Bovine male germline stem-like cells cultured in serum- and feeder-free medium

Abstract

Male germline stem cells (mGSCs) presented in male testis are responsible for spermatogenesis during their whole life. However, little information can be found on the culture of bovine mGSCs, and the current culture system needs to be improved. In this study, we compared the effects of several commercial serum-free media and different extra-cellular matrix on the enrichment and cultivation of mGSCs. To find out the best culture condition, the biological characteristics of the cultured cells were evaluated by morphological observation, RT-PCR and immunofluorescent staining. According to the cells’ condition in different experiment groups, we found out an efficient cultivation system for bovine mGSCs derived from neonate testis. In this serum- and feeder-free medium, the cultured cells maintained the typical morphology, and expressed specific surface markers of both pluripotent ES cells and mGSCs, including SSEA-1, CD49f, C-MYC, PLZF, GFRα1, LIN28, NANOG, Oct4 and SOX2 in commercial human ESCs medium PeproGrow-hESC + BIO (6-bromoindirubin-3′-oxime). Embryoid bodies, derived from the bovine mGSCs, and were formed by ganging drop culture. The retinoic acid induced bovine mGSCs were positive for Stra8, SCP3, DZAL, EMA1 and VASA, and resembled spermatid cells morphologically. Thus, we found an efficient bovine mGSCs-cultivation system, which is lack in serum and feeder.

Electronic supplementary material

The online version of this article (doi:10.1007/s10616-015-9933-2) contains supplementary material, which is available to authorized users.

Introduction

Spermatogonial stem cells (SSCs) have important applications in treatments for infertility and production of animal transgenesis (Giassetti et al. 2015). Studies have shown that the establishment of multipotent male germline stem cell (mGSC) lines derived from neonate and adult testes has been achieved (Mardanpour et al. 2008). These cells have similar properties with embryonic stem cells (ESCs) (Golestaneh et al. 2009; Guan et al. 2006; Kanatsu-Shinohara et al. 2008; Kossack et al. 2009) and could be obtained from testes of mice in different ages (Izadyar et al. 2008; Kanatsu-Shinohara et al. 2008). These cells are able to spontaneously differentiate into derivatives of the three embryonic germ layers in vitro and generate teratomas in immunodeficient mice (Guan et al. 2006; Kanatsu-Shinohara et al. 2008). Additionally, they contribute to the development of various organs and show germline transmission when injected into an blastocyst (Guan et al. 2006; Kanatsu-Shinohara et al. 2008). However, these cells were not fully pluripotent, as indicated by their inability to form teratoma, which contributes to the germline transmission (Ko et al. 2009). All these cited studies support the notion that male germline stem cells have the distinct potential to convert into ESC/multipotent-like cells without the introduction of exogenous reprogramming factors in vitro (Giorgetti et al. 2010; Golestaneh et al. 2009; Kossack et al. 2009). However, updating the successful derivation of ESC-like cells from GSCs is limited in both mouse and human (Fujihara et al. 2011; Guan et al. 2006; Kanatsu-Shinohara et al. 2008; Kossack et al. 2009; Mizrak et al. 2010, 2011). The cultivation system for multipotent GSCs from domestic animals has not been established, and there were few reports describing the potentiality of germ cell differentiation in domestic animals (Hua et al. 2009; Labosky et al. 1994).

Traditionally, the mGSCs are cultured with STO or murine embryonic fibroblast (MEF) in fetal bovine serum (FBS) containing medium, however, there are many disadvantages in the usage of serum or feeder cells to culture stem cells. For instance, cells cultured in serum are more likely to differentiate; the proliferation capacity of cells would be limited by MEF (Kanke et al. 2014; Wagner and Vemuri 2010). Moreover, since the components of serum and MEF are unknown and unstable, the investigation of molecular regulation on the niche is restricted (Mannello and Tonti 2007; Totonchi et al. 2010). Recently, some serum- and feeder-free media were used to culture embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs) and spermatogonial stem cells (SSCs) successfully (He et al. 2015; Sahare et al. 2015). In our previous studies, the ESGRO and PeproGrow-hESC media were utilized to culture murine and goat mGSCs (Zhang et al. 2011; Zhu et al. 2012).

