Two distinct mechanisms of transcriptional regulation by the redox sensor YodB

Significance

Bacteria sense and protect themselves against oxidative stress using redox-sensing transcription regulators with cysteine residues. Here, we investigate at the molecular level how the YodB protein, a transcription repressor in Bacillus subtilis, monitors and responds to different oxidative stresses. Diamide stress leads to the formation of disulfide bonds between cysteine residues, whereas the more toxic quinone compound methyl-p-benzoquinone forms an adduct on a specific cysteine residue. These chemical modifications lead to considerably different changes in the YodB structure, causing the release of YodB from the DNA of antioxidant genes. The redox-sensing transcription regulator YodB allows B. subtilis to respond to multiple oxidative signals of differing toxicity by adopting different structures.

Abstract

For bacteria, cysteine thiol groups in proteins are commonly used as thiol-based switches for redox sensing to activate specific detoxification pathways and restore the redox balance. Among the known thiol-based regulatory systems, the MarR/DUF24 family regulators have been reported to sense and respond to reactive electrophilic species, including diamide, quinones, and aldehydes, with high specificity. Here, we report that the prototypical regulator YodB of the MarR/DUF24 family from Bacillus subtilis uses two distinct pathways to regulate transcription in response to two reactive electrophilic species (diamide or methyl-p-benzoquinone), as revealed by X-ray crystallography, NMR spectroscopy, and biochemical experiments. Diamide induces structural changes in the YodB dimer by promoting the formation of disulfide bonds, whereas methyl-p-benzoquinone allows the YodB dimer to be dissociated from DNA, with little effect on the YodB dimer. The results indicate that B. subtilis may discriminate toxic quinones, such as methyl-p-benzoquinone, from diamide to efficiently manage multiple oxidative signals. These results also provide evidence that different thiol-reactive compounds induce dissimilar conformational changes in the regulator to trigger the separate regulation of target DNA. This specific control of YodB is dependent upon the type of thiol-reactive compound present, is linked to its direct transcriptional activity, and is important for the survival of B. subtilis. This study of B. subtilis YodB also provides a structural basis for the relationship that exists between the ligand-induced conformational changes adopted by the protein and its functional switch.

Redox signaling in bacteria is an attractive field and has revealed how bacteria trigger defense mechanisms against environmental and host stresses to survive. For bacteria, the thiol groups of cysteines in proteins are commonly used as thiol-based switches in redox-sensing regulators to activate specific detoxification pathways and restore the redox balance (1–3). Direct sensing and quick responses by transcription factors are regarded as an efficient way to promote the survival of a tiny bacterium and overcome oxidation stress (1–3). In addition, the redox signaling pathways have also been used as important virulence regulators that allow pathogenic bacteria to adapt to the host immune defense system (4).

Among the thiol-based oxidation regulators, Escherichia coli OxyR (5, 6), Xanthomonas campestris OhrR (7, 8), Bacillus subtilis OhrR (9), Pseudomonas aeruginosa MexR (10), and E. coli NemR (11, 12) are representatives that demonstrate how well these regulators sense organic peroxide by forming disulfide bonds between two distantly located cysteines (10). OxyR oxidation leads to the formation of intramolecular disulfide bonds and alters the interaction between the OxyR tetramer and the DNA sites upstream from the OxyR-regulated genes, which enhances OxyR DNA recognition capability (5, 6). Similarly, intermolecular disulfide bonds are formed in response to the oxidation of X. campestris OhrR and reorient the winged-helix domains of the OhrR dimer, which reduces its DNA-binding affinity. Unlike a two-Cys type, such as X. campestris OhrR, B. subtilis OhrR, a one-Cys type, senses hydroperoxides by forming various reversible S-thiolations with the redox buffer bacillithiol (9). As with X. campestris OhrR, MexR forms intermolecular disulfide bonds in response to oxidative stress, which results in a rigid body rotation of the DNA-recognition helices, attenuating DNA-binding affinity (10). E. coli NemR possesses a redox switch that senses either electrophiles or reactive chlorine species by the formation of disulfide bonds (11) or a reversible sulfenamide bond (12), respectively. The representative redox regulators E. coli OxyR, X. campestris OhrR, B. subtilis OhrR, P. aeruginosa MexR, and E. coli NemR demonstrate how these proteins are structurally influenced by the formation of disulfide bonds that are induced by oxidative stress.

In contrast, the MarR/DUF24 family regulators have been known to sense and respond to reactive electrophilic species (RES), including diamide, quinones, and aldehydes, with high specificity (1). Among the MarR/DUF24 family members, B. subtilis YodB is the prototypical regulator and is reported to be regulated by diamide and quinones, which induce intersubunit disulfide formation between Cys6-Cys101′ or S-alkylation on Cys6, respectively (13, 14). However, little is known about the exact molecular mechanisms that are responsible for both the diamide- and quinone-mediated signaling pathways of B. subtilis YodB, which prompted us to initiate structural and functional studies on B. subtilis YodB.

Here, we have revealed that the prototypical regulator YodB of the MarR/DUF24 family from B. subtilis uses two distinct pathways to regulate transcription in response to two RES [diamide or methyl-p-benzoquinone (MPBQ)], as revealed by X-ray crystallography, NMR spectroscopy, and biochemical experiments. Surprisingly, B. subtilis YodB possesses two distinctive conformational states, depending on the types of thiol-reactive compounds (diamide or MPBQ), which may steer the cells into an efficient defense state. Following oxidative shock by either diamide or MPBQ, B. subtilis YodB induces the formation of disulfide bonds between two YodB monomers or S-adducts in two distinct ways. Thus, the regulatory mechanism of B. subtilis YodB should be dissimilar to those of known regulators, including X. campestris OhrR, B. subtilis HypR, or S. aureus QsrR. In addition, the different conformations of YodB may be related to an efficient method of transcriptional regulation to reduce oxidative stress. Our structural study provides the evidence that different thiol-reactive compounds induce dissimilar conformational changes that trigger separate regulatory mechanisms on the target DNA. The specific control of YodB is dependent upon the type of thiol-reactive compound, is linked with its direct transcriptional activity, and is important for the survival of B. subtilis.

Results

After an extensive number of trials to crystallize various B. subtilis YodB constructs, including the full-length construct, we obtained three types of crystals (B. subtilis YodB_reduced, YodB_diamide, and YodB_MPBQ) from the truncated YodB_5–105 construct. B. subtilis YodB was reacted with 1 mM diamide (or 1.5 mM MPBQ) to produce B. subtilis YodB_diamide (or YodB_MPBQ), whereas 1 mM DTT was used to prepare B. subtilis YodB_reduced. In B. subtilis, 2-methylhydroquinone (MHQ) is oxidized to MPBQ, which forms an S-adduct via 1,4-reductive addition of thiols to quinones (15). Due to the high toxicity of MPBQ (Fig. S1), B. subtilis stimulates the azoreductases AzoR1 and AzoR2, which convert MPBQ into MHQ to protect the cells (15–17). In our experiment, B. subtilis was not able to grow in the presence of 1 mM MPBQ, whereas neither 1 mM MHQ nor 1 mM diamide affected growth of either WT (YodB_WT) or ΔyodB mutant cells. In addition, the ΔyodB mutant was more resistant to MHQ and diamide (Fig. S1). Therefore, we used MPBQ to observe the quinone-induced change in the structure of YodB (YodB_MPBQ), which was reported to be 50-fold more toxic than hydroquinones, such as MHQ, in B. subtilis cells (13). The crystal structures of B. subtilis YodB_reduced, YodB_diamide, and YodB_MPBQ were determined at 1.7, 2.0, and 2.1 Å resolution, respectively (Table 1). The crystal structures of B. subtilis YodB_reduced and YodB_MPBQ contained two monomers (chains A and B) in the asymmetric unit, whereas the crystal of B. subtilis YodB_diamide contains one monomer per asymmetric unit.

Fig. S1.

Effects of diamide, MPBQ, and MHQ on the growth of WT B. subtilis strain PS832 and the ΔyodB mutant. (A, Left) Growth curves of WT B. subtilis strain PS832 (blue) and the ΔyodB mutant (yellow). (A, Right) Growth curves of B. subtilis WT in the presence of 0.1 mM (green), 1 mM (yellow), and 10 mM (red) MPBQ. (B) Growth curves of B. subtilis WT and the ΔyodB mutant in the presence of 1 mM MHQ (Left) and 10 mM MHQ (Right) are presented. (C) Growth curves of B. subtilis WT and the ΔyodB mutant in the presence of 1 mM diamide (Left) and 10 mM diamide (Right). (D) MIC values for diamide and MPBQ in the WT B. subtilis strain PS832 and the ΔyodB mutant.

