Skip to main content
Journal of Clinical and Diagnostic Research : JCDR logoLink to Journal of Clinical and Diagnostic Research : JCDR
. 2016 Jul 1;10(7):DC09–DC13. doi: 10.7860/JCDR/2016/16417.8152

A Pilot Study on Carbapenemase Detection: Do We See the Same Level of Agreement as with the CLSI Observations

Agila Kumari Pragasam 1, Rani Diana Sahni 2, Shalini Anandan 3, Archa Sharma 4, Radha Gopi 5, Noorjahan Hadibasha 6, Priya Gunasekaran 7, Balaji Veeraraghavan 8,✉
PMCID: PMC5020186  PMID: 27630840

Abstract

Introduction

Rapid identification of carbapenemase producing organisms is of great importance for timely detection, treatment and implementation of control measures to prevent the spread. The Modified Hodge Test (MHT) and Carba NP test is recommended by CLSI for the detection of carbapenemases in Enterobacteriaceae. However, MHT may give false positive results or fail to detect metallo β-lactamases (MBLs). In the US, MHT is the most widely used test for detection of carbapenemases and has been found to have a sensitivity and specificity of >90% for blaKPC producers. However, in India, the prevalence of blaNDM is higher than blaKPC producers.

Aim

To evaluate the usefulness of CarbaNP in an Indian setting.

Materials and Methods

A total of 260 isolates of carbapenem resistant E.coli (n=57), Klebsiella spp. (n=85), Pseudomonas aeruginosa (n=60), and Acinetobacter baumannii (58) isolated from clinical specimens between 2012-2014 at the Christian Medical College, Vellore were included in the study. All the carbapenem resistant isolates were subjected to CarbaNP, MHT and multiplex PCR for detection of carbapenemase genes.

Results

CarbaNP was found to be positive in 88% (n=50/57), 81% (n=69/51), 38% (n=23/60) and 81% (n=47/58) for E.coli, Klebsiella spp., P. aeruginosa, and A. baumannii respectively. While in MHT it showed, 89% (n=51/57) and 81 % (n=69/85) for E.coli and Klebsiella spp. respectively. In P.aeruginosa, synergy testing of imipenem plus cloxacillin showed that, 65% of CarbaNP negatives were ampC producers. Overall, the sensitivity and specificity of CarbaNP was found to be 94% and 100 for blaNDM; 77% and 100 % for blaOXA-48 like producers and 81% and 100% for CarbAcinetoNP respectively.

Conclusion

This observation was more than what was reported in CLSI guidelines. Therefore, it is advisable to evaluate an assay for better laboratory diagnosis at respective regions.

Keywords: CarbaNP, MHT, Metallo beta lactamases, Class D Oxacillinases

Introduction

Carbapenems are considered to be the drugs of last resort for treating multi drug resistant pathogens due to their excellent clinical efficacy and safety profiles. Resistance to carbapenem groups of drugs is on the rise. It is especially of concern in the nosocomial pathogens which are multidrug resistant. The most common mechanism of carbapenem resistance is the production of carbapenemase enzymes. These enzymes are carried on mobile plasmids and have a greater propensity to cause outbreaks [1]. Carbapenemases are classified based on their functional and molecular properties. Molecular classes A and D are the β-lactamases having serine at their active site, whereas molecular class B β-lactamases are all metallo-enzymes with zinc at their active site. Carbapenemases belonging to class A of molecular classification include blaKPC, blaGES, blaIMI, blaSME and blaSFC

Ambler class B, carbapenemases which were widely found in Pseudomonas and other non-fermenting Gram negative bacilli are now being increasingly identified in Enterobacteriaceae and are inhibited by EDTA [2]. Various families of MβLs are identified in different parts of the world namely blaIMP, blaVIM, blaSPM, blaGIM and blaSIM. Of these, members of VIM and IMP family have a worldwide distribution. Recent identification of New Delhi metallo-β-lactamase-1 (blaNDM-1) producers, originally in the United Kingdom, India, and Pakistan and now reported worldwide which is worrisome. Importantly, blaNDM is now the most commonly isolated enzyme from the Indian subcontinent and is rapidly spreading worldwide [3]. Carbapenemases of the oxacillinase-48 type have been identified mostly in Mediterranean and European countries and in India. This group of β-lactamases is capable of hydrolyzing penicillins, cloxacillin, oxacillin. Their prevalence is on a rise and recent studies found that these were the predominant carbapenemases in countries like France and Belgium [4,5].

