Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2016 Sep 15;11(9):e0162255. doi: 10.1371/journal.pone.0162255

Cosavirus, Salivirus and Bufavirus in Diarrheal Tunisian Infants

Siwar Ayouni 1,2, Marie Estienney 1, Sabeur Hammami 3,4, Mohamed Neji Guediche 3,4, Pierre Pothier 1,5, Mahjoub Aouni 2, Gael Belliot 1,5, Alexis de Rougemont 1,5,*
Editor: Christiane E Wobus6
PMCID: PMC5025138  PMID: 27631733

Abstract

Three newly discovered viruses have been recently described in diarrheal patients: Cosavirus (CosV) and Salivirus (SalV), two picornaviruses, and Bufavirus (BuV), a parvovirus. The detection rate and the role of these viruses remain to be established in acute gastroenteritis (AGE) in diarrheal Tunisian infants. From October 2010 through March 2012, stool samples were collected from 203 children <5 years-old suffering from AGE and attending the Children’s Hospital in Monastir, Tunisia. All samples were screened for CosV, SalV and BuV as well as for norovirus (NoV) and group A rotavirus (RVA) by molecular biology. Positive samples for the three screened viruses were also tested for astrovirus, sapovirus, adenovirus, and Aichi virus, then genotyped when technically feasible. During the study period, 11 (5.4%) samples were positive for one of the three investigated viruses: 2 (1.0%) CosV-A10, 7 (3.5%) SalV-A1 and 2 (1.0%) BuV-1, whereas 71 (35.0%) children were infected with NoV and 50 (24.6%) with RVA. No mixed infections involving the three viruses were found, but multiple infections with up to 4 classic enteric viruses were found in all cases. Although these viruses are suspected to be responsible for AGE in children, our data showed that this association was uncertain since all infected children also presented infections with several enteric viruses, suggesting here potential water-borne transmission. Therefore, further studies with large cohorts of healthy and diarrheal children will be needed to evaluate their clinical role in AGE.

Introduction

Diarrhea remains a frequent illness throughout the world and causes the death of almost 6 million children annually, especially in developing countries. Besides well-documented enteric viruses, the list of viral pathogens causing acute gastroenteritis (AGE) is continuously growing with the emergence of new viruses. No less than three new types of virus have been discovered in diarrheal patients these last years: Cosavirus and Salivirus, two new genera in the Picornaviridae family since 2013, and Bufavirus from the Protoparvovirus genus of the Parvoviridae.

Cosavirus (CosV) was first identified in 2008 from children suffering from acute flaccid paralysis but has been later associated with diarrhea. It has been detected in feces from both patients with gastroenteritis and healthy subjects [1]. CosV has a single-stranded RNA genome of around 7.6 Kb organized in a typical picornavirus genome and has a wide genetic diversity: not less than 6 species (noted A to F) have already been described, of which CosV-A includes 24 different genotypes, and CosV-D includes 5 different genotypes [2].

Salivirus (SalV) was first identified in 2009 [3, 4]. SalV has a single-stranded RNA genome of around 7.1Kb organized in a typical picornavirus genome. Although this virus is related, but distinct, to the Kobuvirus genus, SalV forms a genus that presently includes a single genotype with 2 clusters [5]. Human salivirus (also formerly called klasseviruses) has been associated with diarrhea and detected in feces from both gastroenteritis patients and healthy subjects from all continents, as well as in sewage from Spain and Hong-Kong, suggesting a widespread geographic distribution [4].

Bufavirus (BuV) was first discovered in 2012 in fecal samples from children suffering from diarrhea in Burkina Faso, from which it get its name [6]. Thereafter, BuV was detected in diarrheal stool samples of children from other continents [7–10]. BuV has a single-stranded DNA genome of around 4.9Kb, which encodes nonstructural protein 1 (NS1) and viral structural protein (VP2). Three genotypes (BuV1, 2 and 3) have been described so far [11], but diversity within the capsid gene suggests the possibility of several other genotypes [6].

Whether these viruses are etiologic agents of human gastroenteritis remains unclear, but knowledge about their distribution and genetic divergence in humans is mounting. In this context, the detection rate and the role of these new viruses in AGE in diarrheal infants remain to be established.

Methods

From October 2010 through March 2012, stool samples were collected from 203 children <5 years-old suffering from AGE and attending the Fattouma-Bourguiba Children’s Hospital in Monastir, Tunisia. The children’s median age (MA) was 7.0 mo (ranging 0.5 to 60 mo), and the sex ratio was 1.29. The study and the data collection procedure were approved by the Ethics and Research Committee of the Fattouma-Bourguiba Public Hospital. Informed consents were obtained verbally from the parents of the study participants and consigned in their clinical records in accordance to the Tunisian good clinical practices and hospital clinical investigations guidelines. The samples were anonymized before processing.

