Skip to main content
PMC home page
Frontiers in Microbiology logoLink to Frontiers in Microbiology
. 2016 Sep 12;7:1409. doi: 10.3389/fmicb.2016.01409

Occurence of ArmA and RmtB Aminoglycoside Resistance 16S rRNA Methylases in Extended-Spectrum β-Lactamases Producing Escherichia coli in Algerian Hospitals

Amel Ayad 1,2,3, Mourad Drissi 4, Claire de Curraize 1, Chloé Dupont 5, Alain Hartmann 6, Sébastien Solanas 6, Eliane Siebor 1, Lucie Amoureux 1, Catherine Neuwirth 1,*
PMCID: PMC5018485  PMID: 27672380

Abstract

The aim of this study, was to characterize the extended-spectrum-β-lactamases (ESBLs) producing clinical strains of Escherichia coli isolated between January 2009 and June 2012 from Algerian hospitals and to determine the prevalence of 16S rRNA methylase among them. Sixty-seven ESBL-producers were detected among the 239 isolates included: 52 CTX-M-15-producers, 5 CTX-M-3-producers, 5 CTX-M-1-producers, 2 CTX-M-14-producers, 2 SHV-12-producers and one TEM-167-producer. Among the ESBL–producing strains twelve harbored 16S rRNA methylase genes: 8 rmtB and 4 armA. rmtB was located on a IncFIA plasmid and armA was located either on a IncL/M or a IncFIA plasmid. RmtB-producing isolates were genotypically related and belonged to the sequence type ST 405 whereas ArmA-producing isolates belonged to ST10, ST 167, and ST 117. This first description of 16S rRNA methylases among E. coli in Algerian hospitals pointed out the necessity to establish control measures to avoid their dissemination.

Keywords: Escherichia coli, extended-spectrum β-lactamase, 16S rRNA methylase, armA, rmtB, Algeria

Introduction

The emergence of β-lactam resistance in Escherichia coli which is the most common cause of Gram-negative infections has become a significant health concern, mainly due to the production of extended-spectrum beta-lactamases (ESBLs) (Pitout and Laupland, 2008). Indeed, CTX-M ESBLs (more than 150 enzymes) have increased significantly in Enterobacteriaceae, particularly in E. coli, in most regions of the world (Cantón and Coque, 2006). Another worrisome feature is the emergence of isolates resistant to all clinically important aminoglycosides related to the production of 16S rRNA methylases. In 2003, the first 16S rRNA methylase gene, armA, was identified (Galimand et al., 2003). To date eleven 16S rRNA methylases genes (rmtA, rmtB, rmtC, rmtD, rmtD2, rmtE, rmtF, rmtG, rmtH, armA, and npmA) have been identified, armA and rmtB being the most frequently described in Enterobacteriaceae (Galimand et al., 2003; Bogaerts et al., 2007; Yamane et al., 2007; Fritsche et al., 2008). As these genes are usually located on plasmids they can easily transfer to other bacteria (Nagasawa et al., 2014).

In Algeria, the first CTX-M enzymes have been reported in 2005 in clinical strains of Salmonella enterica from Constantine, East of Algeria (Naas et al., 2005). Since then, several surveys in the north of Algeria have reported the presence of CTX-M-type enzyme and associated resistance to non-β-lactam markers in various species of Enterobacteriaceae (Baba Ahmed-Kazi Tani and Arlet, 2014). Concerning 16S rRNA methylases only ArmA has been detected to date. It was identified for the first time in Enterobacteriaceae strains isolated from an Algerian patient transferred to Belgium (Bogaerts et al., 2007). It was subsequently identified in clinical isolates of S. enterica in Constantine associated with CTX-M-3 or CTX-M-15 (Naas et al., 2009, 2011) and in clinical strains of Salmonella non-Typhi in Annaba associated with CTX-M-15 and CMY-2 (Bouzidi et al., 2011). Recently, it was also described in clinical isolates of Klebsiella pneumoniae, Acinetobacter baumannii, Enterobacter cloacae, and Serratia marcescens (Bakour et al., 2014; Belbel et al., 2014; Batah et al., 2015; Khennouchi et al., 2015).