Carbapenemases are a versatile group of β-lactamases that are characterized by their resistance to virtually all β-lactam antibiotics, including the cephalosporins and carbapenems. However, the hydrolysis profile varies for each group of carbapenemases [6], wherein metallo β-lactamases (MBLs) does not hydrolyze aztreonam. Till date, many numbers of different carbapenemases have been identified and within each carbapenemases, many variants have been found (Laheystudies.org). In India, the most common carbapenemase are blaNDM, blaVIM and blaOXA-48 like enzymes [7]. Rapid detection of carbapenemases using tests with a short turnaround time is essential to ensure early detection and timely implementation of control measures in hospitals. Preliminary screening is with the Disk Diffusion (DD) testing of imipenem or meropenem which is done on routine basis in most of the laboratories. For confirmatory testing, the Modified Hodge test (MHT) is recommended by CLSI for the detection of carbapenemases in Enterobacteriaceae [8]. However, MHT may give false positive results [9] or fail to detect MBLs and can detect up to11% of the isolates [8]. In the US, MHT is the most widely used test for detection of carbapenemases and has been found to have a sensitivity and specificity of >90% for blaKPC producers [8]. However, in India, the prevalence of blaNDM is higher than that of blaKPC producers [10].

In contrast, many groups have reported higher sensitivity in detecting MBLs above 11% as mentioned by CLSI. Additionally, a study has shown it may be possible to improve the sensitivity of MHT in detecting the MBL producers by adding zinc to the test medium as well [11]. Nordmann and Poirel described Carba NP for the detection of carbapenemase producing clinical isolates of Enterobacteriaceae and Pseudomonas spp. [12,13]; and CarbAcineto NP for Acinetobacter spp. [14]. Recently, Carba NP has been introduced as a confirmatory test for carbapenemase producers by CLSI M100-S25 [15].

As the carbapenem resistance rates are high, rapid detection is very important for guiding appropriate antimicrobial therapy and also to implement appropriate control measures. Henceforth, we undertook this pilot study to evaluate MHT and CarbaNP test for timely detection of carbapenemase producers from pathogens isolated from the clinical specimens at a tertiary care centre in South India.

Materials and Methods

Phenotypic Characterization

Bacterial isolates: A total of 260 isolates resistant to imipenem and meropenem isolated from blood and respiratory specimens were included in this study prospectively from all age groups. Of these 57, 85, 60 and 58 were carbapenem resistant E.coli, Klebsiella spp., Pseudomonas aeruginosa and Acinetobacter baumannii respectively. All the study isolates were identified up to species level as per standard protocols which includes, mannitol motility, triple sugar iron, citrate utilization and indole production test for Enterobacteriaceae; Oxidase, catalase, nitrate reduction, sugar fermentation such as lysine, ornithine and arginine tests for Pseudomonas aeruginosa and Acinetobacter baumannii [16]. They were sourced from various clinical specimens collected between 2012 and 2014 at Christian Medical College, Vellore, South India. The screening for the carbapenem resistance for the study isolates were carried out using Kirby Bauer disc diffusion for imipenem (10μg) and meropenem (10μg) along with the routinely tested antimicrobial agents such as cephalosporins (cefotaxime, ceftazidime); β-lactam/β-lactamase inhibitors (Piperacillin/tazo bactam, cefoperazone/sulbactam); carbapenems (imipenem, meropenem); fluoroquinolones (ciprofloxacin, levofloxacin); PB300 units and tigecycline (For Klebsiella spp. and Acinetobacter spp.) and interpreted according to CLSI guidelines M100-S22, M100-S23, M100-S24.

Modified Hodge Test: MHT was performed only for E.coli and Klebsiella spp. as per CLSI recommendations M100-S21 [8]. Lawn culture of 1 in 10 diluted, 0.5 McFarland turbidity of susceptible ATCC 25922 E.coli was made and ertapenem disc of 10 μg/ml was placed in the centre. Test isolate and controls were streaked onto the lawn culture from centre to periphery. Following 24 hours incubation, presence of clover leaf like indentation was taken as positive for the carbapenemase production and absence of indentation was taken as negative. K.pneumoniae ATCC BAA 1705 and K. pneumoniae ATCC BAA 1706 were used as positive and negative controls for all the assays respectively. Presence of clover leaf like indentation along the streak line of the test isolate indicating the growth of the carbapenem susceptible strain (E.coliATCC 25922) was taken as a positive for carbapenemase production. While, absence of indentation was taken as a negative result for carbapenemase production.