For each stool sample, nucleic acids were extracted from 800 μl of 10% fecal suspension in PBS on a Nuclisens® EasyMAG system (bioMérieux, Marcy l’Etoile, France), according to the manufacturer’s instructions. RNA/DNA was eluted in a final volume of 110 μL. CosV and SalV were screened by nested RT-PCR using primer sets targeting the 5’UTR region [1, 12]; and BuV by nested PCR using primer sets targeting the NS1 region [6]. Virus characterization was performed using primer sets targeting various regions: capsid (VP1) and polymerase (3Dpol) for CosV [1, 2]; capsid (VP0), helicase (2Chel) and polymerase (3Dpol) for SalV [4, 13, 14]; and the capsid protein region (VP2) for BuV using the following designed primers: ARUB259: 5’- ATCTCTTTGTTAACCTTGCTAGAAAAAAAG -3’ and ARUB261: 5’- TTASWWTGTGTAGTTWGGCATDSMTC -3’ giving a PCR product of 1710 nt. Primer details are provided in Table 1. RT-PCRs were performed using the Qiagen OneStep RT-PCR kit (Qiagen GmbH, Hilden, Germany) and PCRs with Novagen KOD Hot Start polymerase kit (EMD Millipore, Darmstadt, Germany) on an Eppendorf MasterCycler PCR machine (Eppendorf AG, Hamburg, Germany), according to the manufacturer’s instructions.

Table 1. Oligonucleotides used for detection and genotyping of cosavirus, salivirus and bufavirus in this study.

Virus Method Target Primer Nucleotide Sequence Reference
Cosavirus RT-PCR 5’UTR DKV-N5U-F1 CGT GCT TTA CAC GGT TTT TGA Kapoor et al, 2008 [1]
(1st round) DKV-N5U-R1 GGT ACC TTC AGG ACA TCT TTG G
VP1 INO-VP1-F1 GAI CAR GCI ATG ATG GGI AC Kapusinszky et al, 2012 [2]
INO-VP1-R2 GCI GGI CCI GGR TTK GWY TC
3Dpol DKV-IF1 CTA CCA RAC ITT YCT IAA RGA Kapoor et al, 2008 [1]
DKV-IR1 GCA ACA ACI ATR TCR TCI CCR TA
PCR 5’UTR DKV-N5U-F2 ACG GTT TTT GAA CCC CAC AC Kapoor et al, 2008 [1]
(2nd round) DKV-N5U-R2 GTC CTT TCG GAC AGG GCT TT
VP1 INO-VP1-F1-2 GCC ATG ATG GGI ACI TWY DCI ATI TGG GA Kapusinszky et al, 2012 [2]
INO-VP1-R3 TAR TCI GGR TAI CCR TCR AA
3Dpol DKV-IF2 CTA CCA GAC ATT TCT CAA RGA YGA Kapoor et al, 2008 [1]
DKV-IR2 CCG TGC CAG AIG GIA RIC CIC C
Salivirus RT-PCR 5’UTR SAL-L1 CCC TGC AAC CAT TAC GCT TA Shan et al, 2010 [12]
(1st round) SAL-R1 CAC ACC AAC CTT ACC CCA CC
VP0 LG0119 GCT AAC TCT AAT GCT GCC ACC Holtz et al, 2009 [4]
LG0136 GCT AGG TCA GTG GAA GGA TCA
2Chel KL-2C-F1 CTC GCY GAG GAC ATC ACG GA Han et al, 2010 [13]
KL-2C-R1 GTA CAG GTA CAC RAC CAG TGG CT
3Dpol LL-3D-F1 GAA GAT GCC ATT CGT GGT CTC Li et al, 2009 [14]
LL-3D-R1 AGT CCA GAA CAC GAC CAG GTT
PCR 5’UTR SAL-L2 ATT GAG TGG TGC ATG TGT TG Shan et al, 2010 [12]
(2nd round) SAL-R2 ACA AGC CGG AAG ACG ACT AC
VP0 KLVPF GTC ACY CCM AAC ACC TCC ACT GAA G Han et al, 2010 [13]
KLVPR TTC TGC RCC ATC RGC TCC CGA
2Chel KL-2C-F2 AAT CTG CTG CCC AGG CCG C Han et al, 2010 [13]
KL-2C-R2 AGG GAG ATG GCR GAG AGA GCT GT
3Dpol LL-3D-F2 CTT TCC CAA TCT CCT GGC TAC Li et al, 2009 [14]
LL-3D-R2 GAA GGA CAG AGG GGA TAG TGG
Bufavirus RT-PCR NS1 BF.F1 TCA ACA ATC ACT CAG GCA AAT GG Phan et al, 2012 [6]
(1st round) BF.R1 AGT TTG CCT GGA TGT TCT TTG A
PCR NS1 BF.F2 CTA ACA CTG GTA CTT GCT ATG GAC Phan et al, 2012 [6]
(2nd round) BF.R2 TTC TCT GGT GAT GAT TCT TTT GTC
Open in a new tab