In this study, we have characterized the ESBL-producing clinical strains of E. coli isolated between October 2008 and June 2012 in three hospitals in Western Algeria and determined the prevalence of 16S rRNA methylase genes among them.

Materials and Methods

Bacterial Strains

Two hundred and thirty-nine isolates of E. coli collected between October 2008 and June 2012 from three different hospitals located in North-Western Algeria (Tlemcen, Sidi Bel Abbes and Oran) were included. Two hundred and thirty-seven strains were isolated from patients admitted to the intensive care unit (ICU), surgery and neurosurgery wards. Two isolates have been recovered from hospital environment. Identification was performed using the API 20E system (BioMerieux) and/or matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS).

Antibiotic Susceptibility Testing

Twenty three antibiotics (Bio-Rad) were tested (Table 1). Antibiotic susceptibility testing was determined by disk diffusion method and the minimum inhibitory concentration (MICs) of colistin was determined by a dilution method in Mueller-Hinton (MH) broth (Bio-Rad) as described by the European Committee on Antimicrobial Susceptibility Testing1. Detection of ESBL production was performed by double disk synergy test (Jarlier et al., 1988).

Table 1.

Antimicrobial resistance of extended-spectrum-β-lactamases producing Escherichia coli isolated from three hospitals in Algeria.

Antimicrobial agents Resistance rate (%)
Tlemcen Sidi Bel Abbes Oran Total
(n = 35) (n = 13) (n = 19) (n = 67)
Amoxicillin 100 100 100 100
Amoxicillin–clavulanic acid 82.8 92.3 42.1 73.1
Ticarcillin 100 100 100 100
Ticarcillin–clavulanic acid 97.1 100 89.5 95.5
Piperacillin 100 100 100 100
Piperacillin–tazobactam 40 15.4 0 23.9
Ertapenem 0 0 0 0
Imipenem 0 0 0 0
Cefoxitin 40 38.5 26.3 35.8
Cefotaxime 100 100 94.7 98.5
Ceftazidime 91.4 92.3 84.2 89.5
Cefepime 100 92.3 89.5 95.5
Aztreonam 100 100 100 100
Kanamicin 60 46.1 57.9 56.7
Gentamicin 77.1 76.9 63.2 73.1
Tobramycin 77.1 76.9 63.2 73.1
Amikacin 25.71 7.7 15.8 19.4
Netilmicin 48.6 61.5 57.9 53.7
Nalidixic acid 68.6 53.8 89.5 71.6
Ofloxacin 68.6 61.5 89.5 73.1
Ciprofloxacin 68.6 61.5 84.2 71.6
Colistin 0 0 0 0
Trimethoprim–Sulfamethoxazole 80 84.6 57.9 74.6
Open in a new tab

Bacterial DNA Preparation, Gene Amplification, and Sequencing

Bacterial DNA preparation, gene amplification, sequencing, and nucleotide sequence analysis were performed as previously described (Siebor and Neuwirth, 2011). The primers used for the PCRs are listed in Table 2. All the isolates were analyzed for the presence of blaCTX-M, blaTEM, and blaSHV. The resistant strains to all aminoglycosides tested were further analyzed for the presence of armA and rmtB.

Table 2.

Primers used for PCRs.

Amplified DNA Primer Oligonucleotide sequence (5′–3′)
TEM–F1 ATAAAATTCTTGAAGACGAAA
blaTEM TEM–F CTTATTCCCTTTTTTGCGGC
TEM–R GGTCTGACAGTTACCAATGC
blaSHV SHV–F GGGTTATTCTTATTTGTCGC
SHV–R GTTAGCGTTGCCAGTGCTCG
blaCTX-M CTX-M–F ATGTGCAGYACCAGTAA
CTX-M–R ACCGCRATATCRTTGGT
blaCTX-M group 1 CTX-M-gr1–F TCGTCTCTTCCAGA
CTX-M-gr1–R CCGTTTCCGCTATTA
blaCTX-M group 9 CTX-M-gr9–F ATGGTGACAAAGAGAGTGCA
CTX-M-gr9–R ACAGCCCTTCGGCGATGATT
armA armA-F GTGCGAAAACAGTCGTAG
armA-R GAAGTCAGGATACACCAG
rmtB rmtB-F GAGACACCGATGAACATC
rmtB-R CCTTCTGATTGGCTTATC
Open in a new tab