Because of the commercial value lies in its diversified products, bovine is regarded as an important domestic species for current biological application. In mammalian other than mouse or human, limited success has been achieved in generating ES cell lines though numerous efforts had been made (Roberts et al. 2015). The gene targeting based on GSC is a promising technique for the production of transgenic offspring, acting as a valuable tool in bovine research. However, the isolation of bovine’s SSCs is less efficient than that of other species (Giassetti et al. 2015). In this study, we isolated and established pluripotent mGSCs lines from Chinese Qinchuan bovine testes with the usage of serum- and feeder-free medium, their multipotency and differentiation potential in vitro were also tested.

Materials and methods

Isolation of gonocytes from bovine neonate testis

Qinchuan bovine testes were collected and washed for 5–10 times with phosphate buffered saline (PBS) supplemented with 100 IU/ml penicillin and 100 µg/ml streptomycin. The seminiferous tubules from each testis were separated into small pieces using forceps. Seminiferous epithelial cells were dissociated by modified enzymatic digestion and plated by two-step successive differential plating methods (Izadyar et al. 2003a, b; Lee et al. 2006). The cells were collected and cultured for 12 h, respectively, at 37 °C by two-step successive differential plating methods. Briefly, the small seminiferous tubules were dissociated using three different enzyme cocktails at 37 °C for 25 min: (1) CDD, 2 mg/ml collagenase IV (Invitrogen, Carlsbad, CA, USA), 20 μg/ml DNase (Sigma) and 5 mg/ml dispase (Invitrogen); (2) CTHD, 1 mg/ml collagenase IV (Invitrogen), 1 mg/ml trypsin (Invitrogen), 1 mg/ml hyaluronidase (Sigma, St. Louis, MO, USA) and 10 μg/ml DNase (Sigma). All enzyme cocktails were dissolved in Dulbecco’s phosphate buffered saline. The dissociated fragments were further digested with 0.25 % trypsin and 10 μg/ml DNase (TD) for 5 min, followed by the neutralization with Dulbecco’s modified Eagle’s medium (DMEM) containing 10 % FBS. The dispersed cells were filtrated through 100 μm nylon mesh and washed twice with DMEM by centrifugation. The dissociated cells were suspended in DMEM containing 10 % FBS (Hyclone, Logan, UT, USA), 10 % knock-out serum replacement (KSR, Invitrogen), 2 mM l-glutamine (Invitrogen), 1 % non-essential amino acids (Invitrogen), 100 IU/ml penicillin and 100 µg/ml streptomycin (Invitrogen), and cultured at 10⁵ cells/ml in 35-mm dishes coated with 0.1 % gelatin (Sigma) for 12 h at 37 °C and 5 % CO₂ for the cells to adhere.