Carba NP test: For all carbapenem resistant E.coli, Klebsiella spp. and P. aeruginosa, Carba NP test was done and a modified protocol of CarbAcineto NP was used for A. baumannii as recommended by Nordmann and Poirel [6–8]. Since Class D Oxacillinases are more prevalent in Acinetobacter spp., a modified protocol using 5 M NaCl was used instead of B-PER II lysis buffer, to avoid any buffer effect, as Oxa enzymes possess weak carbapenemase activity. All the study isolates subjected to CarbaNP and CarbAcineto NP were grown on Mueller Hinton agar plates for 24 hours and the isolated colonies were used for testing. K. pneumoniae ATCC BAA 1705 and K. pneumoniae ATCC BAA 1706 were used as positive and negative controls in all the assays, respectively. CarbaNP test was performed in two 1.5ml Eppendorf tubes labeled as control and test. 0.1 ml of B-PER II Lysis buffer (Thermo Scientific Cat.no. 78260) was taken in both the tubes. 10 μl loopfull of colonies to be tested was inoculated in both the tubes and vortexed briefly. Following that, 0.1ml of phenol red solution with 6μg/ml imipenem was added in the tube labeled as test and 0.1 ml of phenol red solution without imipenem was added in the tube labeled as control. The tubes were incubated at 37oC for upto two hours. Every 15 minutes once, the tubes were checked for the colour change. Change of the phenol red indicator from red to yellow was taken as a positive for carbapenemase producers. Absence of colour change from red to yellow was taken as negative result. The observation of colour change was taken by two independent readers. Imipenem+cloxacillin test: Combination disc test of imipenem and imipenem plus cloxacillin was used to demonstrate the synergy of cloxacillin with imipenem in order to differentiate between carbapenemase and non-carbapenemase producers (only for P.aeruginosa) [17]. Cloxacillin of 4000μg/ml was used alone and in combination with imipenem (10 μg/ml). Zone diameter of >5mm difference between imipenem alone and in combination of imipenem plus cloxacillin was taken as a positive result for hyper AmpC producers.

Molecular Characterization

Multiplex PCR for Detection of Carbapenemase genes

All the test isolates were grown on blood agar overnight and whole genomic DNA was extracted by boiling lysis method [18]. Conventional multiplex PCR was done for the detection of carbapenemase genes such as blaSPM, blaIMP, blaVIM, blaNDM, blaKPC and blaOXA-48 like. In addition, blaOXA-51, blaOXA-23 and blaOXA-24 genes were screened for A. baumannii isolates. Further, presence of blaOXA-51 was carried out to confirm that all studied isolates are A.baumannii [19–25]. The amplicons were visualized in 2% agarose gel with staining of ethidium bromide. Known positive controls for appropriate genes were used (Courtesy: IHMA, Inc., USA). Primers and cycling conditions are mentioned in [Table/Fig-1]. Furthermore, a total of 30 carbapenem susceptible isolates of E.coli and 30 carbapenem susceptible Klebsiella spp. were included in the assay as a comparator.

[Table/Fig-1]:

Primers used for the carbapenemase gene identification.

Genes Primers Product
Size (bp)
Annealing temp (oC) References
blaIMP GGAATAGAGTGGCTTAAYTCTC 232 59 [11]
GGTTTAAYAAAACAACCACC
blaVIM GATGGTGTTTGGTCGCATA 390 59 [12]
CGAATGCGCAGCACCAG
blaOXA-48 like TATATTGCATTAAGCAAGGG 800 59 [13]
CACACAAATACGCGCTAACC
blaNDM CACCTCATGTTTGAATTCGCC 984 59 [14]
CTCTGTCACATC GAAATCGC
blaKPC TGTCACTGTATCGCCCGTC 1011 59 [15]
CTGAGTGCTCTACAGAAAACC
blaSPM AAAATCTGGGTACGCAAACG 271 59 [16]
ACATTATCCGCTGGAACAGG
blaOXA-51 TAATGCTTTGATCGGCCTTG 353 57 [17]
TGGATTGCACTTCATCTTGG
blaOXA-23 like GATCGGATTGGAGAACCAGA 501 52
ATTTCTGACCGCATTTCCAT
blaOXA-24/40 like GGTTAGTTGGCCCCCTTAAA 246 52
AGTTGAGCGAAAAGGGGATT

Statistical Method

Statistical analysis of the categorical data was done using SPSS Version 16.0. The sensitivity and specificity of CarbaNP test were calculated and compared with PCR results as a gold standard, for the individual carbapenemase encoding genes respectively.