Table 1.

Statistics for data collection, phasing, and model refinement

Data	Dataset
	YodBreduced	YodBdiamide	YodBMPBQ
A. Data collection
Space group	P21	P62	P21
Unit cell lengths, a, b, c, Å	40.78, 50.80, 50.35	94.98, 94.98, 25.42	38.94, 51.18, 48.39
Unit cell angle, β, °	95.49		93.46
X-ray wavelength, Å	1.0000	1.0000	1.0000
Resolution range, Å	50.0–1.70 (1.73–1.70)*	30.0–2.00 (2.03–2.00)*	50.0–2.10 (2.14–2.10)*
Total/unique reflections	38,373/22,351	54,617/9,187	41,520/10,779
Completeness, %	99.0 (98.4)*	99.9 (99.8)*	96.0 (95.8)*
CC1/2†	0.999 (0.921)*	0.997 (0.767)*	0.998 (0.935)*
<I >/<σI>	44.5 (3.5)*	35.8 (2.3)*	36.9 (2.7)*
Rmerge‡, %	5.6 (45.1)*	6.8 (62.6)*	7.0 (62.9)*
B. Model refinement
PDB ID code	5HS7	5HS8	5HS9
Resolution range, Å	50.0–1.70	30.0–2.00	50.0–2.10
Rwork/Rfree§, %	19.7/22.1	20.6/24.8	24.4/27.6
No. of nonhydrogen atoms/average B-factor, Å2
Protein	1,617/30.9	817/39.5	1,446/65.0
Water	160/39.8	78/50.8	11/67.7
Glycerol	6/29.2
Wilson B-factor, Å2	25.6	35.4	52.3
Rms deviations from ideal geometry
Bond lengths, Å/bond angles, °	0.012/1.54	0.011/1.26	0.012/1.48
Rms Z-scores
Bond lengths/bond angles	0.589/0.720	0.696/0.569	0.603/0.710
Ramachandran plot
Favored/outliers, %	96.0/0.0	99.0/0.0	99.0/0.0
Poor rotamers, %	0.6	0.0	1.0

^*Values in parentheses refer to the highest-resolution shell.

^†CC_1/2 is described in ref. 46.

^‡R_merge = Σ_h Σ_i | I(h)_i – < I(h) > |/Σ_h Σ_i I(h)_i, where I(h) is the intensity of reflection h, Σ_h is the sum over all reflections, and Σ_i is the sum over i measurements of reflection h.

^§R = Σ | |F_obs| – |F_calc| |/Σ |F_obs|, where R_free and R_work are calculated for a randomly chosen 5% of reflections that were not used for refinement and for the remaining reflections, respectively.

Crystal Structures of the Reduced (YodB_reduced), Diamide-Treated (YodB_diamide), and Quinone-Bound (YodB_MPBQ) Forms of B. subtilis YodB.

In all of the models, the C-terminal residues are disordered: three residues (Pro103–Asp105) in chain A and four residues (Glu102–Asp105) in chain B of YodB_reduced, two residues (Glu102–Pro103) of YodB_diamide, and five residues (Ser101–Asp105) of YodB_MPBQ. In the YodB_MPBQ model, the loop between β2 and β3 is completely disordered in both the A and B chains. The monomers of B. subtilis YodB_reduced and YodB_diamide are composed of five α-helices and three β-strands as follows: α1 (residues 7–17), α2 (residues 21–28), β1 (residues 33–34), α3 (residues 35–41), α4 (residues 47–59), β2 (residues 63–68), β3 (residues 74–79), and α5 (residues 81–100) (Fig. 1).

Fig. 1.

Overall structures of B. subtilis YodB_reduced, YodB_diamide, and YodB_MPBQ. (A) The structure of the B. subtilis YodB_reduced dimer (chain A in cyan and chain B in blue) is presented in two views. The cysteine residues are drawn as red and yellow spheres. The positions of the cysteine residues are indicated as black rectangular boxes and the details are shown in D. (B) The structure of the B. subtilis YodB_diamide dimer (chain A in yellow and chain B in orange) is presented in two views. The two disulfides are indicated as black rectangular boxes (Right) and the details are shown in E. (C) The structure of the B. subtilis YodB_MPBQ dimer (chain A in pink and chain B in magenta) is presented in two views. The disordered regions are drawn as black dotted lines. The conformational change related to the recognition of the DNA by YodB_MPBQ is marked by the black rectangular box and the details are shown in F. (D) The two sets of reduced cysteine residues in B. subtilis (Cys6 and Cys101′ or Cys6′ and Cys101) are drawn as red spheres. (E) The two disulfide bonds in B. subtilis YodB_diamide are drawn as an mFo−DFc electron density map, which is contoured at 2.0 σ (in blue mashes). (F) Modification of Cys6 by MPBQ induces conformational change of recognition helix (α4′) and movement of Trp20 and Glu10. The residues Arg19, Trp20, Met44, and Ile45 are also influenced by MPBQ binding. The structures were constructed using PyMOL (45).

The two monomer structures of YodB_reduced are highly similar to each other, with rms deviations of 0.7 Å for 96 equivalent Cα pairs. Additionally, the two monomer structures of YodB_MPBQ are nearly identical to each other, with rms deviations of 0.7 Å for 88 equivalent Cα pairs. The overall monomer structures of YodB_reduced are nearly identical to those of YodB_diamide (with rms deviations of 1.3−1.5 Å for 87−91 equivalent Cα pairs) and YodB_MPBQ (with rms deviations of 0.6−0.9 Å for 88−90 equivalent Cα pairs). Despite the high structural similarities between YodB_reduced, YodB_diamide, and YodB_MPBQ, large rms deviations are observed in several regions. For YodB_diamide, the N- and C-terminal α-helices (α1 and α5) and the loop between β2 and β3 showed maximum deviations of 2.3 Å (Cys6 at the start of α1), 7.0 Å (Cys101 at the end of α5), and 3.8 Å (Pro72), respectively; for YodB_MPBQ, the loop between β2 and β3 was completely disordered, and the α3 helix and the loop between α3 and α4 deviated from the corresponding region of YodB_reduced, with maximum deviations of 4.0 Å (Fig. 1C).

When the monomer structures of YodB_reduced and YodB_diamide were analyzed to identify structural homologs using the Dali server (18), the structures of Staphylococcus aureus QsrR (4) [Protein Data Bank (PDB) ID codes 4HQE and 4HQM; Z-scores of 12.4−16.1, rms deviations of 1.3−3.3 Å, and a sequence identity of 38% for 96−100 equivalent Cα pairs], B. subtilis HypR (19) (PDB ID codes 4A5M and 4A5N; Z-scores of 13.7−14.6, rms deviations of 2.1−3.4 Å, and a sequence identity of 38% for 95−100 equivalent Cα pairs), and E. coli MarR (20) (PDB ID code 1JGS; Z-scores of 11.7−12.4, rms deviations of 1.9−3.3 Å, and a sequence identity of 14% for 90 equivalent Cα pairs) were the most similar, as expected.

Diverse Features of the Dimer Structures of B. subtilis YodB_reduced, YodB_diamide, and YodB_MPBQ.

The molecular masses of B. subtilis YodB_5–105 (YodB_reduced, YodB_diamide, and YodB_MHPQ) were determined by size-exclusion chromatography with inline multiangle light scattering (SEC-MALS) and were ∼27−31 kDa (Fig. S2). These masses correspond to the dimer of B. subtilis YodB in solution.

Fig. S2.

SEC-MALS chromatograms of YodB_reduced (blue), YodB_diamide (orange), and YodB_MPBQ (magenta). UV absorption signals at 280 nm (left y axis, lines with dots) and calculated molar masses (right y axis, solid lines) are plotted as a function of the elution volume. The numbers denote the corresponding molecular masses of the peaks.

Strikingly different features were observed in the dimer models of each YodB protein (YodB_reduced, YodB_diamide, and YodB_MPBQ). Despite the high structural similarities between the YodB_reduced, YodB_diamide, and YodB_MPBQ monomers, the dimer models of each YodB are discretely dissimilar to each other (Fig. 1). The refined dimer models of YodB_reduced and YodB_diamide are essentially dissimilar, with rms deviations of 9.2 Å for 198 equivalent Cα pairs, whereas those of YodB_reduced and YodB_MPBQ display fewer conformational differences, with rms deviations of 1.3 Å for 178 equivalent Cα pairs (Fig. 1). The YodB dimer behaves in a different mode, with respect to its two types of thiol-reactive compound-induced forms, giving rise to significantly different shifts among YodB_reduced, YodB_diamide, and YodB_MPBQ.