Culture of bovine mGSCs in different medium

The non-adhering cells were transferred onto new Matrigel (92 ng/ml, BD, Franklin Lakes, NJ, USA) or Laminin (20 μg/ml, Sigma) coated plates for culture in the same condition, medium was changed every other day and the cells were passaged firstly dissociated mechanically followed by enzymatic (TrypleSelect, Invitrogen) dissociation based on Kossack et al. (2009), selected and transferred into new Matrigel treated plates every 5–8 days. The following six media were used to evaluate the effects on the proliferation of mGSCs: (1) PeproGrow-hESC: PeproGrow-hESC (Peprotech, Rocky Hill, NJ, USA) supplemented with 10 ng/ml recombinant human basic fibroblast growth factor (bFGF, Millipore, Billerica, MA, USA), 20 ng/ml glial cell line-derived neurotrophic factor (GDNF, Peprotech), 10 ng/ml epidermal growth factor EGF (Millipore), 10 ng/ml GFRα1 receptor (Sino Biological Inc., Beijing, China); (2) PeproGrow-hESC + BIO: PeproGrow-hESC (Peprotech) supplemented with 2.5 μM 6-bromoindirubin-3-oxime (BIO, Merck, Shanghai, China), 10 ng/ml recombinant human bFGF (Millipore), 20 ng/ml GDNF (Peprotech), 10 ng/ml EGF (Millipore), 10 ng/ml GFRα1 receptor (Sino Biological Inc.); (3) ESGRO: ESGRO medium (Millipore), 10 ng/ml bFGF (Millipore), 20 ng/ml GDNF (Peprotech), 10 ng/ml EGF (Millipore) and 10 ng/ml GFRα1 receptor (Sino Biological Inc.); (4) DMEM/F12 + KSR + FBS: DMEM/F12 (Life technologies, Carlsbad, CA, USA) supplemented with 1 % FBS and 10 % Knockout serum replacement (KSR, Invitrogen), 4 mM l-glutamine (Invitrogen), 1 % non-essential amino acids (Invitrogen), 100 IU/ml penicillin and 100 µg/ml streptomycin (Invitrogen), 10 ng/ml bFGF (Millipore), 20 ng/ml GDNF (Peprotech), 10 ng/ml EGF (Millipore), 10 ng/ml GFRα1 receptor (Sino Biological Inc.); (5) DMEM/F12 + FBS: DMEM/F12 (Life technologies) supplemented with 10 % FBS (Hyclone), 4 mM l-glutamine (Invitrogen), 1 % non-essential amino acids (Invitrogen), 100 IU/ml penicillin and 100 µg/ml streptomycin (Invitrogen), 10 ng/ml bFGF (Millipore), 20 ng/ml GDNF (Peprotech), 10 ng/ml EGF (Millipore), 10 ng/ml GFRα1 receptor (Sino Biological Inc.); and (6) StemPro-34 SFM: StemPro-34 SFM supplemented with StemPro supplement (Invitrogen), 1× N2 supplement (Invitrogen), 6 mg/ml d-(+)-glucose (Invitrogen), 30 mg/ml pyruvic acid (Invitrogen), 1 µl/ml DL-lactic acid (Sigma), 5 mg/ml bovine serum albumin (BSA; Invitrogen), 1 % FBS (Invitrogen), 2 mM l-glutamine (Invitrogen), 50 μM β-mercaptoethanol (Invitrogen), 1× penicillin/streptomycin (Invitrogen), 1× minimal essential medium (MEM) and 1× non-essential amino acids (Invitrogen), 1× MEM vitamins (Invitrogen), 30 ng/ml β-estradiol (Sigma), 60 ng/ml progesterone (Sigma), 10 ng/ml human EGF (Peprotech), 10 ng/ml human bFGF (Peprotech), 20 ng/ml GDNF (Peprotech), 10 ng/ml GFRα1 receptor (Sino Biological Inc.), 10 ng/ml LIF (Millipore). The effects were determined by the number of colonies and the amount of cells after they had been cultured for 4 days. Then those colonies were collected and utilized in subsequent experiments.

AP staining

To detect alkaline phosphatase (AP) activity, the cells cultured under the normal conditions were fixed with 4 % paraformaldehyde (PFA) for 10–15 min at room temperature. The protocol was referred as Zhang et al. (2011).