Sequences were obtained with the ABI Big Dye sequencing kit on an ABI 3130XL sequencer (Applied Biosystems, Waltham, USA). Phylogenetic analysis were performed using using MEGA6 software [15]. After sequence alignment using the MUSCLE programme with a maximum of 64 iterations [16], phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter model with a discrete gamma distribution, which was the best-fit DNA substitution model for the nucleotide dataset submitted. Bootstrap values were calculated from 1000 replicates. The nucleotide sequences were deposited in the GenBank database under the accession numbers: KU362760 to KU362792.

All samples were tested for norovirus (NoV) and group A rotavirus (RVA) by RT-qPCR. Positive samples for the three screened viruses were also tested for astrovirus (AstV) and sapovirus (SaV) by RT-qPCR, adenovirus (AdV) by qPCR and Aichi virus (AiV) by RT-PCR then genotyped when technically feasible, using the NRC’s PCR screening and typing procedures as reported in S1 Table [17–30]. Secretor status of positive individuals has been determined by genotyping on blood samples by using the methods described in our previous studies [31, 32].

Results and Discussion

During the study period, 71 (35.0%) children were infected with norovirus and 50 (24.6%) with rotavirus, of which 11 were mixed infections. In all, 11 (5.4%) samples were positive for one of the three investigated viruses: 2 (1.0%) CosV (MA = 12.0 mo.), 7 (3.5%) SalV (MA = 6.0 mo.) and 2 (1.0%) BuV (MA = 20.8 mo.). Of note, all individuals infected by these new viruses were secretors. No mixed infections involving these viruses were found, but multiple infections with 1 to 4 viruses responsible for GEA in humans were found in all cases (Table 2). These mixtures of several enteric viruses, particularly with non-enteric adenoviruses, suggest here an environmental contamination from soiled waters. While both CosV and BuV infections occurred during winter in 2 different seasons, most SalV infections occurred in the autumn of the second season of the survey (Fig 1). However, the number of tested stools being rather limited, a larger sampling will be required to confirm any seasonality pattern.

Table 2. Demographic characteristic and detected enteric viruses in patients with cosavirus, salivirus or bufavirus infections.

New viruses detected Genotype Sample ID Age, mo / sex Sample date Other viruses tested* GenBank Accession Numbers
NoV RVA AstV AdV SaV AiV
CosV A10 H036 9/M 2011/01/21 GII.g/GII.1 ‒ ‒ AdV-2 GI.2 AiV-A KU362764a, KU362766b, KU362784c, KX721253d
A10 H226 3/F 2012/03/15 ‒ ‒ ‒ ‒ + ‒ KU362765a,KU362785cKX721254d
SalV A1 H010 27/M 2011/03/09 ‒ G2P[4] ‒ ‒ + ‒ KU362767d, KU362773a, KU362779b, KU362786c
A1 H108 13/M 2011/12/03 ‒ G9P[8] ‒ + GII.1 ‒ KU362768d, KU362774a, KU362780b, KU362787c
A1 H142 12/M 2011/10/04 GII.P21/GII.3 G4P[8] ‒ AdV-41 ‒ ‒ KU362769d, KU362775a, KU362781b, KU362788c
A1 H144 2.5/F 2011/09/30 ‒ ‒ ‒ + ‒ ‒ KU362770d, KU362776a, KU362782b, KU362789c
A1 H159 6/F 2011/10/20 GII.P21/GII.3 ‒ ‒ AdV-6 ‒ ‒ KU362771d, KU362777a, KU362783b, KU362790c
A1 H169 39/M 2012/02/18 ‒ G3P[8] ‒ ‒ ‒ ‒ KU362791c
A1 H214 7/M 2011/11/15 ‒ ‒ HAstV-5 ‒ ‒ ‒ KU362772d, KU362778a, KU362792c
BuV 1 H040 2.5/M 2011/01/30 GII + ‒ AdV-6 ‒ ‒ KU362760a, KU362762d
1 H232 39/M 2012/03/05 ‒ GxP[8] ‒ AdV-2 ‒ ‒ KU362761a, KU362763d
Open in a new tab

CosV: cosavirus; SalV: salivirus; BuV: bufavirus; NoV: norovirus; RVA: rotavirus; AstV: astrovirus; AdV: adenovirus; SaV: sapovirus; AiV: Aichi virus

* Genotypes are shown when available; ‒: negative; +: positive; M: male; F: female

a Polymerase region

b Helicase region

c 5’UTR region

d VP region

Fig 1. Temporal distribution of norovirus, rotavirus, cosavirus, salivirus and bufavirus in Tunisian children from October 2010 to March 2012.