The dimer structure of YodB_reduced is nearly identical to the structures of S. aureus QsrR and B. subtilis HypR, with the exception of the local positions of the α-helix (α4), which participated in the DNA binding, and the loop between β2 and β3 (Fig. S3). Despite the high similarity between the monomer structures of YodB_reduced and E. coli MarR, their dimer structures and the interfaces between monomers are completely different (Fig. S3). In the reduced state (YodB_reduced), the two sulfur atoms of Cys6/Cys101′ and Cys6′/Cys101 are well separated by 8.3 and 9.0 Å, respectively. After oxidation via the addition of diamide, disulfide bonds are formed with S–S distances of 2.2 Å (Fig. 1 D and E).

Fig. S3.

Structural comparisons of YodB with HypR, QsrR, and MarR. Superimposed views of (A) YodB_reduced and YodB_MPBQ, (B) QsrR_reduced (PDB ID code 4HQE; green) and QsrR_{oxidized(menadione)} (PDB ID code 4HQM; dark green), (C) HypR_reduced (PDB ID code 4A5N; gray) and HypR_oxidized (PDB ID code 4A5M; dark purple), and (D) MarR [PDB ID code 1JGS; light gray (chain A) and black (chain B)]. Cysteine residues involved in oxidation are drawn as sticks and colored in red and yellow.

The interfaces of YodB_reduced, YodB_diamide, and YodB_MPBQ per dimers are 3,300, 2,240, and 2,700 Ų, respectively. The interfaces of YodB_reduced are definitely larger than those of YodB_diamide and YodB_MPBQ, which may indicate that YodB_reduced forms a more favorable dimer than the other forms. Although they have dissimilar interfaces, the residues involved in the hydrophobic interactions of each dimeric interface in YodB_reduced, YodB_diamide, and YodB_MPBQ are nearly identical (Fig. 2). However, the residues that contribute to the hydrophilic interactions in the dimer of YodB_diamide are completely different from those in the YodB_reduced and YodB_MPBQ (Fig. 2).

Fig. 2.

Detailed structures of the dimeric interface of B. subtilis YodB_reduced, YodB_diamide, and YodB_MPBQ. (A) The residues in YodB_reduced that contribute hydrophobic interactions at the interface are depicted. The detailed hydrophilic interactions are labeled as a, b, and c, which are shown in D. (B) The residues in YodB_diamide that contribute to the hydrophobic interactions at the interface are depicted. The detailed hydrophilic interactions are labeled as a, which are shown in E. Because Glu92 and Glu92′ are partly buried in the hydrophobic environment and form no favorable interactions with other residues, it is feasible that the carboxylate groups of Glu92 and Glu92′ are protonated even at pH 5.7 (which is the measured pH value of the YodB_diamide crystallization condition) and interact with each other via hydrogen bonds with the distance between OE1 (Glu92) and OE2 (Glu92′) [or OE1 (Glu92′) and OE2 (Glu92)] of 2.6 Å. (C) The residues in YodB_MPBQ that contribute to hydrophobic interactions at the interface are depicted. The detailed hydrophilic interactions are labeled as a, b, and c, which are shown in F. (D−F) The residues that are involved in hydrophilic interactions at the dimeric interface of the three YodB dimers (YodB_reduced, YodB_diamide, and YodB_MPBQ) are shown in D−F, respectively. The hydrophilic interactions are indicated by red dotted lines. All figures are presented in the same orientation. For a better display, all residues of chain A and chain B are presented in a surface view and ribbon diagram, respectively.

Quinone-Induced Conformational Change in the YodB_MPBQ Dimer.

The mass spectra of the YodB (5–17) peptide show that the unmodified peptide peak at 1,413.6 Da is shifted to 1,535.7 Da after the addition of MPBQ (Fig. 3). The observed increase of 122.1 Da in the peptide mass corresponds to a covalent bond with MPBQ (molecular mass, 122.1 Da) (Fig. 3). In YodB_MPBQ, the electron density of MPBQ was not observed near the Cys6 or Cys6′ residues, although MPBQ was covalently bound to YodB as shown in Fig. 3C. The Cys6 and Cys6′ residues showed high B-factors of 83 Ų compared with 31 Ų for the two Cys6 residues in YodB_reduced (the average B-factors of YodB_MPBQ and YodB_reduced are 65 Ų and 31 Ų, respectively). This result indicates that MPBQ may increase the mobility of the two Cys6 residues in the dimer and affect a structural change in the dimer. In YodB_MPBQ, the loop between α3 and α4 moves toward the α2 helix, which causes the side chain of Trp20′ to approach α1 and to interact with Glu10 (Fig. 1F). The conformational change in the loop between α1′ and α2′ still maintains hydrophobic interactions with Met44′ and Ile45′ on the loop between α3′ and α4′. As a result, the MPBQ adducts on Cys6 and Cys6′ affect the DNA recognition helices α4 and α4′, causing them to move 3 Å (by measuring distance between Lys48/Lys48′-Cα atoms) toward each other, with ∼10° rotation (Fig. S4). In S. aureus QsrR, the conformational change induced by the S-quinonization of Cys5 affects the DNA-binding region (α4 and α4′) and allows it to be dissociated from the DNA (4). For B. subtilis HypR, the diamide- and NaOCl-induced disulfide bond formation force the HypR to bind to the DNA and activate the transcription of hypO (19). The S-quinonization of S. aureus QsrR moves α4 and α4′ of the QsrR dimer ∼11 Å in opposite directions, with a rotational change of ∼28°, whereas the disulfide bond formed in the B. subtilis HypR dimer moves α4 and α4′ ∼4 Å toward each other, with a rotational change of ∼9° (Fig. S3). The conformation of B. subtilis YodB_reduced most likely resembles that of QsrR_{oxidized(menadione)} (or HypR_reduced), rather than QsrR_reduced (or HypR_oxidized). The reason for the opposite orientations of α4 and α4′ in QsrR and HypR could be explained by the presence of a spacer between two inverted repeats in the DNA. B. subtilis YodB binds to DNA containing a seven nucleotide spacer, whereas QsrR and HypR bind to DNA with five and two nucleotide spacers, respectively (Fig. S5). The other conformational changes in the YodB_MPBQ dimer, including shifts in the loop between α3 and α4, the loop between β2 and β3, and the α3 helix, were also observed in the QsrR dimer (Fig. S3).

Fig. 3.

Mass spectra of YodB before and after S-adduct formation with MPBQ. (A) The chemical structure and molecular mass of MPBQ. (B) Mass spectra of the dissolved crystals of YodB_C101S grown after incubating with MPBQ (Lower) and without treatment with MPBQ (Upper). An increase of 125 Da indicates that MPBQ is covalently linked to Cys6 of the protein. (C) Mass spectra of the YodB (Met5−Gly17) peptide. The peptide mass is increased by 121.1 Da by the formation of the S-adduct of MPBQ. The addition of 1 mM DTT did not detach MPBQ from the peptide, indicating that an irreversible S-adduct of MPBQ was formed.

Fig. S4.

Structural comparison of YodB_MPBQ with YodB_reduced. (A) Superimposed structures of YodB_reduced and YodB_MPBQ in view identical to that in Fig. 1F. Residues and secondary structures affected by MPBQ-adducts are presented with the movement of α3 and α4 in the comparative figure. (B) Separate structural view of YodB_MPBQ from A. (C) Separate structural view of YodB_reduced from A. (D) Conformational changes in the DNA-recognition helices (α4 and α4′) of YodB_reduced and YodB_MPBQ are displayed in the superimposed structures of YodB_reduced and YodB_MPBQ.

Fig. S5.

In silico docking model of the DNA–YodB_reduced complex. (A) Stereo view of the DNA-bound YodB_reduced model, drawn in a view identical to that in Fig. 1. (B) Stereo view of the DNA-bound YodB_reduced model, drawn in the other view. The model of the DNA-bound YodB_reduced structure was generated using the High Ambiguity Driven Docking algorithm (HADDOCK) (40). Multiple solutions were clustered automatically and resulted in the best single cluster of docking results: The best solution showed the score of −131 ± 9.9, the smallest rms deviation (0.9 Å ± 0.5 Å), and the largest buried surface areas (1,994 ± 101.8 Ų). The coordinates for the YodB_reduced protein were taken from the current crystal structure without modifications, and coordinates for the DNA molecule of a 17-bp sequence (5′-ATACTATTTGTAAGTAA-3′) were modeled ab initio using the model.it server (41). The inverted repeats of DNA are colored in red.