Results

CarbaNP was found to be positive in 88% (n=50/57) of E.coli, 81% (n=69/85) of Klebsiella spp., 38% (n=23/60) of P. aeruginosa and CarbAcineto NP was positive in 81% (n=47/58) of A. baumannii. MHT was found to be positive in 89% (n=51/57) of E.coli and 81% (n=69/85) of Klebsiella spp. [Table/Fig-2,3].

[Table/Fig-2]:

Results of carbapenem resistance characterization by phenotypic and molecular methods for E.coli and Klebsiella spp.

Carba NP MHT blaNDM blaOxa48 like blaNDM+blaOxa-48*
blaNDM+blaVIM†
No carbapenemase detected Remarks
Total no tested: Klebsiella pneumoniae (n=85)
Klebsiella spp. (n=68) + + 18 35 13*; 1† 1‡ Among blaoxa-48 like producer, 36 out of 47 isolates were detected by CarbaNP and 46 out of 47 were detected by MHT with one isolate negative for both, which could be due to mucoid phenotype/poor carbapenemase activity
Similarly among blaNDM producers, 19 out of 20 were detected by Carba NP and 18 among 19 were detected by MHT. Both the results are not in concurrence with the CLSI statement as only 11 % blaoxa-48 like producers can be detected by CarbaNP, while we detected 74% and only 11% of blaNDM can be detected by MHT, as we detected 95% of isolates.
*,†CarbaNP positivity may be due to blaNDM co-production
Klebsiella spp. (n=14) - + 1 11 1; 1 0 Carba NP Fails in the detection of 11 isolates of blaoxa-48like producers, while MHT aids in the detection
Klebsiella spp. (n=2) - - - 1 - 1‡ blaOXA-48 like negativity could be due to mucoid phenotype/poor carbapenemase activity
‡Could be due to other resistant mechanisms
Klebsiella spp. (n=1) + - 1 - - - blaNDM producer fails to be detected by MHT while CarbaNP detected
Total no tested: E.coli (n=57)
E.coli (n=46) + + 28 8 5 5‡ In E.coli, blaNDM were predominant. Among 33 blaNDM producers, 31 were detected by CarbaNP; out of 10 blaOxa-48 like enzymes, 9 were picked up by CarbaNP. Same numbers were picked up by MHT as well
E.coli (n=5) - + 1 1 3 - CarbaNP fails to detect 1 blaOXA-48 like and 1 blaNDM producer
E.coli (n=4) + - 3 1 - - blaNDM producer fails to be detected by MHT while CarbaNP detected
E.coli (n=2) - - 1 - - 1‡ blaNDM negativity could be due to mucoid phenotype
‡Could be due to other resistant mechanisms

[Table/Fig-3]:

Results of carbapenem resistance characterization by phenotypic and molecular methods for P. aeruginosa and A. baumannii.

CarbaNP blaNDM blaVIM blaOXA-48 like
blaNDM+blaOXA-23*
Class D blaOXA (23†& 24‡) No Carbapenemases genes detected Remarks
P. aeruginosa: total tested (n=60)
P. aeruginosa (n=23) + 9 9 1 Not done 4§ Excellent sensitivity in detecting MβL producers
§could be other MβL genes which were not included in the multiplex PCR panel/any other mechanisms
P. aeruginosa (n=37) - 1 2 - Not done 34|| Fails to detect one blaNDM and two blaVIM isolates may be due to mucoid phenotypes
|| majority of isolates were negative for CarbaNP and PCR, indicating the prevalence of intrinsic mediated resistance mechanisms such as ampC+porins or efflux pumps
A. baumannii: total tested (n=58)
A. baumannii (n=47) + - - 9* 38† - †CarbAcineto NP protocol is better for detection of class D blaOXA-23 producers
A. baumannii (n=11) - - - - 11‡ - ‡Out of 49 blaOXA-23 producers, CarbAcineto NP fails to pick up 11 isolates