Genotyping of the Isolates Producing 16S rRNA Methylase

The strains were submitted to genotypic analysis by Pulsed-Field Gel Electrophoresis (PFGE) and Multilocus sequence typing (MLST). PFGE was performed following DNA digestion by XbaI as already described (Neuwirth et al., 1996). Restriction patterns were interpreted according to Tenover’s criteria (Tenover et al., 1995), and the isolates have been classified into different pulsotypes. Pulsotypes were compared by calculation of the Dice correlation coefficient with DendroUPGMA software2 and were clustered into a dendrogram by UPGMA. Strains were defined as having a clonal relationship at a criterium of 85% similarity (Ejrnaes et al., 2006). MLST was performed using seven conserved housekeeping genes of E. coli (adk, fumC, gyrB, icd, mdh, purA, and recA) as previously described (Wirth et al., 2006). The sequences types were determined by referring to the open-source software freely available at MLST Databases at the ERI, University College Cork website3.

Mating Experiments and Plasmids Analysis

Mating experiments to attempt to transfer resistance genes were carried out using rifampicin resistant E. coli K-12 C600 recipient strain as described previously (Chen et al., 2007). Transconjugants were selected on Drigalski agar plates containing amikacin (4 mg/L), gentamicin (4 mg/L), and rifampicin (200 mg/L), on Drigalski agar plates containing cefotaxime (4 mg/L) and rifampicin (200 mg/L), on Drigalski agar plates containing gentamicin (4 mg/L) and rifampicin (200 mg/L) and on Drigalski agar plates containing amikacin (30 mg/L) and rifampicin (200 mg/L).

Identification of plasmids by PCR-based replicon typing was performed on the donor strains and their transconjugants as described previously (Carattoli et al., 2005). Plasmid sizes were determined by digestion of whole-genome DNA with S1 endonuclease to linearize the plasmids and PFGE to separate them. Plasmids obtained were transferred to nylon membranes and hybridized with digoxigenin-labeled specific probes [blaCTX-M group 1, blaTEM, armA, rmtB, and replicon groups (IncL/M, IncFIA, IncFIB, and IncN)] (Barton et al., 1995).

Results

ESBL Producers

Sixty-seven ESBL-producing isolates have been detected: 35 from Tlemcen hospital, 13 from Sidi Bel Abbes hospital and 19 from Oran hospital. Isolates were mainly recovered from ICU (58.2%), followed by 26.9% from surgery department. Eighteen strains (26.9%) were recovered from wound pus, 17 (25.4%) from tracheal aspirate, 17 (25.4%) from urine and urinary catheters, 7 (10.4%) from rectal swabs, 4 (6%) from bedsores, 1 (1.5%) from catheter, 1 (1.5%) from gastric tube, and 2 (3%) from hospital environment. Among these strains 64 isolates (95.5%) carried blaCTX-M (52 blaCTX-M-15, 5 blaCTX-M-3, 5 blaCTX-M-1, 2 blaCTX-M-14), while 2 carried blaSHV-12 and 1 blaTEM-167.

All the ESBL-producing isolates remained susceptible to imipenem, ertapenem, and colistin and most of them to piperacillin-tazobactam (76%), cefoxitin (64.2%), and amikacin (80.6%). However most of the strains were resistant to all other antibiotics tested (>53%) (Table 1).

Characterization of 16S rRNA Methylase-Producers (Table 3; Supplementary Figure S1)

Table 3.

Characteristics of the 16S rRNA methylase producing E. coli strains isolated in Tlemcen, Sidi Bel Abbes, and Oran hospitals, Algeria.