Extensive Conformational Changes in the YodB_diamide Dimer.

Surprisingly, the dimer structure of YodB_diamide is quite different from any known structure, including S. aureus QsrR and B. subtilis HypR (Fig. 4 and Fig. S3). When we superimpose each monomer (monomer A) of YodB_reduced and YodB_diamide, the movement of the other monomer (monomer B) of YodB_diamide can clearly be analyzed. The conformational change in the YodB_diamide dimer is induced by the formation of two disulfide bonds between Cys6 and Cys101′ (or Cys6′ and Cys101) (Fig. 4A). These disulfide bonds reorient one monomer (chain B) and change the overall dimer structure, with a significant translocation of 37 Å (Fig. 4A). The formation of a disulfide bond between Cys6 and Cys101′ is accompanied by a large movement of two helices (α1 and α5′) to produce a favorable disulfide bond between two cysteine residues. The formation of disulfide bonds induces rotation of the α1 and α5′ helices by ∼10° and 30°, respectively, with a maximal shift of 11 Å at Glu81 on α5′ (Fig. 4B). To accommodate the formation of the other disulfide bond (Cys6′ and Cys101), the α1′ and α2′ helices are shifted in a perpendicular direction by the α5 axis, with a maximum distance of 25 Å (Fig. 4B). The translational movement of α1′, α2′, and α5′ is accompanied by the reorientation of chain B, along with the generation of a new dimer interface. As a result of the formation of the two disulfide bonds, the space between α1 and α1′ increases from 5 Å to 23 Å, with a ∼50° rotational movement (Fig. S6). One of the most striking features in the YodB_diamide dimer is a large movement of the DNA-recognition helices (α4 and α4′). The distance between α4 and α4′ (between Lys48/Lys48′-Cα atoms) in YodB_reduced is ∼39 Å, whereas that in the YodB_diamide is ∼60 Å for the equivalent Lys48-Cα pairs (Fig. 4C). The movement of the two α4 and α4′ helices of YodB_diamide is achieved by significant translational (37 Å) and rotational (56°) shifts following the addition of diamide. In addition, α1 and α1′ are reoriented to face each other through a ∼68° rotational movement (Fig. 4D). Although there are significant translational and rotational movements of the secondary structures in YodB, the dimensions of the YodB_reduced dimer are nearly identical to those of YodB_diamide, 35 × 30 × 80 Å. Disulfide bond formation between Cys6 and Cys108′ (14) does not seem to be favorable because the distance between Cys6 and Cys108′ is expected to be much larger than that between Cys6 and Cys101′.

Fig. 4.

Structural rearrangement of the YodB_diamide dimer upon the formation of two disulfide bonds. (A) The large movement of chain B of YodB_diamide is indicated by an arrow in the superimposed view of YodB_reduced and YodB_diamide dimers. Two cysteine residues (Cys6 and Cys101′) that form the disulfide bond are shown in red and yellow spheres. For a better display, two chains of YodB_reduced are presented in a transparent view. (Right) Surface views of the two structures (YodB_reduced and YodB_diamide) are superimposed. In the black rectangular box, surface views of YodB_reduced and YodB_diamide are presented separately. Following the addition of diamide, chain B of YodB is reoriented, with a large movement up to 37 Å and a rotation by 65°. The structural changes in YodB_diamide are depicted in B−D in detail. (B) The rotation of α1 and α5′ is caused by the disulfide bond between Cys6 and Cys101′. The translational movement of α1′ and α2′ is achieved by the disulfide bond between Cys6’ and Cys101. (C) The formation of two disulfide bonds results in a large change in the distance between the two DNA recognition helices (α4 and α4′). (D) In chain B of YodB_diamide, α1′ is shifted to a new position by a translational movement coupled with a rotation of 68°.

Fig. S6.

Structural reorientation of α1 and α1′ in the YodB dimer. Structures of YodB_reduced (Left) and YodB_diamide (Right) are presented. The helices α1 and α1′ are reoriented, and the distance between them is increased from 5 Å to 23 Å, with a ∼50° rotational movement by the formation of two disulfide bonds.

NMR Study of YodB_reduced, YodB_diamide, and YodB_MPBQ in Solution.

The conformations of YodB in solution were monitored by NMR spectroscopy. Approximately 91.3% (85 of 93, excluding 6 proline residues) of the chemical shifts were assigned to individual residues of B. subtilis YodB_5–105 in the reduced state (in the presence of 2 mM DTT). According to the chemical shift index, the secondary structure of the YodB protein in solution showed no deviation from the crystal structure.

Following the addition of diamide, both chemical shift changes and line broadenings on the backbone amide NH peaks were observed in the 2D [¹H,¹⁵N] transverse relaxation optimized spectroscopy–heteronuclear single-quantum correlation (TROSY-HSQC) spectra (Fig. 5A), indicating a conformational change in YodB in the intermediate and fast exchange mode on an NMR time scale. Significant chemical shift changes (which deviate from the average by over 1σ using a 1:2 ratio of YodB:diamide) were observed for residues on the α1 (Cys6, Ser11, Ala12, Ser14, and Leu16), α2 (Gly22), and α5 helices (Ala88, Trp96, and Asp98), as well as the loop between α1 and α2 (Trp20). In addition, significant line broadenings (top 10% of cross-peaks exhibiting large changes in intensities using 1:2 ratio of YodB:diamide) were observed for residues on α1 (Phe13), α3 (Lys36), α4 (Gln47, Lys48, Ala51, and Glu58), the loop between α3 and α4 (Ser46), α5 (Ala85 and Trp96), and the C-terminal loop (Gly104). When we mapped the affected residues onto the crystal structure of YodB_reduced, the residues were clustered in the homodimeric interface of YodB and the DNA recognition helix α4 (Fig. 5 B and C). These results indicate that diamide induced a large structural change in the homodimeric interface in solution, consistent with the crystal structure of YodB_diamide.

Fig. 5.

Diamide- and quinone-induced structural changes in B. subtilis YodB in solution. (A) (Left) Overlaid [¹H,¹⁵N] TROSY-HSQC titration spectra of the ¹⁵N-labeled YodB titrated with different ratios of diamide. (Lower Left) The overlaid [¹H,¹⁵N] TROSY-HSQC spectra of examples of peaks that exhibit chemical shift changes following diamide titration. The arrow in the diagram indicates the direction of the chemical shift. (Right) Overlaid [¹H,¹⁵N] TROSY-HSQC titration spectra of the ¹⁵N-labeled YodB titrated with different ratios of MPBQ. (Lower Right) Examples of peaks that exhibited chemical shift changes following diamide titration. (B, Left) The ratio of the cross-peak intensities (orange) and chemical shift changes (purple) of residues in YodB produced by diamide binding (2.0 equivalent) was plotted against the residue number. The ratio of the peak intensities was normalized to the ratio of the peak intensity of Glu70. The asterisks indicate the residues that did not exhibit observable peaks upon diamide titration due to severe broadening. The secondary structural elements of YodB_reduced are shown above the plot, where the helices and strands are indicated by cylinders and arrows, respectively. (B, Right) The ratio of the cross-peak intensities of residues in YodB produced by MPBQ-binding (2.0 equivalent) was plotted against the residue number. The ratio of the peak intensities was normalized to the ratio of the peak intensity of Thr68. (C, Left) The reductions in the signal intensities and chemical shift changes produced by diamide titration (2.0 equivalent) were mapped onto the crystal structure of YodB_reduced. The unassigned residues, including prolines, are indicated as gray spheres. (B, Right) The reduction in the signal intensities produced by MPBQ titration (2.0 equivalent) was mapped onto the crystal structure of YodB_reduced. The unassigned residues, including prolines, are indicated as gray spheres.