The multiplex PCR for the detection of carbapenemase genes revealed the presence of 57 blaOXA-48like producers, 53 blaNDM producers, 11 blaVIM producers and few co-producers of blaNDM+blaOXA-48like, blaNDM+blaVIM and blaNDM+blaOXA-23 as listed in [Table/Fig-3,4]. Synergism testing of imipenem plus cloxacillin for Carba NP negative isolates of P. aeruginosa revealed that, out of 37 isolates, 24 were positive for AmpC plus porin loss detection.

[Table/Fig-4]:

Sensitivity and specificity of carbapenemase detection assays

Sensitivity and Specificity rates
Carbapenemases CLSI India (present study)
Sensitivity and
specificity
Sensitivity Specificity
Modified Hodge Test blaOXA-48like >90% 96 100
blaNDM Up to 11% 90 100
Carba NP blaOXA-48like Up to 11% 77 100
blaNDM >90% 94 100
CarbAcineto NP Class D Carbapenemase:
blaOxa23,24,58 which is more predominant in Acinetobacter spp.
Non committal 81 100

The overall sensitivity and specificity of CarbaNP were found to be 84 % and 100% respectively. The sensitivity and specificity for MHT was found to be 96 % and 100 % for blaOXA-48 like producers and 90% and 100% for blaNDM producers. While, sensitivity and specificity of CarbaNP shows 77% and 100% for blaOXA-48 like producers and 94% and 100% for blaNDM producers. On the other hand, CarbAcineto NP showed 81% sensitivity and 100% specificity rates [Table/Fig-4].

Discussion

In comparison with the CLSI recommendations and the study finding, there is a significant variation observed in the sensitivity and specificity. In case of MHT, CLSI states that there is >90% sensitivity and specificity for blaKPC carbapenemase and 11% for metallo β-lactamases. In this study, we however found a sensitivity of 96% and specificity of 100% for non metallo β-lactamases. In addition, we found 90% sensitivity for blaNDM like producers in contrast to 11% reported by CLSI.

Likewise, for CarbaNP test, CLSI states the sensitivity and specificity of >90% for metallo β-lactamases and up to 11% for blaOXA-48 like producers. Although we found 94 % sensitivity for metallo β-lactamases and 77% sensitivity for blaOXA-48 like producers unlike 11% reported by CLSI.

Upon testing the carbaNP negative P.aeruginosa for porin loss plus AmpC hyper producers, using imipenem with cloxacillin showed 65% (n=24/37) were positive, while 35 % of (n=13/37) isolates were still negative, which may be due to efflux pumps or loss of porins. These results are in accordance with previously reported studies, in which carbapenem resistance due to carbapenemases is found to be less in non-carbapenemase producers beacuse of porin loss and ampC hyper-production [26]

Interestingly, CLSI does not mention CarbAcineto NP. This gives an even better sensitivity and specificity of 81% and 100% respectively than CarbaNP test. The information derived from this study varies extensively when compared to the CLSI observations, indicating the influence of the type of carbapenemase prevalent in a geographic region and the suitable methodology used for enhanced detection of carbapenemase.

Remarkably, EUCAST neither recommends MHT or CarbaNP, but rather recommends specific enzyme based detection methods for the detection of resistance mechanisms such as using aminophenyl boronic acid, cloxacillin and EDTA for different classes of carbapenemases [27]. It is worthwhile to evaluate and compare these methodologies to with CLSI recommendations for any advantage for Indian settings as mentioned in [Table/Fig-5].

[Table/Fig-5]:

Interpretative criteria for carbapenems according to CLSI and EUCAST guidelines.