Strain Hospital Ward Isolation date Sample ESBL (plasmid) 16S rRNA methylase (plasmid) PFGE pulsotypes MLST
T E62 Tlemcen Neurosurgery 19/10/2008 Bedsore blaCTX-M-15[Inc L/M 55 kb (T+)3] armA [same Inc L/M 55 kb (T+)] C ST 167 (CC ST 10)
S E23 Sidi Bel Abbes Neurosurgery 18/03/2010 Pus blaCTX-M-15[Inc L/M 55 kb (T+)] armA [same Inc L/M 55 kb (T+)] D ST 10 (CC ST 10)
0 E11 Oran ICU1 16/12/2010 Infected wound blaTEM-167[Inc N 40 kb (T+)] armA[Inc FIA size nd5 (T+)] B ST 117
0 E13 Oran Neurosurgery 16/12/2010 Gastric tube blaCTXM-1[Inc N 40 kb (T+)] armA[Inc FIA size nd (T-)] B ST 117
T E114 Tlemcen ICU 01/04/2010 Tracheal aspirate blaCTX-M-15[Inc FIA About 100 kb (T-)4] rmtB [same Inc FIA About 100 kb (T-)] A ST 405
T E116 Tlemcen ICU 02/05/2010 Rectal swab blaCTX-M-15[Inc I1 About 100 kb (T+)] rmtB [Inc FIA About 85 kb(T+)] A ST 405
T E117 Tlemcen ICU 20/05/2010 Tracheal aspirate blaCTX-M-15[Inc I1 About 100 kb (T+)] rmtB [Inc FIA About 85 kb (T+)] A ST 405
T E118 Tlemcen ICU 01/06/2010 Tracheal aspirate blaCTX-M-15[(Inc I1 About 100 kb (T+)] rmtB [Inc FIA About 85 kb (T+)] A ST 405
T E120 Tlemcen ICU 06/01/2011 Tracheal aspirate blaCTX-M-15[Inc I1 About 100 kb (T+)] rmtB [Inc FIA About 85 kb (T+)] A ST 405
T E124 Tlemcen ICU 27/02/2011 Rectal swab blaCTX-M-15[Inc FIA About 100 kb (T-)] rmtB [same Inc FIA About 100 kb (T-)] A ST 405
T E133 Tlemcen ENT2 21/04/2011 Catheter blaCTX-M-15[Inc FIA About 100 kb (T-)] rmtB [same Inc FIA About 100 kb (T-)] A ST 405
T E134 Tlemcen ICU 26/04/2011 Urine blaCTX-M-15[Inc FIA About 100 kb (T-)] rmtB [same Inc FIA About 100 kb (T-)] A ST 405
Open in a new tab

1ICU, intensif care unit. 2ENT, ear nose throat surgery. 3T+, obtention of transconjugant. 4T-, no transconjugant. 5nd, non determined.

Twelve isolates were resistant to all aminoglycosides tested of which four strains harbored armA and 8 rmtB. ArmA was detected among CTX-M-15, CTX-M-1, and TEM-167-producers whereas rmtB was detected only among CTX-M-15-producers (Table 3). The eight RmtB-producing strains all originated from Tlemcen hospital belonged to pulsotype A and to ST 405. A wider diversity was observed among the four ArmA-producers that belonged to three different pulsotypes (B, C, and D) and three different ST: ST10 (one isolate from Sidi Bel Abbes hospital), ST167 (one from Tlemcen hospital), and ST117 (two isolates from Oran hospital).

In the eight isolates, rmtB was located on a IncFIA plasmid. In four cases blaCTX-M-15 was located on the same plasmid while it was located on a IncI1 plasmid in the other four cases. IncFIA was transferred only in the presence of IncI1. armA was located either on a transferable IncL/M plasmid (with blaCTX-M-15) or on a IncFIA plasmid (in these two cases blaCTX-M-1 or blaTEM-167 were located on a IncN plasmid).

Discussion

Our results are in accord with previous studies and confirm that CTX-M-15 is the predominant ESBL encountered among E. coli in Algerian hospitals (Ramdani-Bouguessa et al., 2006; Baba Ahmed-Kazi Tani et al., 2013). The same situation is also observed in Tunisia (Mamlouk et al., 2006) and Morocco (Girlich et al., 2014) illustrating the large spread of CTX-M-15-producing E. coli in the north African countries. Nevertheless, the CTX-M-1, CTX-M-14, SHV-12, and TEM-167 ESBLs also detected in our study had never been reported to date among E. coli strains in Algeria. There is a single description of CTX-M-14-producing S. enterica collected from Draa-El-Mizan hospital, east of Algeria (Iabadene et al., 2009) whereas SHV-12 has already been detected in clinical isolates of K. pneumoniae and E. cloacae in Algeria (Baba Ahmed-Kazi Tani and Arlet, 2014). There is no description of TEM-167 to date, only blaTEM-167 is available in GenBank (FJ360884).