Using a titration of MPBQ, the overall number of peaks was significantly reduced in the 2D [¹H,¹⁵N] TROSY-HSQC spectra. However, in contrast to the diamide titration experiment, most of the cross-peaks did not exhibit significantly different chemical shifts compared with those of YodB_reduced following the addition of MPBQ (Fig. 5A). The result suggests that YodB undergoes only minimal structural changes in solution following MPBQ binding, which is consistent with the crystal structures of YodB_reduced and YodB_MPBQ. Notably, a significant reduction in the peak intensities (top 10% of cross-peaks exhibiting large changes in intensities; brought by a 1:2 ratio of YodB:MPBQ) was identified for residues on α1 (Ala12, Phe13, and Ser14), α2 (Gly22), and α5 (Thr84, Phe90, Asp98, and Gln99), and the loop between α1 and α2 (Lys18 and Arg19) (Fig. 5B). The observed decrease in the peak intensities suggests that, in its MPBQ-bound form, the residues on the homodimeric interface of YodB, which consists of the α1, α2, and α5 helices, undergo conformational changes at a rate that corresponds to the intermediate NMR time scale. Additionally, when we added a stoichiometric excess of MPBQ compared with YodB (stoichiometric ratio of YodB:MPBQ was 1:5), the overall cross-peaks were substantially broadened (Fig. S7). The results indicate that YodB may undergo dynamic behavior upon MBPQ binding, which may explain the extremely low binding affinity of YodB_MPBQ for DNA. Consistent with this observation, the crystal structure of YodB_MPBQ showed much higher average B-factors of 65 Ų compared with 31 Ų of YodB_reduced.

Fig. S7.

MPBQ increases overall structural mobility of B. subtilis YodB. (A) Two-dimensional [¹H,¹⁵N] TROSY-HSQC titration spectra of ¹⁵N-labeled YodB in the presence of 2 mM DTT. (B) Two-dimensional [¹H,¹⁵N] TROSY-HSQC titration spectra of ¹⁵N-labeled YodB in the presence of 5 equivalent diamide. (C) Two-dimensional [¹H,¹⁵N] TROSY-HSQC titration spectra of ¹⁵N-labeled YodB in the presence of 5 equivalent MPBQ.

To further characterize the interaction between YodB and DNA in solution, we investigated the binding mode between YodB and a 17-bp DNA containing the azoR1 promoter region (ATACTATTTGTAAGTAA) using NMR spectroscopy. In general, the overall cross-peaks in the 2D [¹H,¹⁵N] TROSY-HSQC spectrum of B. subtilis YodB showed line broadenings and not chemical shift changes upon DNA titration, even at the low DNA:YodB ratio of 0.1:1 (Fig. S8A). This result demonstrated a long rotational correlation time, which is attributed to the formation of the YodB–DNA complex in solution. In particular, 10 cross-peaks (Ser11, Ala12, Ser14, Gly17, Arg19, Lys36, Met49, Ala51, Leu57, and Val75) in the 2D [¹H,¹⁵N] TROSY-HSQC spectra were largely broadened upon DNA binding, showing a more than 70% reduction in the peak intensities (Fig. S8B). The residues of the most affected peaks were localized in three α-helices (α1, α3, and α4) and one β-strand (β3), which possess a predominantly positive electrostatic potential (Figs. S8C and S9). The DNA binding site of YodB identified here is consistent with that of DNA-bound S. aureus QsrR (PDB ID code 4QHE).

Fig. S8.

YodB binds to azoR1 promoter DNA in solution. (A) Two-dimensional [¹H,¹⁵N] TROSY-HSQC titration spectra of ¹⁵N-labeled YodB in the absence of azoR1 promoter DNA (black) and with 0.1 (orange) and 0.5 (blue) equivalents of the DNA. (B) Ratio of cross-peak intensities of residues in YodB produced by DNA-binding (0.1 equivalent), which is plotted versus residue number. The ratio of intensity was obtained by dividing each peak height value for YodB in the presence of 0.1 equivalent DNA by that of YodB alone. The secondary structural elements in YodB are shown above the plot, where the helices and strands are indicated by cylinders and arrows, respectively. Unassigned residues, including prolines, are represented as 0%. (C) Reductions in signal intensities produced by DNA binding, mapped onto the crystal structure. Backbone amide nitrogen atoms are indicated with spheres for chain A and colored according to intensity ratio [ratio < 0.3 (red), 0.3 ≤ ratio < 0.35 (orange), 0.35 ≤ ratio < 0.4 (light yellow), 0.4 ≤ ratio < 0.5 (light pink), 0.5 ≤ ratio < 1 (white)]. Unassigned residues, including prolines, are colored gray.

Fig. S9.

Electrostatic potential surfaces of YodB. Electrostatic potential surface diagrams for (A) YodB_reduced, (B) YodB_diamide, and (C) YodB_MPBQ. (D) The residues of YodB_reduced that are affected most upon DNA binding are depicted in both structures of YodB_reduced (Left) and YodB_MPBQ (Right). In D, residues are shown as sticks and are labeled in chain A only. The structures are shown in a view identical to that in Fig. 1. The molecular surface is colored in blue and red according to positive and negative electrostatic potentials, respectively. The electrostatic surface views were generated with GRASP and PyMOL (www.pymol.org).

Insights into the Dissimilar DNA-Dissociation Modes of YodB_diamide and YodB_MPBQ.

To investigate the influence of both thiol-reactive compounds (diamide and MPBQ) on two cysteine residues (Cys6 and Cys101) and their effects on the YodB–DNA interaction, we performed a fluorescence polarization assay to measure the dissociation constant (K_d) of the YodB_WT and mutant (YodB_C6S, YodB_C101S, and YodB_C6S/C101S) YodB constructs following treatment with diamide or MPBQ. The average K_d values from multiple measurements are summarized in Fig. 6. The data for YodB_WT show that the reduced form of YodB_WT binds to its cognate DNA with high affinity (K_d of 1.0 ± 0.1 μM), showing preference for the TACT{7}AGTA consensus sequence (Fig. 7A and Fig. S10). For the diamide-treated and MPBQ-treated YodB_WT, the binding affinities to the cognate DNA were lower than that of the reduced form of YodB_WT (Fig. 7A). In addition, diamide-treated YodB has a relatively higher DNA-binding affinity (K_d of 5.0 ± 0.9 μM) than MPBQ-treated YodB (K_d of 32.9 ± 8.1 μM), which may suggest that the addition of MPBQ allows YodB to be easily dissociated from the DNA compared with diamide-treated YodB. The dissimilarity of DNA-binding affinities between MPBQ-treated YodB and diamide-treated YodB is also consistent with our in vivo transcription assay of the YodB-controlled azoR1 gene (Fig. 7A). The result indicates that the transcription of the azoR1 gene is activated by much lower concentration of MPBQ (0.01 mM) than diamide (10 mM). Furthermore, the transcriptional activation of azoR1 by MPBQ treatment lasts longer due to the irreversible nature of the MPBQ-derived modification (Fig. 7B). Reverse transcription quantitative real-time quantitative PCR (RT-qPCR) analysis further confirmed that YodB responds to diamide and MPBQ with distinct mechanisms in vivo. The mutation of C101S resulted in the decreased induction of azoR1 in response to diamide, whereas the YodB_C101S mutant still retained its responsiveness to MPBQ (Fig. 7C). These results clearly show that diamide and MPBQ use different mechanisms in vivo, which is consistent with our observations in vitro. For the C6S and C101S mutants, the binding affinities of the diamide-treated YodB mutants were three- to sevenfold higher than those of diamide-treated YodB_WT. However, the binding affinities of the diamide-treated single mutants (C6S or C101S) were not similar to those of the YodB_WT. The results deviated somewhat from our dimeric structure of YodB_diamide, because the C6S (or C101S) mutant could not form disulfides to allow the large structural change that permits complete dissociation from the DNA. This result may indicate that the thiol group of Cys6 (or Cys101) is converted into sulfenic acid by diamide, which influences the dissociation of the YodB dimer from the DNA (21, 22). If sulfenic acid formed on the thiol group of Cys6 (or Cys101), the intermediate state of YodB might temporarily stabilize the diamide-induced conformation until the disulfide bonds are formed. In the YodB_C6S/C101S mutant, the K_d value for the diamide-treated YodB_C6S/C101S is nearly identical to that for the untreated YodB_C6S/C101S, as expected. Following the addition of MPBQ, the K_d value of the YodB_C101S is decreased by 5.1-fold compared with that of the MPBQ-treated YodB_WT, whereas the K_d of YodB_C6S is decreased by 8.6-fold, indicating that MPBQ has a larger effect on Cys6 than Cys101, as revealed in previous reports (13). In the double mutant (C6S/C101S) of YodB, the K_d value for the MPBQ-treated YodB_C6S/C101S (1.6 ± 0.3 μM) is still fivefold lower than the untreated YodB_C6S/C101S (0.3 ± 0.1 μM), which indicates that an additional MPBQ-induced factor affects the oxidation of the YodB protein. To further reveal a minor effect on YodB protein by MPBQ, we performed MALDI-TOF MS analysis of the YodB_C6S/C101S mutant to detect any possible modifications made by MPBQ (Fig. S11). The mass of C6S/C101S was increased by 15 Da after the addition of MPBQ. This change may result from an oxidation on a noncysteine residue that still affects DNA-binding affinity of C6S/C101S. Accordingly, we performed NMR experiments to study the interactions between the YodB_C6s/101S and MPBQ in solution (Fig. S11). Upon the addition of a fivefold stoichiometric excess of MPBQ over YodB, the overall peak intensities were slightly decreased and the residues that showed line broadenings were distributed over a large fraction of protein. This result suggests that MPBQ can induce a minor but global conformational change in YodB when in solution and decrease the binding affinity of YodB to its cognate DNA.