MIC Recommendations for carbapenemase detection
CLSI
(2015)
EUCAST
(2015)
CLSI (2015) EUCAST
≤S ≥R ≤S ≥R
Enterobacteriaceae Modified Hodge
Test (only for
Enterobacteriaceae)
Carba NP Test Synergism testing of meropenem (M)
with APBA, cloxacillin and EDTA
Carba NP Test
Doripenem 1 4 1 2 >90% sensitivity for blaKPC producers


11 % sensitivity for blaNDM producers

>90% sensitivity for blaKPC, blaNDM, blaVIM, blaIMP, blaSPM, blaSME

11% sensitivity for blaOXA-48 like producers
M+APBA Class A carbapenemase Recommended only for Enterobacteriaceae

Less sensitive for blaOXA-48 like producers
Imipenem 1 4 2 8 M+APBA and M+Cloxacillin AmpC+ Porin loss
Meropenem 1 4 2 8 M+EDTA MBLs
Ertapenem 0.5 2 0.5 1 No synergism with any of the combinations blaOXA -48 like and ESBL+Porin loss
P. aeruginosa
Doripenem 2 8 1 2 Not
recommended
Same as of Enterobacteriaceae Not
Recommended
Imipenem 2 8 4 8
Meropenem 2 8 2 8
A.baumannii
Doripenem 2 8 1 2 Not
recommended

Although, EUCAST does not recommend CarbaNP, Nordmann and Poirel et al., recommended the use of CarbAcineto NP for the detection of carbapenemases in
A. baumannii
Imipenem 2 8 2 8
Meropenem 2 8 2 8

Moreover, studies have evaluated the performance of MHT in detecting metallo β-lactamases and found the sensitivity and specificity rates ranging from 58 to 78% and 57% to 100% respectively [28,29]. This is much higher than that mentioned by CLSI. Furthermore, the addition of Zinc sulfate to the test medium increases the sensitivity of the blaNDM detection from 50% to 85.7%, but lacks specificity [11]. In addition, Neo-Sensitabs has also been evaluated and shown to be more efficient in detecting carbapenemases [30].

In spite of CarbaNP being simple and easy, its downside includes false positive and false negatives results due to the change in the pH of the test solution, the inoculum size, time of incubation, test isolate growth medium where the inoculum was taken, mucoid phenotypes and presence of class blaOXA-48 like enzymes with low carbapenemase activity [31,32]. In addition, the colour change of red to orange-yellow must be detected to interpret the test and thus it is dependent on the observer. These conditions should be taken into consideration when interpreting the results. Finally in terms of time, the CarbaNP takes two hours, while the MHT requires the 24 hours time period for the carbapenemase detection.

This study reports 90% sensitivity and specificity for blaoxa-48 like enzymes by MHT and >90% sensitivity and specificity for blaNDM producers by CarbaNP method. Even though MHT was estimated by CLSI to give a sensitivity of 11% for blaNDM producers, much higher rates were found in Indian settings as in this study where it was around 90% sensitive and 100% specific. Similarly, blaoxa-48 like enzymes detection by CarbaNP was >70% sensitivity and specificity while CLSI observation was only 11%. Although, CLSI recommends CarbaNP for A.baumannii, it is well known that CarbAcinetoNP has a higher sensitivity and specificity for A.baumannii [14].

Limitations

Other carbapenemase encoding genes were not looked for the isolates that are resistance to carbapenem but negative for the carbapenemase genes tested in PCR.

Conclusion

Detection of carbapenem resistant organism (CRO) using different methodologies demonstrates variations in the sensitivity and specificity across different geographical regions. Overall, it was evident that MHT is comparatively better for the detection of class D Oxa enzymes but not for metallo β lactamases. On the contrary, CarbaNP is excellent rapid test in detecting metallo β lactamases but not for class D Oxa enzymes. Henceforth, it is advisable to screen the isolates through CarbaNP for the rapid detection, followed by MHT for any region where class D Oxa-enzymes are more prevalent. Eventually, combined testing of both Carba NP and MHT will certainly help in detecting the most of the carbapenemases. Moreover, this study signifies the importance of knowing the predominant carbapenemase enzymes seen in a specified geographical region before deciding upon a suitable phenotypic screening technique. Further work should investigate the EUCAST proposed carbapenemase detection algorithm to establish whether this better suits the Indian setting.

Acknowledgments

The authors thank Indian Council of Medical Research (ICMR) and Fluid Research Grant (CMC) for provided funding to carry out this evaluation as a part of Antimicrobial Surveillance Study. We also thank Dr. Laura Nabarro (Public Health England) for manuscript proof reading and suggestions.

Financial or Other Competing Interests

None.