Immunofluorescence staining

The bovine neonate testes were isolated and fixed in 4 % PFA (Paraformaldehyde) for 24 h and embedded in paraffin wax, then sections were cut, deparaffinized and rehydrated following standard methods (Niu et al. 2016). The slides were soaked in boiling citrate buffer for 15–25 min to get natural cooling, then washed in cold PBS for 3 times, each for 5 min. After three washes in PBS, testicular tissues were blocked in 10 % goat serum at room temperature for 30 min, then exposed to the primary antibody against GFRα1 (1:200; Sino Biological Inc.), PLZF (1:200, Santa Cruz Biotechnology, Santa Cruz, CA, USA), PGP9.5 (1:200, Bioss Inc., Woburn, MA, USA) for overnight at 4 °C. Then they were washed in PBS for 3 times, each for 5 min and incubated with secondary FITC-conjugated antibodies (1:500; Chemicon, Temecula, CA, USA) at room temperature for 30 min followed by three washes in PBS. Nuclei of cells were stained using Hoechst 33342 (Sigma). Images were captured using a Leica fluorescence microscope (Hicksville, NY, USA). The 3rd passage mGSCs colonies were fixed with 4 % PFA for 10 min at room temperature, followed by three washes in cold PBS, 5 min each time. Washed cultures were treated with blocking solution (PBS + 1 % BSA) for a minimum of 30 min before being washed with PBS and stained with primary antibodies specific for CD49f (1:500, Chemicon), C-MYC (1:500, Chemicon), SSEA-1 (1:200, Chemicon). The appropriate FITC-conjugated secondary antibodies were used according to the manufacturer’s manual (1:500, Chemicon). The nuclei of induced cells were stained by 5 µg/ml Hoechst 33342 for 5 min. At the same time, the negative controls were stained with secondary antibodies: goat anti-rabbit IgG and goat anti-mouse IgG. The induced cultures were analyzed by mouse anti-monoclonal or rabbit anti-mouse polyclonal antibodies against Stra8 (1:500, Santa Cruz Biotechnology), SCP3 (1:500, Santa Cruz Biotechnology), DZAL (1:1000, Abcam, Cambridge, UK), VASA (1:1000, Abcam) and EMA1 (1:200, DSHB, Iowa City, IA, USA). We have proven that the above germ cell antibodies reacted with bovine testicular spermatogenic cells, but not with fibroblasts (data not shown).

RT-qPCR

Total RNA for RT-qPCR analysis were extracted from typical SSCs using TRIzol (Qiagen, Shanghai, China). The cDNA was synthesized based on 500 ng RNA with a commercially available kit (TaKaRa, Biotech. Co. Ltd., Shiga, Japan). The PCR steps included denaturation at 95 °C for 5 min, followed by repeated (35) cycles of 30 s at 95, 58 °C for 30 s, 72 °C for 30 s, and extension at 72 °C for 10 min. The primers were designed based on the sequences of the open reading frame from the NCBI GenBank and synthesized by AuGCT Biotechnology (Beijing, China). The PCR primers and the length of the amplified products are shown in Table 1. The PCR products were analyzed in 1 % agarose (Invitrogen) gel electrophoresis, stained with ethidium bromide (Invitrogen), and visualized under UV illumination.

Table 1.

The qRT-PCR primers sequences and the length of the amplified products

Primer	Sense primer sequence 5′ → 3′	Antisense primer sequence 5′ → 3′	Tm (°C)	Length of products (bp)
β-ACTIN	CGGCAATGAGCGGTTCC	CGTGTTGGCGTAGAGGTCCT	58	142
NANOG	CCCGAAGCATCCAACTCTAGG	GTCCGTGTCGAGGGTGTCA	58	93
SOX2	CCCGTGGTTACCTCTTCTTCC	CGCTCTGGTAGTGCTGGGAC	58	145
OCT4	AAGGGCAAACGATCAAGCA	AATGGGACCGAAGAGTACAGAGT	58	167
CMYC	AGAGGGCTAAGTTGGACAGTG	CAAGAGTTCCGTATCTGTTCAAG	58	346
LIN28	CTGGAATCTATCCGAGTCACCG	GATGCTCTGGCAGAAATGGC	58	192
TERT	CAGCCACGTCATCAGGATCG	GCTTGTTCTCCATGTCCCCATA	58	116
PLZF	CACCGCAACAGCCAGCACTAT	CGGCATACAGCAGGTCATCCAA	58	127
GFRα1	CCACCAGCATGTCCAATGAC	GAGCATCCCATAGCTGTGCTT	58	101
DAZL	TCCGTCCTCTGGAAATGGC	AGCACTGCCCGACTTCTTC	58	168

