholar]
- 25.Al Shahi H, Shimada K, Miyauchi K, Yoshihara T, Sai E, Shiozawa T, et al. Elevated Circulating Levels of Inflammatory Markers in Patients with Acute Coronary Syndrome. Int J Vasc Med. 2015;2015:805375. doi: 10.1155/2015/805375. doi:10.1155/2015/805375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Eiras S, Teijeira-Fernández E, Shamagian LG, Fernandez AL, Vazquez-Boquete A, Gonzalez-Juanatey JR. Extension of coronary artery disease is associated with increased IL-6 and decreased adiponectin gene expression in epicardial adipose tissue. Cytokine. 2008;43(2):174–180. doi: 10.1016/j.cyto.2008.05.006. doi:10.1016/j.cyto.2008.05.006. [DOI] [PubMed] [Google Scholar]
- 27.Elsenberg EH, Sels JE, Hillaert MA, Schoneveld AH, van den Dungen NA, van Holten TC, et al. Increased cytokine response after toll-like receptor stimulation in patients with stable coronary artery disease. Atherosclerosis. 2013;231(2):346–351. doi: 10.1016/j.atherosclerosis.2013.09.036. doi:10.1016/j.atherosclerosis.2013.09.036. [DOI] [PubMed] [Google Scholar]
- 28.Friedberg EC. DNA damage and repair. 2003;421(6921):436–440. doi: 10.1038/nature01408. [DOI] [PubMed] [Google Scholar]
- 29.Gigante B, Strawbridge RJ, Velasquez IM, Golabkesh Z, Silveira A, Goel A, et al. Analysis of the role of interleukin 6 receptor haplotypes in the regulation of circulating levels of inflammatory biomarkers and risk of coronary heart disease. PLoS One. 2015;10(3):e0119980. doi: 10.1371/journal.pone.0119980. doi:10.1371/journal.pone.0119980. [DOI] [PMC free article] [PubMed] [Google Scholar]