References

  • [1].Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007;20(3):440–58. doi: 10.1128/CMR.00001-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Cornaglia G, Giamarellou H, Rossolini GM. Metallobeta-lactamases: a last frontier for beta-lactams? Lancet Infect Dis. 2011;11:381–93. doi: 10.1016/S1473-3099(11)70056-1. [DOI] [PubMed] [Google Scholar]
  • [3].Lascols C, Hackel M, Marshall SH, Hujer AM, Bouchillon S, Badal R, et al. Increasing prevalence and dissemination of NDM-1 metallo-β-lactamase in India: data from the SMART study (2009) J Antimicrob Chemother. 2011;66(9):1992–97. doi: 10.1093/jac/dkr240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [4].Poirel L, Potron A, Nordmann P. OXA-48-like carbapenemases: the phantom menace. J Antimicrob Chemother. 2012;67(7):1597–606. doi: 10.1093/jac/dks121. [DOI] [PubMed] [Google Scholar]
  • [5].Dortet L, Cuzon G, Nordmann P. Dissemination of carbapenemase-producing Enterobacteriaceae in France, 2012. J Antimicrob Chemother. 2014;69(3):623–27. doi: 10.1093/jac/dkt433. [DOI] [PubMed] [Google Scholar]
  • [6].Papp-Wallace KM, Endimiani A, Taracila MA, Bonomo RA. Carbapenems: past, present, and future. Antimicrob Agents Chemother. 2011;55(11):4943–60. doi: 10.1128/AAC.00296-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Castanheira M, Deshpande LM, Mathai D, Bell JM, Jones RN, Mendes RE. Early Dissemination of NDM-1- and OXA-181-Producing Enterobacteriaceae in Indian Hospitals: Report from the SENTRY Antimicrobial Surveillance ProGram, 2006-2007. Antimicrob Agents Chemother. 2011;55(3):1274–78. doi: 10.1128/AAC.01497-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8]. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty first Informational Supplement. CLSI document M100-21. Wayne, PA: Clinical and Laboratory Standards Institute; 2011.
  • [9].Carvalhaes CG, Picão RC, Nicoletti AG, Xavier DE, Gales AC. Cloverleaf test (modified Hodge test) for detecting carbapenemase production in Klebsiella pneumoniae: be aware of false positive results. J Antimicrob Chemother. 2010;65(2):249–51. doi: 10.1093/jac/dkp431. [DOI] [PubMed] [Google Scholar]
  • [10].Dortet L, Poirel L, Nordmann P. Worldwide Dissemination of the NDM-Type Carbapenemases in Gram-Negative Bacteria. BioMed Research International. 2014;2014:249856. doi: 10.1155/2014/249856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Girlich D, Poirel L, Nordmann P. Value of the Modified Hodge Test for Detection of Emerging Carbapenemases in Enterobacteriaceae. J Clin Microbiol. 2012;50(2):477–79. doi: 10.1128/JCM.05247-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Nordmann P, Poirel L, Dortet L. Rapid detection of carbapenemase-producing Enterobacteriaceae. Emerging Infect Dis. 2012;18(9):1503–07. doi: 10.3201/eid1809.120355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Dortet L, Poirel L, Nordmann P. Rapid detection of carbapenemase-producing Pseudomonas spp. J Clin Microbiol. 2012;50(11):3773–76. doi: 10.1128/JCM.01597-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Dortet L, Poirel L, Errera C, Nordmann P. CarbAcineto NP test for rapid detection of carbapenemase-producing Acinetobacter spp. J Clin Microbiol. 2014;52(7):2359–64. doi: 10.1128/JCM.00594-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15]. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; Twenty fifth Informational Supplement. CLSI document M100-25. Wayne, PA: Clinical and Laboratory Standards Institute; 2015.
  • [16].James Versalovic, Karen C. Carroll, Guido Funke, James H. Jorgensen, Marie Louise Landry, David W. Warnock., editors. Manual of clinical microbiology. 10th ed. Washington, D.C.: American Society for Microbiology; 2011. [Google Scholar]