Our study further highlights the emergence of 16S rRNA methylase enzymes among ESBL-producing E. coli strains in the west of Algeria. Among our collection, the prevalence rate of 16S rRNA methylase determinants was 18%, which is very high compared to those reported in Japan (0.03%) (Yamane et al., 2007), in Turkey (0.7%) (Bercot et al., 2010), in France (1.3%) (Bercot et al., 2008), and in China (10%) (Wu et al., 2009). The detection of RmtB-producing E. coli is an interesting finding of our study. Indeed the RmtB enzyme has never been reported in Algeria. The eight isolates producing RmtB were genotypically related and belonged to ST405. Interestingly ST405 associated or not with production of CTX-M-15 ESBL is increasingly reported worldwide and belongs to the high-risk clones in the dissemination of antibiotic resistance (Woodford et al., 2011). The association of blaCTX-M-15 and rmtB on a conjugative plasmid (also carrying the plasmid-mediated fluoroquinolone efflux pump gene qepA) in one ST405 E. coli isolate has been reported in the United States (Tian et al., 2011) but the plasmid was not typed by PCR-based replicon.

All RmtB-producers have been recovered in Tlemcen Hospital and seven of them were collected in ICU suggesting patient cross contamination in this ward.

Therefore there is a need to reinforce the compliance of health-care workers with the infection control measures. The epidemiological results concerning ArmA-producers is quite different: the four isolates recovered in three hospitals in Western Algeria belonged to three different pulsotypes suggesting horizontal spread of the resistance determinants among E. coli. There are several reports of ArmA-producers among different species of Enterobacteriaceae and also A. baumannii from Algerian Hospitals (Bogaerts et al., 2007; Naas et al., 2009, 2011; Bouzidi et al., 2011; Bakour et al., 2014; Belbel et al., 2014; Batah et al., 2015; Khennouchi et al., 2015). The production of 16S rRNA methylase together with the production of ESBL observed in our study (RmtB plus CTX-M-15 or ArmA plus CTX-M-15) corresponds to an emerging and threatening combination reported worldwide (Bogaerts et al., 2007; Khennouchi et al., 2015). To our best knowledge two combinations detected in our study were not reported before: ArmA plus CTX-M-1 and ArmA plus TEM-167 in two isolates clonally related (OE11 and OE13) recovered simultaneously from Oran’s hospital.

Our data indicated that the diversity of ESBL among E. coli is growing in Algerian hospitals (CTX-M-1, CTX-M-14, CTX-M-15, TEM-167, and SHV-12) and that new mechanisms are emerging (16S rRNA methylases). In our study 11 out of 12 isolates that co-produced ESBL and methylase were resistant to all antibiotics tested except carbapenems and colistin, making of them the only available therapeutic option for these strains. Therefore the public health impact is potentially important.

Conclusion

There is a need for implementation of antimicrobial stewardship programs in Algerian hospitals to make the best use of the available antibiotics and to avoid as much as possible the unreasonable use of broad-spectrum molecules leading to the emergence of resistant isolates. Also strict control measures have to be elaborated to avoid the spread of multiresistant organisms such as those described here that co-produced ESBL and 16S rRNA methylase.

Author Contributions

AA: Selected the isolates, performed the characterization of the ESBL, of the methylase, the analysis by PFGE, the MLST analysis and manuscript preparation. MD: Designed the study. CdC and LA: Participated to genotyping and interpretation. ES: Sequence analysis and manuscript preparation. AH and SS: Performed plasmid analysis. CD: Performed PFGE analysis (dendrogram). CN: Choice of the isolates, choice of the tools, interpretation of the results and manuscript preparation.