Fig 1

Open in a new tab

Our data showed that the detection rate of CosV in diarrheal children (1%) was lower than observed in China or Brazil, where they were reported in diarrheal children in 2.8% and 3.6% of patients [33, 34], respectively. CosV has been previously reported in up to 33.0% of healthy Tunisian subjects or suffering from non-polio acute flaccid paralysis, most of them being children <6 years old [35]. However, the difference in detection rates is due to different natures of the two cohorts. According to phylogenetic analysis of their VP1 regions, the two CosV strains, H036 and H226, were closely related to the genotype A10. Indeed, they shared 87% and 88% of their nucleotide sequences, respectively, but 98% of their amino acids (aa) sequences with the Nepalese NP8/3 CosV strain (JQ811823) (Fig 2A). Since the 3Dpol sequence of the NP8/3 strain is not known and the length of the sequences is short, their 3Dpol regions were closely related to the Nigerian NG263 CosV strain (JN867756), which belongs to the genotype A20, with 93% and 94% of nucleotide sequence homology, respectively (Fig 2B). Of note, the VP1 sequences of our strains shared merely 56% of their aa sequences with the NG263 strain.

Fig 2. Phylogenetic trees of cosaviruses detected in diarrheal Tunisian children.

Fig 2

Open in a new tab

A. VP1 region of cosavirus (904 nt); B. 3Dpol region of cosavirus (400 nt). Phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter nucleotide substitution model with a discrete gamma distribution. Bootstraps values were calculated from 1000 replicates. Strains of this study are shown in red. Genotypes are shown in bold.

In this study, the detection rate of SalV infections accounted for 3.5% of the Tunisian cases, which is close to the 4.2% observed in Chinese children but much less than the 8.8% of cases in South Korea [12, 13]. Although they are globally widespread, SalV seem to circulate more in Asia that in North Africa. Interestingly, the detection rate of SalV in this study was similar to the detection rate of AiV (3.6%) in Tunisian children [36]. Since Salivirus is a genus phylogenetically close to Kobuvirus, both viruses might share some epidemiology characteristics that remain to be defined. Phylogenetic analysis of VP0, 2Chel and 3Dpol regions of 6 of the 7 detected SalV also showed that they belonged to the cluster A1 and were all closely related with various Asian strains, especially from South Korea (Fig 3). Further analysis also showed that the nt and aa sequences of the Tunisian clustering strains (i.e. strains H010, H142, H144, H159 and H214) had 99% of homology with Hungarian strains detected 1 year later in newborns suffering from AGE [5] (data not show).

Fig 3. Phylogenetic trees of saliviruses detected in diarrheal Tunisian children.

Fig 3

Open in a new tab

A. VP0 region of salivirus (815 nt); B. 2CHel region of salivirus (275 nt); C. 3Dpol region of (686 nt); Phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter nucleotide substitution model with a discrete gamma distribution. Bootstraps values were calculated from 1000 replicates. Strains of this study are shown in blue. Genotypes are shown in bold.

With a low detection rate (1%), BuV were only found occasionally in Tunisian stools. These findings are similar to those observed in children from Asia, Europe or Africa where detection rates range from 0.5% to 4.0% in patients of all ages [6–10]. Given that this present study was focused only on young children, our results suggest that BuV detection rate is the similar in young children as the rest of the Tunisian population. Complete VP2 sequences of H040 and H232 BuV strains showed that both strains belonged to genotype 1 and shared 99% of their sequence with published West-African and Finnish strains (Fig 4A). The 2 BuV strains shared 99% of their VP2 aa sequences (7/569 aa substitutions). Although NS1 sequences appeared more closely related to strains from genotype 3 (Fig 4B), aa sequence analysis of BuV polymerase showed small divergence between genotypes. Serological studies will be needed to get a better picture of BuV circulation in Tunisian population.

Fig 4. Phylogenetic trees of bufaviruses detected in diarrheal Tunisian children.