Fig. 6.

Fluorescence polarization assays for the DNA binding affinities of (A) the WT, (B) C101S, (C) C6S, and (D) C6S/C101S double mutants of B. subtilis YodB. The YodB binding assay was performed with the azoR1 promoter site. The experiment showed that diamide and MPBQ inhibit the DNA-binding affinity of YodB through different mechanisms. The experiment with the reduced YodB proteins was performed in the presence of DTT, shown in black. The plots of diamide-treated and MPBQ-treated YodB are shown in orange and blue, respectively. The average values of triplicate measurements and SDs are shown.

Fig. 7.

Changes in the transcript levels for azoR1 in response to diamide and MPBQ in vivo, determined by RT-qPCR. WT or C101S mutant B. subtilis PS832 cells were treated with diamide (orange) or MPBQ (blue), and relative levels for azoR1 were determined. The data represent the mean + SD (n = 3). (A) MPBQ induced expression of azoR1 at a 1000-fold lower concentration than diamide. Total RNA was extracted 5 min after the treatment. The transcript level for azoR1 before the treatment was taken as 1, and the relative expression levels are shown. (B) WT B. subtilis cells were treated with 10 mM diamide or 0.01 mM MPBQ, and total RNA was extracted after the indicated periods of time. The transcript level for azoR1 in the WT cells before the treatment (0 min) was taken as 1, and the relative expression levels are shown. (C) C101S mutant cells were treated with 10 mM diamide or 0.01 mM MPBQ, and total RNA was extracted 5 min after the treatment. The transcript level for azoR1 in WT cells without the treatment was taken as 1, and the relative expression levels are shown.

Fig. S10.

The fluorescence polarization plot for the binding affinity between the WT YodB and the noncognate DNA in the reduced state. The result indicates no binding affinity between them. The assay was performed with a 24-bp-long, 6-FAM–labeled noncognate DNA molecule (GGACGCGGTGTCGCCGCACCCGGG).

Fig. S11.

Interactions between YodB(C6S/C101S) and MPBQ in solution. (A) Mass spectra for the YodB C6S/C101S mutant before (Left) and after (Right) the addition of 5 equivalents of MPBQ. Minor mass difference of 15 Da in two mass data may indicate a possible oxidation (the addition of an oxygen atom) on a noncysteine residue by MPBQ. (B) Two-dimensional [¹H,¹⁵N] TROSY-HSQC titration spectra of the ¹⁵N-labeled YodB(C6S/101S) in the absence of MPBQ (black), and with 2 (blue), and 5 (red) equivalents of MPBQ. (C) Ratio of cross-peak intensities of residues in YodB in the presence of MPBQ (5 equivalent), plotted against the residue number. The secondary structure elements in YodB are shown above the plot, where the helices and strands are indicated by cylinders and arrows, respectively. Unassigned residues, including prolines, are represented as 0%.

Discussion

In B. subtilis, oxidative stress by RES such as diamide and quinones triggers the expression of regulons that are regulated by Spx, CtsR, PerR, CymR, and the MarR/DUF24 family of regulators (14, 23). B. subtilis YodB is a prototypical MarR/DUF24 family transcriptional regulator that directly senses and responds to both quinone and diamide (4, 14). Most of the MarR/DUF24 family regulators possess a conserved cysteine residue near the N terminus, and one or two cysteine residues with less-conserved positions are located near the C terminus (14). Because B. subtilis YodB resembles two-Cys type regulators, including X. campestris OhrR (sequence identity of 20.3%) and B. subtilis HypR (sequence identity of 31.0%), the molecular function of YodB was expected to be very similar to these regulators (19). However, our in-depth insights into the mechanism of B. subtilis YodB show that it undergoes different conformational changes (YodB_diamide or YodB_MPBQ) that are individualized to different redox-related signals. The diamide-mediated and quinone-mediated signaling pathways involving YodB process the stress information into distinct functional responses in B. subtilis but they up-regulate the same subset of genes to inhibit the repressive action of YodB. Therefore, we propose the following redox switch mechanism for B. subtilis YodB: (i) diamide-mediated signaling pathway, which includes the possible diamide-induced formation of sulfenic acid intermediates on Cys6 (or Cys101), formation of two diamide-induced disulfide bonds between Cys6 and Cys101′ (or Cys6′ and Cys101), full dissociation of YodB from the operator DNA, and activation of diamide-detoxification systems and (ii) quinone-mediated S-alkylation on Cys6 of YodB, which includes the possible quinone-induced formation of sulfinic or sulfonic acid intermediates on Cys6 (or Cys101), formation of a quinone adduct on Cys6 and Cys6′, and full dissociation of YodB from the operator DNA (Fig. 8). It is surprising that two different thiol-reactive compounds induce different conformational changes in the structure of the transcription factor YodB (YodB_diamide or YodB_MPBQ), which activates gene expression in dissimilar ways. Diamide is sensed by B. subtilis YodB via the formation of intermolecular disulfide bonds between two cysteine residues (Cys6 and C101′/Cys6′ and Cys101) of opposing subunits with large structural rearrangements. In contrast, MPBQ induces S-alkylation on Cys6 of YodB and enables the dissociation of YodB from the target DNA, with minor structural changes that are similar to QsrR and HypR.

Fig. 8.

Proposed redox switch mechanism for B. subtilis YodB. The two pathways of the YodB protein are depicted as (1) the diamide-mediated signaling pathway and (2) quinone-mediated S-alkylation, with each possible intermediate form. The diamide-mediated signaling pathway is reversible, whereas the quinone-mediated S-alkylation is irreversible, as indicated by the arrows. YodB is regulated either by the formation of two diamide-induced disulfide bonds between Cys6 and Cys101′ (or Cys6′ and Cys101) or the formation of a quinone adduct on Cys6 and Cys6′. In contrast to the reversible reaction of the diamide-mediated pathway, low concentration of quinones irreversibly dissociate YodB from the target DNA. The intermediate diamide-induced form may have oxidized the sulfur atoms on the cysteine residues, whereas the intermediate form indicated by an asterisk may be induced by unknown factors as well as the oxidation of cysteine residues. Finally, the derepression of the YodB protein on the target DNA by the two oxidative reagents allows the transcription of oxidation-detoxifying genes. The model of the DNA-bound YodB_reduced structure was generated using the High Ambiguity Driven Docking algorithm (HADDOCK) (43). Cysteine residues that are affected by the oxidative signals are shown in orange.

In addition, the structural changes induced by MPBQ are relatively minor and more responsive than those induced by diamide. Therefore, it can be suggested that B. subtilis may discriminate two oxidative signals (MPBQ and diamide) using one YodB regulator and respond to the more toxic compound MPBQ at much lower concentration than diamide (Fig. S1). In addition to this delicate system, the different features or reversibility of the two reactions (a reversible reaction by diamide or an irreversible S-adduct formation by quinones) may contribute to the equilibrated redox state in cells such as B. subtilis for the efficient management of oxidative shocks. To the best of our knowledge, our study on YodB provides the first insights into a redox regulator that responds to multiple oxidation signals (via intermolecular-disulfide bonds or S-alkylation) with distinct conformational changes and presents a possible regulatory mechanism at the molecular level. In summary, this study provides structural insights into how B. subtilis YodB senses multiple signals and regulates gene expression in distinct pathways. It also provides a structural basis for the relationship between ligand-induced conformational changes and its functional switch.

Materials and Methods

Gene Cloning.

The primers used in the study are listed in Table S1. The residues Met5–Asp105 (YodB_5–105) of the yodB (BSU19540) gene were amplified from the B. subtilis genomic DNA (strain 168) (24) by PCR using the primers yodB-F/yodB-R. The gene products for the three mutants (YodB_C6S, YodB_C101S, and YodB_C6S/C101S) were obtained by PCR using the primers yodBC6S-F/yodB-R, yodB-F/yodBC101S-R, and yodBC6S-F/yodBC101S-R, respectively. The amplified DNA was inserted into the pET-28a(+) expression vector (Novagen) that had been digested with both NdeI and XhoI. The four constructs of YodB include a 21-residue hexa-histidine tag (MGSSHHHHHHSSGLVPRGSHM) at the amino terminus of the recombinant protein to facilitate protein purification. The resulting constructs were verified by DNA sequencing.