Conflict of Interest Statement

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Footnotes

Supplementary Material

The Supplementary Material for this article can be found online at: http://journal.frontiersin.org/article/10.3389/fmicb.2016.01409

Click here for additional data file. (163KB, PDF)

References

  1. Baba Ahmed-Kazi Tani Z., Arlet G. (2014). News of antibiotic resistance among Gram-negative bacilli in Algeria. Pathol. Biol. 62 169–178. 10.1016/j.patbio.2014.01.005 [DOI] [PubMed] [Google Scholar]
  2. Baba Ahmed-Kazi Tani Z., Decré D., Genel N., Boucherit-Otmani Z., Arlet G., Drissi M. (2013). Molecular and epidemiological characterization of enterobacterial multidrug resistant strains in Tlemcen Hospital (Algeria) (2008–2010). Microb. Drug Resist. 19 185–190. 10.1089/mdr.2012.0161 [DOI] [PubMed] [Google Scholar]
  3. Bakour S., Touati A., Bachiri T., Sahli F., Tiouit D., Naim M., et al. (2014). First report of 16S rRNA methylase ArmA-producing Acinetobacter baumannii and rapid spread of metallo-β-lactamase NDM-1 in Algerian hospitals. J. Infect. Chemother. 20 696–701. 10.1016/j.jiac.2014.07.010 [DOI] [PubMed] [Google Scholar]
  4. Barton B. M., Harding G. P., Zuccarelli A. J. (1995). A general method for detecting and sizing large plasmids. Anal. Biochem. 226 235–240. 10.1006/abio.1995.1220 [DOI] [PubMed] [Google Scholar]
  5. Batah R., Loucif L., Olaitan A. O., Boutefnouchet N., Allag H., Rolain J. M. (2015). Outbreak of Serratia marcescens coproducing ArmA and CTX-M-15 mediated high levels of resistance to aminoglycoside and extended-spectrum beta-lactamases, Algeria. Microb. Drug Resist. 21 470–476. 10.1089/mdr.2014.0240 [DOI] [PubMed] [Google Scholar]
  6. Belbel Z., Chettibi H., Dekhil M., Ladjama A., Nedjai S., Rolain J. M. (2014). Outbreak of an armA methyltransferase-producing ST39 Klebsiella pneumoniae clone in a pediatric Algerian Hospital. Microb. Drug Resist. 20 310–315. 10.1089/mdr.2013.0193 [DOI] [PubMed] [Google Scholar]
  7. Bercot B., Poirel L., Nordmann P. (2008). Plasmid-mediated 16S rRNA methylases among extended-spectrum β-lactamase-producing Enterobacteriaceae isolates. Antimicrob. Agents Chemother. 52 4526–4527. 10.1128/AAC.00882-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bercot B., Poirel L., Ozdamar M., Hakko E., Turkoglu S., Nordmann P. (2010). Low prevalence of 16S methylases among extended-spectrum- β-lactamase-producing Enterobacteriaceae from a Turkish hospital. J. Antimicrob. Chemother. 65 797–798. 10.1093/jac/dkq003 [DOI] [PubMed] [Google Scholar]
  9. Bogaerts P., Galimand M., Bauraing C., Deplano A., Vanhoof R., De Mendonca R., et al. (2007). Emergence of ArmA and RmtB aminoglycoside resistance 16S rRNA methylases in Belgium. J. Antimicrob. Chemother. 59 459–464. 10.1093/jac/dkl527 [DOI] [PubMed] [Google Scholar]
  10. Bouzidi N., Aoun L., Dekhil M., Granier S. A., Poirel L., Brisabois A., et al. (2011). Co-occurrence of aminoglycoside resistance gene armA in non-Typhi Salmonella isolates producing CTX-M-15 in Algeria. J. Antimicrob. Chemother. 66 2180–2181. 10.1093/jac/dkr237 [DOI] [PubMed] [Google Scholar]
  11. Cantón R., Coque T. M. (2006). The CTX-M β-lactamase pandemic. Curr. Opin. Microbiol. 9 466–475. 10.1016/j.mib.2006.08.011 [DOI] [PubMed] [Google Scholar]
  12. Carattoli A., Bertini A., Villa L., Falbo V., Hopkins K. L., Threlfall E. J. (2005). Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods 63 219–228. 10.1016/j.mimet.2005.03.018 [DOI] [PubMed] [Google Scholar]