In vitro differentiation of mGSCs

The bovine mGSC colonies (passage 4) were dissociated mechanically into small clumps and re-suspended in DMEM containing 10 % FBS, 2 mM l-glutamine, 1 % non-essential amino acids, 100 IU/ml penicillin and 100 µg/ml streptomycin at 300–500 cells/20 µl to form cell clusters. For further differentiation, the embryoid bodies (EBs) (d3) were cultured in Petri dishes coated with 0.1 % gelatin in DMEM medium containing 20 % FBS (Hyclone), 0.1 mM 2-mercaptoethanol (Sigma), 2 mM glutamine (Invitrogen), 1 mM sodium pyruvate (Invitrogen) and 0.1 mM non-essential amino acids (Invitrogen) for 3–15 days to investigate the potentiality of spontaneous differentiation. In order to investigate the spermatid differentiation potential of the clusters or EB-like clusters, they were dissociated into small clusters or single cells and transferred into the same differentiation medium consisting of 1 × 10⁻⁶ M retinoic acid (RA) for 7–14 days in the absence of feeder cells to induce differentiation (Hua et al. 2011; Nayernia et al. 2006).

Statistical analysis

We had three replicates in each experiment. All data were expressed as the mean ± standard error (SE). Variance and statistical comparisons were calculated using Graph Prism 5.0 software, Student’s t test was used to determine statistical significance for qRT-PCR data. p value < 0.05 was considered to be significant.

Results

Characterization of bovine spermatogenic cells in the testis

In the newborn bovine testis, the gonocytes are the main cells to form the seminiferous tubes with few spermatocytes or sperm cells (Fig. 1a). Gonocyte’s nucleus is round, large, and rich in euchromatin and chromatin is distributed evenly in it. Seminiferous tubes become larger and spermatocytes or spermatid cells appear in bovine testicular tissue at 1-year old (Fig. 1b). The putative bovine SSCs are positive for PLZF, GFRα1 and PGP9.5, and some spermatogonia are positive for C-KIT when analyzed by immunofluorescence (Fig. 1c).

Fig. 1.

Morphology and characterization of bovine mGSCs in the testis. a HE staining of the neonate bovine testis. b HE staining of 1 year old bovine testicular tissues. Bar 100 μm (left), 50 μm (right), c The results of immunofluorescence double-label staining of 1 year old bovine testicular tissues. GFRα1, PLZF and PGP9.5 (Green); C-KIT (Red); Hoechst 33342 (Blue), Bar 100 μm. d Total number of cells obtained per gram testicular tissue treated with different methods; e The percentage viability of testicular cells obtained after treatment with different methods. (*p < 0.01; ***p < 0.05). (Color figure online)

Optimization of the conditions of isolation and purifying bovine mGSCs

To obtain the bovine testicular cells efficiently, two enzyme cocktails were combined to dissociate cells. The results showed that, compared with the other groups, the group where cocktail CTHD and TD were used simultaneous gained the largest amount of cells per gram testicular tissue (2.8 × 10⁷, Fig. 1d). The cells of greatest vitality (94.75 %, p < 0.05, Fig. 1e) were obtained by using CDD in combination with TD.

The bovine testicular cells were collected after having been cultured in plates coated with 0.1 % gelatin for 4 h. Then we cultured them for another 48 h at 37 °C in different plates coated with different extracellular matrices-Laminin, Gelatin or Matrigel, to enrich mGSC. In this stage, the cells attached and formed small colonies (Fig. 2a). The colonies in Laminin treated plates were more compact, while the clusters on Matrigel were loose and grape-bunches shaped. Moreover, the colony formation rate in Gelatin coated plates was significantly lower than that in Matrigel and Laminin (Fig. 2b). Then those colonies were collected and utilized in the subsequent experiments.

Fig. 2.

Morphology and phenotypic feature of bovine mGSCs. a The morphology of the isolated 2 passage bovine mGSCs cultured on plates, which were coated with Laminin or Matrigel, Bar 100 μm; b the colonies number in Laminin and Matrigel; c the cells were dissociated with Tryple and then cultured in six different media; d AP staining of bovine mGSCs cultured in six different media, Bar 100 µm. (*p < 0.01; **p < 0.001; ***p < 0.05)