Table S1.

Primers used in this study

Primer	Sequence
yodB-F	GGGAATTCCATATGATGTGCCCTAAAATGGAATCCG
yodB-R	CCGCTCGAGTTAGTCACCAGGCTCGCAAAATTG
yodBC6S-F	GGGAATTCCATATGATGTCCCCTAAAATGGAATCC
yodBC101S-R	CCGCTCGAGTTAGTCACCAGGCTCAGAAAATTG
ΔyodB1_F	GCTGCATAGCAGCTAAAGAAG
ΔyodB1_R	CTTTAGTTGAAGAATAAAGGATCCCTTCATCTATTGATTGAC
ΔyodB2_F	CAGTCGGTTTTCATATGTCACTAACCTGAAAAAGAGCCTTTG
ΔyodB2_R	CCTGACGACCTCATGGTATC
pDG1730_yodB_F	CGCGGATTCAACATCCAGAGTATTCGTCATAGTGT
pDG1730_yodB_R	CCCAAGCTT TTATTTCTCTTCTTCACACACTGTGTC
pDG1730_C101S_F	GATCAATTTAGCGAGCCTGG
pDG1730_C101S_R	CCAGGCTCGCTAAATTGATC
RT-qPCR_azoR1_F	TTTTCGCATTCCCGCTTTGG
RT-qPCR_azoR1_R	CCTTCTGAGTAGACACCGCC
RT-qPCR_23s rRNA_F	AAAGGCACAAGGGAGCTTGACTGCGAGA
RT-qPCR_23s rRNA_R	ATGAGCCGACATCGAGGTGCCAAACCT

Protein Expression and Purification.

The purification of the WT and three mutant YodB_5–105 proteins was nearly identical, except for the treatment with the oxidizing reagents (diamide or MPBQ). The YodB proteins were overexpressed in E. coli strain BL21(DE3). The cells were grown in LB culture medium containing 50 μg/mL kanamycin at 37 °C until they reached an OD₆₀₀ of 0.5, and protein expression was induced by treating the cells with 0.5 mM isopropyl-β-d-thiogalactopyranoside for 4 h at 37 °C. The cells were then harvested by centrifugation at 5,500 × g for 10 min at 4 °C. The cell pellet was resuspended and lysed by sonication in buffer A (50 mM Tris⋅HCl, pH 8.0, and 500 mM NaCl) containing 10% (vol/vol) glycerol and EDTA-free Complete Protease Inhibitor Mixture (Roche). The cell debris was removed and discarded by centrifugation at 18,000 × g for 1 h at 4 °C. The supernatant was applied to a nickel-nitrilotriacetic acid-agarose affinity chromatography column (Novagen) that had been equilibrated in buffer A. The protein was eluted with buffer A containing 200 mM imidazole. To purify YodB_reduced, the eluted sample was diluted 10-fold with buffer B (20 mM Tris⋅HCl, pH 8.0) containing 2 mM β-mercaptoethanol. The diluted protein sample was loaded onto a Hiprep Q column (GE Healthcare) that had been preequilibrated with buffer B. The sample was eluted with a gradient of 50–800 mM NaCl in buffer B. To cleave the N-terminal hexa-histidine tag, 100 units of thrombin from human plasma (Sigma-Aldrich) were added to 10 mg of the eluted protein and incubated for 12 h at 20 °C. The cleaved protein was applied to a HiLoad 16/60 Superdex 75 prep-grade column (GE Healthcare) that had been equilibrated with buffer C (20 mM Tris⋅HCl at pH 8.0 and 150 mM NaCl) containing 1 mM DTT and 1 mM EDTA, as a final purification step. For crystallization, the purified protein was concentrated to 18.3 mg/mL using an Amicon Ultra-15 centrifugal filter unit (Millipore).

The YodB_diamide protein was expressed and purified essentially as described for YodB_reduced, with the exception of the reaction with diamide and buffer composition. After purification on a nickel-nitrilotriacetic acid-agarose affinity column, the protein sample was incubated with 1 mM diamide for 1 h at room temperature and then diluted 10-fold with buffer B. The diluted protein sample was loaded onto a Hiprep Q column (GE Healthcare) that had been preequilibrated with buffer B. The sample was eluted with a gradient of 50–800 mM NaCl in buffer B. The cleavage of the N-terminal hexa-histidine tag was identical to that for YodB_reduced. The cleaved protein was applied to a HiLoad 16/60 Superdex 75 prep-grade column (GE Healthcare) that had been equilibrated with buffer C, as a final purification step. For crystallization, the purified protein was concentrated to 16.5 mg/mL using an Amicon Ultra-15 centrifugal filter unit (Millipore).

The YodB_MPBQ protein was expressed and purified essentially as described for YodB_reduced, with the exception of the addition of MPBQ after purification. To promote homogeneous conjugation following the addition of MPBQ, we used the YodB_C101S mutant instead of the WT YodB protein, which is similar to the procedure for menadione-modified QsrR (4). After purification by SEC, 600 µM purified protein was incubated with 1.5 mM MPBQ for 1 h at room temperature and was then further purified on a HiLoad 16/60 Superdex 75 prep-grade column (GE Healthcare) that had been equilibrated with buffer C. For crystallization, the purified protein was concentrated to 24 mg/mL using an Amicon Ultra-15 centrifugal filter unit (Millipore).

For NMR spectroscopy, the homogeneous ¹⁵N-labeled YodB_5–105 proteins were produced in E. coli BL21 (DE3) cells using M9 minimal media containing 1 g/L ¹⁵NH₄Cl. The ²H-, ¹⁵N-, and ¹³C-labeled proteins were produced by growing E. coli BL21 (DE3) cells in M9 minimal media containing 1 g/L ¹⁵NH₄Cl and 1.5 g/l ¹³C₆-glucose in ∼99% D₂O instead of H₂O. The purification procedures for the uniformly labeled YodB_5–105 proteins are identical to those for YodB_reduced. For the NMR measurements, the purified proteins were concentrated using an Amicon Ultra-15 centrifugal filter unit (Millipore) and the buffer was exchanged to 20 mM MES, pH 6.5, containing 150 mM NaCl, 2 mM DTT, and 1 mM EDTA. Ten percent D₂O was added to the sample before it was loaded into a Shigemi tube.

Crystallization and X-Ray Data Collection.

YodB_reduced, YodB_diamide, and YodB_MPBQ were crystallized in 96-well crystallization plates at 293 K using the sitting-drop vapor-diffusion method. Each sitting drop was prepared by mixing 0.5 µL each of the protein solution and the reservoir solution [0.2 M sodium bromide and 20% (wt/vol) PEG 3,350 for YodB_reduced; 0.1 M Bis-Tris at pH 5.5, 200 mM lithium sulfate, and 25% (wt/vol) PEG 3,350 for YodB_diamide; and 0.2 M sodium citrate tribasic dihydrate and 30% (wt/vol) PEG 3,350 for YodB_MPBQ] and was placed over 70 µL of the reservoir solution. The crystals were vitrified using a cryoprotectant solution that consisted of the reservoir solution supplemented with 20% (vol/vol) glycerol. The crystals were soaked in the cryoprotectant solution for a few seconds before being frozen in liquid nitrogen. A set of X-ray diffraction data for the YodB_reduced crystal was collected at 100 K on a Quantum 270 CCD area detector (Area Detector Systems Corporation) at the BL-7A experimental station of the Pohang Light Source, Korea. The YodB_reduced crystal belongs to the monoclinic space group P2₁, with unit cell parameters of a = 40.78 Å, b = 50.80 Å, c = 50.35 Å, β = 95.49°. The X-ray diffraction data for both the YodB_diamide and YodB_MPBQ crystals were collected at 100 K on a Quantum 315r CCD area detector at the BL-5C experimental station of the Pohang Light Source, Korea. The YodB_diamide crystal belongs to the hexagonal space group P6₂, with unit cell parameters of a = b = 94.98 Å, c = 25.42 Å. The YodB_MPBQ crystal belongs to the monoclinic space group P2₁, with unit cell parameters of a = 38.94 Å, b = 51.17 Å, c = 48.39 Å, β = 93.46°. The raw data were processed and scaled using the HKL2000 program (25). Table 1 summarizes the data collection statistics.

Structure Determination, Refinement, and Analysis.