  13. Chen L., Chen Z. L., Liu J. H., Zeng Z. L., Ma J. Y., Jiang H. X. (2007). Emergence of RmtB methylase-producing Escherichia coli and Enterobacter cloacae isolates from pigs in China. J. Antimicrob. Chemother. 59 880–885. 10.1093/jac/dkm065 [DOI] [PubMed] [Google Scholar]
  14. Ejrnaes K., Sandvang D., Lundgren B., Ferry S., Holm S., Monsen T., et al. (2006). Pulsed-field gel electrophoresis typing of Escherichia coli strains from samples collected before and after pivmecillinam or placebo treatment of uncomplicated community-acquired urinary tract infection in women. J. Clin. Microbiol. 44 1776–1781. 10.1128/JCM.44.5.1776-1781.2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Fritsche T. R., Castanheira M., Miller G. H., Jones R. N., Armstrong E. S. (2008). Detection of methyltransferases conferring high-level resistance to aminoglycosides in Enterobacteriaceae from Europe, North America, and Latin America. Antimicrob. Agents Chemother. 52 1843–1845. 10.1128/AAC.01477-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Galimand M., Courvalin P., Lambert T. (2003). Plasmid-mediated highlevel resistance to aminoglycosides in Enterobacteriaceae due to 16S rRNA methylation. Antimicrob. Agents Chemother. 47 2565–2571. 10.1128/AAC.47.8.2565-2571.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Girlich D., Bouihat N., Poirel L., Benouda A., Nordmann P. (2014). High rate of faecal carriage of extended-spectrum b-lactamase and OXA-48 carbapenemase-producing Enterobacteriaceae at a University hospital in Morocco. Clin. Microbiol. Infect. 20 350–354. 10.1111/1469-0691.12325 [DOI] [PubMed] [Google Scholar]
  18. Iabadene H., Bakour R., Messai Y., Da Costa A., Arlet G. (2009). Detection of blaCTX-M-14 and aac(3)-II genes in Salmonella enterica serotype Kedougou in Algeria. Med. Mal. Infect. 39 806–807. 10.1016/j.medmal.2009.04.003 [DOI] [PubMed] [Google Scholar]
  19. Jarlier V., Nicolas M. H., Fournier G., Philippon A. (1988). Extended broad-spectrum b-lactamases conferring transferable resistance to newer b-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Rev. Infect. Dis. 10 867–878. 10.1093/clinids/10.4.867 [DOI] [PubMed] [Google Scholar]
  20. Khennouchi N. C., Loucif L., Boutefnouchet N., Alleg H., Rolain J. M. (2015). MALDI-TOF MS as a tool to detect a nosocomial outbreak of extended-spectrum beta-lactamase- and ArmA methyltransferase-producing Enterobacter cloacae clinical isolates in Algeria. Antimicrob. Agents Chemother. 59 6477–6483. 10.1128/AAC.00615-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Mamlouk K., Boutiba-Ben Bakour I., Gautie V., Vimont S., Picard B., Redjeb S. B., et al. (2006). Emergence and outbreaks of CTX-M extended spectrum β-lactamase producing Echerichia coli and Klebsiella pneumoniae strains in a Tunisian hospital. J. Clin. Microbiol. 44 4049–4056. 10.1128/JCM.01076-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Naas T., Bentchouala C., Cuzon G., Yaou S., Lezzar A., Smati F., et al. (2011). Outbreak of Salmonella enterica serotype Infantis producing ArmA 16S RNA methylase and CTX-M-15 extended-spectrum β-lactamase in a neonatology ward in Constantine, Algeria. Int. J. Antimicrob. Agents 38 135–139. 10.1016/j.ijantimicag.2011.04.012 [DOI] [PubMed] [Google Scholar]
  23. Naas T., Bentchouala C., Lima S., Lezzar A., Smati F., Scheftel J. M., et al. (2009). Plasmid-mediated 16S rRNA methylases among extended-spectrum-beta-lactamase-producing Salmonella enterica Senftenberg isolates from Algeria. J. Antimicrob. Chemother. 64 866–868. 10.1093/jac/dkp312 [DOI] [PubMed] [Google Scholar]