  • [17].Fournier D, Garnier P, Jeannot K, Mille A, Gomez A-S, Plésiat P. A Convenient Method To Screen for Carbapenemase-Producing Pseudomonas aeruginosa. J Clin Microbiol. 2013;51(11):3846–48. doi: 10.1128/JCM.01299-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [18].Queipo-Ortuno MI, Colmenero JDD, Macias M, Bravo MJ, Pilar Morata. Preparation of Bacterial DNA Template by Boiling and Effect of Immunoglobulin G as an Inhibitor in Real-Time PCR for Serum Samples from Patients with Brucellosis. Clinical and Vaccine Immunology. 2008:293–296. doi: 10.1128/CVI.00270-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119–23. doi: 10.1016/j.diagmicrobio.2010.12.002. [DOI] [PubMed] [Google Scholar]
  • [20].Dallenne C, Da Costa A, Decré D, Favier C, Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important beta-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010;65(3):490–95. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
  • [21].Poirel L, Castanheira M, Carrër A, Rodriguez CP, Jones RN, Smayevsky J, et al. OXA-163, an OXA-48-Related Class D β-Lactamase with Extended Activity Toward Expanded-Spectrum Cephalosporins. Antimicrob Agents Chemother. 2011;55(6):2546–51. doi: 10.1128/AAC.00022-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Nordmann P, Boulanger AE, Poirel L. NDM-4 Metallo-β-Lactamase with Increased Carbapenemase Activity from Escherichia coli. Antimicrob Agents Chemother. 2012;56(4):2184–86. doi: 10.1128/AAC.05961-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Yigit H, Queenan AM, Anderson GJ, Domenech-Sanchez A, Biddle JW, Steward CD, et al. Novel carbapenem-hydrolyzing beta-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2001;45(4):1151–61. doi: 10.1128/AAC.45.4.1151-1161.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [24].Ellington M.J, Kistler J, Livermore D.M, Woodford N. Multiplex PCR for rapid detection of genes encoding acquired metallo-beta-lactamases. J Antimicrob Chemother. 2007;59:321–22. doi: 10.1093/jac/dkl481. [DOI] [PubMed] [Google Scholar]
  • [25].Amudhan S M, Sekar U, Arunagiri K, Sekar B. OXA beta-lactamase-mediated carbapenem resistance in Acinetobacter baumannii. Indian J of Med Microbiol. 2011;29:269–74. doi: 10.4103/0255-0857.83911. [DOI] [PubMed] [Google Scholar]
  • [26].Lee J-Y, Ko KS. OprD mutations and inactivation, expression of efflux pumps and AmpC, and metallo-β-lactamases in carbapenem-resistant Pseudomonas aeruginosa isolates from South Korea. International Journal of Antimicrobial Agents. 2012;40(2):168–72. doi: 10.1016/j.ijantimicag.2012.04.004. [DOI] [PubMed] [Google Scholar]
  • [27]. European Committee on Antimicrobial Susceptibility Testing. 2014. EUCAST guidelines for detection of resistance mechanisms and specific resistances of clinical and/or epidemiological importance.
  • [28].Doyle D, Peirano G, Lascols C, Lloyd T, Church LD, Pitout J. Laboratory detection of Enterobacteriaceae that produce carbapenemases. J Clin Microbiol. 2012;50(12):3877–80. doi: 10.1128/JCM.02117-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Pasteran F, Veliz O, Rapoport M, Guerriero,, Corso A. Sensitive and specific modified hodge test for KPC and metallo beta lactamase detection in Pseudomonas aeruginosa by use of a novel strain, Klebsiella pneumoniae ATCC 700603. J Clin Microbiol. 2011;49(12):4301–03. doi: 10.1128/JCM.05602-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [30].Jeremiah SS, Balaji V, Anandan S, Sahni RD. A possible alternative to the error prone modified hodge test to correctly identify the carbapenemase producing Gram-negative bacteria. Indian J Med Microbiol. 2014;32:414–18. doi: 10.4103/0255-0857.142258. [DOI] [PubMed] [Google Scholar]
  • [31].Tijet N, Boyd D, Patel SN, Mulvey MR, Melano RG. Evaluation of the Carba NP test for rapid detection of carbapenemase-producing Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrob Agents Chemother. 2013;57(9):4578–80. doi: 10.1128/AAC.00878-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [32].Dortet L, Bréchard L, Poirel L, Nordmann P. Impact of the isolation medium for detection of carbapenemase-producing Enterobacteriaceae using an updated version of the Carba NP test. J Med Microbiol. 2014;63(Pt 5):772–76. doi: 10.1099/jmm.0.071340-0. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical and Diagnostic Research : JCDR are provided here courtesy of JCDR Research & Publications Private Limited

RESOURCES