Optimization the culture medium of mGSCs

Then the cells were dissociated with TrypleSelect and cultured with six different media, respectively (Fig. 2c, d). With the high viability of bovine mGSCs cultured in PeproGrow-hESC, those cells formed less colonies and were loosely distributed. Epithelioid cells in this medium proliferated slowly. MGSCs cultured in PeproGrow-hESC with BIO formed more grape-like colonies that were distributed densely, and the colonies were in a good configuration, meanwhile with a higher proliferation rate. Cultured in ESGRO, mGSCs formed typical-configuration colonies, which were more densely distributed, and the epithelioid-like cells and cells in colonies proliferated slowly. However, the colonies formed in the typical SSC medium (StemPro-34 SFM) were few, and more fibroblast-like cells appeared in this medium. MGSCs cultured in DMEM/F12 + FBS lost the original shape and were supposed to enter the differentiation process, forming colonies that were distributed loosely. Cells that were cultured in DMEM/F12 + KSR + FBS showed to be in good condition and formed smaller colonies (Fig. 2c, d).

In a further step, we chose three media: DMEM/F12 + 1 % FBS + 10 % KSR, PeproGrow-hESC + BIO, and ESGRO medium, respectively, to culture bovine mGSCs, and anti-GFRa1, -KI67, and -PLZF immunofluorescence staining was used to evaluate their proliferation potential (Fig. 3a–c). Our results showed that colonies in these media were positive for GFRα1, PLZF and KI67. Through qRT-PCR analysis, we detected the expression of GFRα1 and PLZF in all these three group cells (Fig. 3d), while cells cultivated in PeproGrow-hESC + BIO and in ESGRO expressed higher level of PLZF and GFRa1, respectively. Thus, we chose the former one to culture bovine mGSCs. Immunofluorescence staining results showed that our putative bovine mGSCs also expressed the characteristic surface markers of both pluripotent ES cells and mGSCs, such as SSEA-1, CD49f and C-MYC (Supplementary Fig. 1A). PLZF, GFRα1, LIN28, NANOG, Oct4, C-myc, SOX2 and Tert were detected at mRNA level (Supplementary Fig. 1B).

Fig. 3.

Immunofluorescence analysis results of bovine mGSCs (3rd passages in vitro) cultured in 3 media. a Bovine mGSCs cultured in DMEM/F12 + 10 % KSR + 1 % FBS were positive for PLZF, GFRα1 and KI-67; b when cultured in PeproGrow-hESC with BIO, bovine mGSCs were positive for PLZF, GFRα1 and KI-67; c bovine mGSCs were positive for PLZF, GFRα1 however, only weakly positive for KI-67 when the medium was alternated by ESGRO. d The expression of SSC markers were analysed by qRT-PCR. (*p < 0.01; **p < 0.001; ***, p < 0.05)

FACS was applied to analyze bovine mGSCs (4th passage) cultured in PeproGrow-hESC + BIO, those data demonstrated that mGSCs were positive for CD166, CD44, CD29 and negative for CD34, CD71, CD9a, however, CD11a, CD147, CD117 and CD45 were weakly expressed (Fig. 4a). The immunofluorescence analysis also proved that those cells highly expressed VASA, ETV5 and GFRα1 (Fig. 4c).

Fig. 4.

The characteristics of bovine mGSCs (4th passages in vitro) cultured in PeproGrow-hESC with BIO. a FACS analysis showed that mGSCs were positive for CD166, CD44 and CD29. CD11a, CD147, CD117 and CD45 were weakly expressed; CD34, CD71, CD9a were negative; b the bovine mGSCs were observed by transmission electron microscopy, and the nucleus is large. Lipid, mitochondria and endoplasmic reticulum pseudopodia were in the cytoplasm while microvilli were located on the cytomembrane; c the immunofluorescence analysis of the cells was positive for VASA, ETV5, GFRα1, Bar 100 μm, the IgG panel is the negative control, in the 4 middle panels the nuclei were stained blue by Hoechst 33342, and the right panel is the merge

Through transmission electron microscopy, we could see that the bovine mGSCs were large, oval-shaped cells with a high nuclear to cytoplasm ratio. Lipid, mitochondria and endoplasmic reticulum pseudopodia were in the cytoplasm while microvilli were located on the cytomembrane (Fig. 4b).