  24. Naas T., Lezzar A., Bentchouala C., Smati F., Scheftel J. M., Monteil H., et al. (2005). Multidrug-resistant Salmonella enterica serotype Senftenberg isolates producing CTX-M beta-lactamases from Constantine, Algeria. J. Antimicrob. Chemother. 56 439–440. 10.1093/jac/dki216 [DOI] [PubMed] [Google Scholar]
  25. Nagasawa M., Kaku M., Kamachi K., Shibayama K., Arakawa Y., Yamaguchi K., et al. (2014). Loop-mediated isothermal amplification assay for 16S rRNA méthylases genes in Gram-negative bacteria. J. Infect. Chemother. 20 635–638. 10.1016/j.jiac.2014.08.013 [DOI] [PubMed] [Google Scholar]
  26. Neuwirth C., Siebor E., Lopez J., Pechinot A., Kazmierczak A. (1996). Outbreak of TEM-24-Producing Enterobacter aerogenes in an intensive care unit and dissemination of the extended-spectrum β-lactamase to other members of the family Enterobacteriaceae. J. Clin. Microbiol. 34 76–79. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Pitout J. D. D., Laupland K. B. (2008). Extended-spectrum-beta-lactamases producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect. Dis. 8 159–166. 10.1016/S1473-3099(08)70041-0 [DOI] [PubMed] [Google Scholar]
  28. Ramdani-Bouguessa N., Mendonça N., Leitao J., Ferreira E., Tazir M., Caniça M. (2006). CTX-M-3 and CTXM- 15 extended-spectrum b-lactamases in isolates of Escherichia coli from a hospital in Algiers, Algeria. J. Clin. Microbiol. 44 4584–4586. 10.1128/JCM.01445-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Siebor E., Neuwirth C. (2011). The new variant of Salmonella genomic island 1 (SGI1-V) from a Proteus mirabilis French clinical isolate harbours blaVEB-6 and qnrA1 in the multiple antibiotic resistance region. J. Antimicrob. Chemother. 66 2513–2520. 10.1093/jac/dkr335 [DOI] [PubMed] [Google Scholar]
  30. Tenover F. C., Arbeit R. D., Goering R. V., Mickelsen P. A., Murray B. E., Persing D. H., et al. (1995). Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33 2233–2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Tian G. B., Rivera J. I., Park Y. S., Johnson L. E., Hingwe A., Adams-Haduch J. M., et al. (2011). Sequence type ST405 Escherichia coli isolate producing QepA1, CTX-M-15, and RmtB from Detroit, Michigan. Antimicrob. Agents Chemother. 55 3966–3967. 10.1128/AAC.00652-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Wirth T., Falush D., Lan R., Colles F., Mensa P., Wieler L. H., et al. (2006). Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol. 60 1136–1151. 10.1111/j.1365-2958.2006.05172.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Woodford N., Turton J. F., Livermore D. M. (2011). Multiresistant Gram-negative bacteria: the role of high-risk clones in the dissemination of antibiotic resistance. FEMS Microbial. Rev. 35 736–755. 10.1111/j.1574-6976 [DOI] [PubMed] [Google Scholar]
  34. Wu Q., Zhang Y., Han L., Sun J., Ni Y. (2009). Plasmid-mediated 16S rRNA méthylases in aminoglycoside-resistant Enterobacteriaceae isolates in Shanghai, China. Antimicrob. Agents Chemother. 53 271–272. 10.1128/AAC.00748-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Yamane K., Wachino J., Suzuki S., Shibata N., Kato H., Shibayama K., et al. (2007). 16S rRNA methylase-producing gram-negative pathogens, Japan. Emerg. Infect. Dis. 13 642–646. 10.3201/eid1304.060501 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file. (163KB, PDF)

Articles from Frontiers in Microbiology are provided here courtesy of Frontiers Media SA

RESOURCES