The crystal structures of B. subtilis YodB were determined using the molecular replacement method in MOLREP (26), which used a monomer model of S. aureus QsrR as a search model (4). Two models of B. subtilis YodB were further refined with the REFMAC (27) and PHENIX (28) programs, including bulk solvent correction. The model was manually constructed and water molecules were added using the Coot program (29). Five percent of the data were randomly set aside as the test data for the calculation of R_free (30). The stereochemistry of the final structures was evaluated using MolProbity (31). The overall geometry of the final models of YodB_reduced, YodB_diamide, and YodB_MPBQ ranked in the 97th, 100th, and 98th percentiles, with MolProbity scores of 1.29, 1.02, and 1.47, where the 100th percentile is the best among structures of comparable resolution. The structural deviations were calculated using Superpose (32). The solvent-accessible surface areas were calculated using PISA (33). The protein–protein interactions were calculated using the Protein Interactions Calculator (34).

NMR Spectroscopy.

All NMR experiments were conducted at 298 K on a Bruker 800-MHz or 900-MHz NMR spectrometer equipped with cryogenic probes. The backbone assignments of H^N, N, C′, C^α, and C^β were obtained from the 3D HNCO, HN(CA)CO, HNCA, HN(CO)CA, HNCACB, and HN(CO)CACB spectra. The chemical shifts were externally referenced to DSS. All 2D and 3D NMR datasets were processed with NMRPipe (35) and analyzed in NMRView (36). The titration of ¹⁵N YodB with diamide was performed with 500 μM ¹⁵N YodB using stocks of 100 mM diamide in 20 mM MES, pH 6.5, 150 mM NaCl, 2 mM DTT, and 1 mM EDTA, which was used to record the [¹H,¹⁵N] TROSY-HSQC spectra. The titration of ¹⁵N YodB with MPBQ was performed with 500 μM ¹⁵N-labeled YodB using stocks of 50 mM MPBQ in 20 mM MES, pH 6.5, 150 mM NaCl, 2 mM DTT, and 1 mM EDTA, which was used to record the [¹H,¹⁵N] TROSY-HSQC spectra. The binding of YodB_reduced to the double-strand 17-bp DNA containing the azoR1 promoter region (ATACTATTTGTAAGTAA) was investigated by comparing the [¹H,¹⁵N] TROSY-HSQC spectra of 500 μM ¹⁵N-labeled YodB in 20 mM MES, pH 6.5, 150 mM NaCl, 2 mM DTT, and 1 mM EDTA in the presence or absence of DNA.

Fluorescence Polarization Assay.

The 6-FAM–labeled 17-bp double-strand DNA containing the azoR1 promoter region (ATACTATTTGTAAGTAA) was purchased from Bioneer. To determine the DNA-binding affinities of YodB_5–105 in the reduced state, a 100 nM solution of the 6-FAM–labeled DNA was incubated with increasing amounts of the purified proteins in buffer D (20 mM Tris⋅HCl at pH 7.5 and 150 mM NaCl) containing 2 mM DTT for 30 min at 25 °C. To determine the DNA-binding affinities of YodB_5–105 in the oxidized state, the proteins were incubated with 5 mM diamide or 5 mM MPBQ, which were further dialyzed against buffer D before incubation with a 100 nM solution of the 6-FAM–labeled DNA. The fluorescence polarization signals were recorded using black 384-well plates (Greiner) on a SpectraMax M5e microplate reader (Molecular Devices) with a 485-nm excitation filter and a 520-nm emission filter. The data were analyzed with KaleidaGraph (Synergy Software) using the equation ΔFP = FP − FP_free = (ΔFP_max [protein])/K_d + [protein]), where FP_free is the background polarization signal (no protein, measured), ΔFP_max is the maximum polarization change (calculated), and [protein] is the protein concentration and K_d is the dissociation constant. The bound fractions were calculated as ΔFP/ΔFP_max. Each experiment was performed in triplicate.

SEC-MALS.

SEC was performed on a BioSep SEC-s3000 size-exclusion column (Phenomenex) using a 1260 infinity HPLC system (Agilent Technologies), and MALS was measured inline using a miniDAWN-TREOS instrument with an emission at 657.4 nm (Wyatt Technology). The scattering data were analyzed with ASTRA 6.0.1.10 software (Wyatt Technology). To determine the multimeric state of YodB_5–105 in the reduced state, the protein was analyzed in buffer C containing 2 mM DTT at room temperature. To determine the multimeric states of YodB_5–105 in the oxidized state, the proteins were incubated with 5 mM diamide or 5 mM MPBQ at room temperature, which were further dialyzed against buffer C and loaded onto a column that had been preequilibrated with buffer C.

Cell Growth Curve Measurement.

B. subtilis strain PS832, a prototrophic derivative of strain 168, was used for the growth curve measurements. The long-flanking homologous recombination method was performed to delete the yodB gene in B. subtilis (37) using the ΔyodB1_F/ΔyodB1_R and ΔyodB2_F/ΔyodB2_R primers. For complementation of the WT yodB gene, the target DNA was amplified and included its native promoter and terminator using the pDG1730_yodB_F and pDG1730_yodB_R primers. The amplified DNA was inserted into the pDG1730 vector that had been digested with both BamHI and EcoRI. The insertion of the vector containing the yodB gene into B. subtilis was performed as previously described (38). The cloned samples were spread onto LB agar plates supplemented with 5 μg/mL chloramphenicol and 100 μg/mL spectinomycin, which were then incubated overnight at 37 °C. For the growth curve measurements of B. subtilis strain PS832 and the ΔyodB mutant, the cells from each single colony were diluted into 20 mL prewarmed Spizizen minimal medium (39) in 50-mL conical tubes (SPL Life Sciences) and incubated at 37 °C with agitation at 180 rpm. When the OD₆₀₀ reached 0.4 (time 0), diamide, MHQ, or MPBQ from freshly prepared stock solutions were added to the medium and the OD₆₀₀ was measured every 30 min for up to 2 h (60 min over the next 2 h).

RT-qPCR Analysis.

The yodB C101S mutant was generated using a site-directed mutagenesis kit (Stratagene) based on the complementation construct (pDG1730:yodB) with the pDG1730_C101S_F/ pDG1730_C101S_R primer set. B. subtilis strains were grown in LB medium at 37 °C overnight and diluted 1:100 into LB medium. The cells were grown until they reached an OD₆₀₀ of 0.4, followed by the addition of diamide or MPBQ. Total RNA from both treated and untreated cells was isolated using an RNeasy Mini Kit (Qiagen) with additional treatment with RNase free DNase I (Qiagen) following the manufacturer’s instructions. RT-qPCR was performed using a One Step SYBR PrimeScript PLUS RT-PCR kit (Takara) in an Applied Biosystems 7300 Real Time PCR System with the following primers specific to azoR1 and 23s rRNA: RT-qPCR_azoR1_F/ RT-qPCR_azoR1_R and RT-qPCR_23s rRNA_F/ RT-qPCR_23s rRNA_R, respectively. The 23s rRNA gene was used as an endogenous control, and the relative fold change in azoR1 gene expression was calculated using the comparative C_T (2^−ΔΔC_T) method (40).

Determination of Minimum Inhibitory Concentration.

The WT or ΔyodB mutant B. subtilis PS832 cells were tested using in vitro susceptibility tests [minimum inhibitory concentration (MIC)]. The MIC tests were performed using the Clinical and Laboratory Standards Institute (CLSI) [formerly National Committee for Clinical Laboratory Standards (NCCLS)] broth microplate method (NCCLS, 2003) with a starting inoculum of ∼10⁶ cfu/mL for all isolates (41, 42). The cells were cultured in LB broth at 37 °C for 24 h. MIC was defined as the lowest concentration of antimicrobial agent that inhibited visible growth. The results of the MIC tests are summarized in Fig. S1.

In Silico DNA-YodB_reduced Docking.

Lacking crystallographic data for the interaction between YodB_reduced and its cognate DNA, an in silico molecular docking study was performed using the High Ambiguity Driven protein–protein Docking algorithm (HADDOCK) (43). The coordinates for the YodB_reduced protein were taken from the current crystal structure without modifications, and coordinates for a DNA molecule spanning 17 bp (sequence 5′-ATACTATTTGTAAGTAA-3′) were modeled ab initio using the model.it server (44). The residues Gln47, Lys48, and Glu52 of the recognition helix (α4 and α4′) in the YodB_reduced dimer as well as the base pairs thymine2–thymine5 and adenine13–adenine16 within two consecutive major grooves of the DNA were defined as “active residues,” which are required to have an interface contact of ambiguous distance. Passive residues were defined automatically as residues around active residues.