Differentiation potential of bovine mGSCs

Bovine mGSCs maintained typical colony morphology in PeproGrow-hESC with BIO medium (Fig. 5a–i). EB-like clusters derived from bovine mGSCs were cultured in suspension for 4–10 days in DMEM/F12 medium without growth factors. Neural-like cells were formed from EB-like clusters after 6 days (Fig. 5a-II). RA induced the differentiation of bovine mGSCs for 4–17 days (Fig. 5b-I, II), spermatid-like cells appeared and were positive for Aniline blue (Fig. 5b-II, III, IV). Immunofluorescence staining showed that the induced cells were positive for meiotic markers: Stra8, SCP3, DZAL, and germ cell markers: VASA and EMA1 (Fig. 5c).

Fig. 5.

Spermatid-like cells were formed after induction with retinoic acid (RA). a-I Bovine mGSCs cultured in PeproGrow-hESC + BIO formed SSC-like clones, Bar 100 μm; a-II MGSCs were differentiated into neural-like cells, Bar 50 μm; b-I The characteristics of the bovine mGSCs (4th passages in vitro) after they were induced by RA for 4 days, Bar 100 μm; b-II the Giemsa staining result of bovine mGSCs after they were induced by RA for 17 days. Bar 50 μm; b-III, IV induced cells were positive for Aniline blue staining, Bar 100 μm; c Stra8, SCP3, DZAL, VASA and EMA1 were also expressed in the induced cells, Bar 50 μm

Discussion

It is significant for scientists to purify more testicular cells with greater vitality in order to establish mGSC lines. Van der Wee managed to get enough mouse testicular cells with enzyme cocktail CDH, keeping those spermatogonia’s proliferation ability in vitro for a long period (van der Wee et al. 2001). Izadyar found the phenomenon that CDTH contributed to the gain of large amounts of bull testicular cells. However, there are few information about which enzyme could decompose bovine testis effectively and make scientists obtain mGSCs easily. Our study showed that when working together with TD, the enzyme cocktail CTHD could perform well in digesting testis and enriching bovine mGSC, which is meaningful for researchers who are making efforts to obtain such cells. Previously, it was difficult to obtain pure mGSCs. The reason does not only lie in the lack of a special marker of mGSC, but also in the small quantity of this kind of cells in testis. Bellvé (1993) isolated mouse mGSC with the purity of 90 % successfully, while Kim selected and obtained pig mGSC with a purity of 80 % (Kim et al. 2011). However, there are few reports focusing on the enrichment of bovine mGSC. Our study demonstrated that Matrigel and Laminin could enrich bovine mGSC in a very efficient way, and Laminin was superior to Matrigel. Besides, this system is easy to handle.

Scientists have managed to find out efficient media to cultivate mGSCs. Though it was previously reported that mGSC can be maintained by DMEM with the addition of 10 % FBS (Nagano et al. 1998), studies showed that more than 90 % of them have been lost within one week in this medium. Afterwards, α-MEM was reported as a better medium for mGSC culturing (Kubota et al. 2004), but the amount of mGSCs showed no increase in it. In other studies, different kinds of media with relatively simple composition were used. For example, DMEM/F12 and α-MEM have been reported as appropriate media in rat mGSC cultivation, but it is not possible to use the later media for feeder-free culture.

For each type of stem cells, specific microenvironments as well as growth factors are required to sustain their self-renewal capability and differentiation potential. In vivo, the mGSCs’ survival, proliferation and differentiation are dependent on their environments and are regulated by it. In vitro, the complex components of serum could lead to significant differences in niches (Barnes and Sato, 1980). Culture medium is expected to contribute to the exploration of the conditions needed by mGSC and the investigation of molecular and signaling pathways that regulate mGSC’s proliferation and pluripotency (Hua et al. 2009). A study conducted previously has shown that in vitro, with the presence of serum or feeder cells, mGSC could be cultured for a long period, sustaining the competence of differentiating into multiple types of cells (Guan et al. 2006). In our study, bovine GSCs were cultured in serum- and feeder-free media including the commercial medium for human and mouse ESCs (Hannoun et al. 2010; Zhang et al. 2011), and the DMEM/F12 with 10 % FBS was used as control. In the serum- and feeder- free cultivation system- PeproGrow-hESC, those cells grew up to 6 passages for over 1.5 months and maintained morphology similar to mouse and human GSCs, indicating that our system was viable and could simulate the cellular niche in seminiferous tubules and maintain mGSCs proliferation and differentiation in vitro. When the GSK3 inhibitor-BIO was added in the PeproGrow-hESC, the cells formed typical colonies more easily, and were retained in undifferentiated stage. On the contrary, more than 90 % of mGSCs cultured in DMEM/F12 with 10 % FBS disappeared within a week. To improve the serum-free culture system, we reduced the concentration of serum and supplemented 10 % KSR, which contains vital elements and has been used to cultivate various types of stem cells. Cells in this updated system proliferated rapidly and produced grape-like colonies with a doubling time of 4–6 days. Before the cells increased, the differentiation process started, which was indicated by the looseness of the clones that the cells have been cultured up to 3 passages for over 15 days. The characteristics of these cells were consistent with mouse and human SSCs (Golestaneh et al. 2009; Guan et al. 2006; Kanatsu-Shinohara et al. 2003a, b; Kanatsu-Shinohara et al. 2005; Kubota et al. 2003; Seandel et al. 2007), suggested the conserved pathway in mammalian male germ cell development.

Culture medium is key for stem cells in that it can change the cells’ biological characteristics associated with their differentiation potential (Roobrouck et al. 2011a, b; Zhu et al. 2012). Serum-free media can maintain mGSCs’ capacities stably. Moreover, the utilization of this medium is also beneficial for the exploration of the conditions mGSC need as well as the molecular and signaling pathways that regulate mGSC proliferation and pluripotency (Hua et al. 2009). In this study, we used the commercial media lack in serum and feeder to culture bovine mGSCs derived from neonate testis, the results showed that the putative cells shared the typical mGSC markers and the potentiality to differentiate into spermatid-like cells (Dong et al. 2010). However, the defined serum-free medium-StemPro34 SFM for SSCs (Kubota and Brinster 2008) was not suitable for bovine mGSCs based on the cell proliferation and the markers expressed. These results further suggested that the suitable niches and mechanisms for self-renewal capacity of SSCs among different species are different. Promyelocytic leukemia zinc finger protein (PLZF), GFRa1 and VASA are associated with self-renewal and pluripotency of mGSCs (Song et al. 2015). GDNF family receptor alpha-1(GFRa1) is one of the receptors of Glial cell line-derived neurotrophic factor (GDNF), a vital factor in promoting spermatogonial self-renewal (Buageaw et al. 2005). VASA gene (also named DDX4) encodes another RNA-binding protein that is highly conserved across species and expressed specifically in the germline in several model organisms from flies, mice, and humans (Nagamori et al. 2011). The stem cell factor receptor (KIT, CD117) is also required for the germ cell development (Barrios et al. 2012). PCNA and KI67 are markers of cell proliferation. Dazl is a conserved gene in mammalian meiosis, which encodes RNA binding protein required for spermatocyte meiosis (Niu et al. 2014). Ten-eleven translocation (Tet1), a key regulator of DNA methylation, has been identified as a key enzyme for the activation of DNA demethylation (Zheng et al. 2015). In this study, the expressions of PLZF, GFRα1, PCNA, KI67, DAZL and TET1 were analyzed by qRT-PCR and immunofluorescence to evaluate the most appropriate medium for bovine mGSCs to sustain their self-renewal ability. All these results demonstrated that the cells in our selection media can grow well, retain the high self-renewal potential with the capacity of differentiating into spermatid-like cells.

In conclusion, we successfully obtained mGSCs from bovine neonate testis with a simple serum- and feeder-free system. These cultured cells are able to differentiate into spermatid-like cells in vitro after RA treatment. This system provides a model to study the mechanisms of spermatogenesis and new strategies for the production of transgenic cattle.

Electronic supplementary material

Below is the link to the electronic supplementary material.