Fig 4

Open in a new tab

A. VP2 region of bufavirus (1710 nt); B. NS1 region of bufavirus (441 nt) Phylogenetic trees were inferred using the Maximum Likelihood method based on the Tamura-3-parameter nucleotide substitution model with a discrete gamma distribution. Bootstraps values were calculated from 1000 replicates. Strains of this study are shown in green. Genotypes are shown in bold.

Conclusion

Although these new viruses are suspected to be responsible for AGE in children, our data showed that this association was uncertain since all infected children also presented infections with several enteric viruses. Nevertheless, these multiple infections exemplified the threat that enteric viruses pose in terms of public health within communities in North Africa and generally in developing countries. Therefore, further studies with large cohorts of healthy and diarrheal children will be needed to evaluate their clinical role in AGE.

Supporting Information

S1 File. GenBank Accession Numbers.

(DOCX)

Click here for additional data file. (11.8KB, docx)
S1 Table. Oligonucleotides used for detection and genotyping of classic enteric viruses in this study.

(PDF)

Click here for additional data file. (73.7KB, pdf)

Acknowledgments

Siwar Ayouni was awarded a fellowship from Campus France (PHC-UTIQUE program). We would like to thank Philip Bastable for editorial assistance.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

SA was awarded a fellowship from Campus France (PHC-UTIQUE program). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Kapoor A, Victoria J, Simmonds P, Slikas E, Chieochansin T, Naeem A, et al. A highly prevalent and genetically diversified Picornaviridae genus in South Asian children. Proc Natl Acad Sci U S A. 2008;105(51):20482–7. Epub 2008/11/27. 10.1073/pnas.0807979105 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Kapusinszky B, Phan TG, Kapoor A, Delwart E. Genetic diversity of the genus Cosavirus in the family Picornaviridae: a new species, recombination, and 26 new genotypes. PLoS ONE. 2012;7(5):e36685 Epub 2012/05/23. 10.1371/journal.pone.0036685 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Greninger AL, Runckel C, Chiu CY, Haggerty T, Parsonnet J, Ganem D, et al. The complete genome of klassevirus—a novel picornavirus in pediatric stool. Virol J. 2009;6:82 Epub 2009/06/23. 10.1186/1743-422X-6-82 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Holtz LR, Finkbeiner SR, Zhao G, Kirkwood CD, Girones R, Pipas JM, et al. Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread. Virol J. 2009;6:86 Epub 2009/06/26. 10.1186/1743-422X-6-86 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Boros A, Raab M, Karoly E, Karai A, Katai A, Bolba N, et al. A cluster of salivirus A1 (Picornaviridae) infections in newborn babies with acute gastroenteritis in a neonatal hospital unit in Hungary. Arch Virol. 2016;161(6):1671–7. 10.1007/s00705-016-2824-9 . [DOI] [PubMed] [Google Scholar]
  • 6.Phan TG, Vo NP, Bonkoungou IJ, Kapoor A, Barro N, O'Ryan M, et al. Acute diarrhea in West African children: diverse enteric viruses and a novel parvovirus genus. J Virol. 2012;86(20):11024–30. Epub 2012/08/03. 10.1128/JVI.01427-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Altay A, Yahiro T, Bozdayi G, Matsumoto T, Sahin F, Ozkan S, et al. Bufavirus genotype 3 in Turkish children with severe diarrhoea. Clin Microbiol Infect. 2015. 10.1016/j.cmi.2015.06.006 . [DOI] [PubMed] [Google Scholar]
  • 8.Chieochansin T, Vutithanachot V, Theamboonlers A, Poovorawan Y. Bufavirus in fecal specimens of patients with and without diarrhea in Thailand. Arch Virol. 2015;160(7):1781–4. 10.1007/s00705-015-2441-z . [DOI] [PubMed] [Google Scholar]
  • 9.Huang DD, Wang W, Lu QB, Zhao J, Guo CT, Wang HY, et al. Identification of Bufavirus-1 and Bufavirus-3 in Feces of Patients with Acute Diarrhea, China. Sci Rep. 2015;5:13272 10.1038/srep13272 . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Smits SL, Schapendonk CM, van Beek J, Vennema H, Schurch AC, Schipper D, et al. New viruses in idiopathic human diarrhea cases, the Netherlands. Emerg Infect Dis. 2014;20(7):1218–22. 10.3201/eid2007.140190 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Yahiro T, Wangchuk S, Tshering K, Bandhari P, Zangmo S, Dorji T, et al. Novel human bufavirus genotype 3 in children with severe diarrhea, Bhutan. Emerg Infect Dis. 2014;20(6):1037–9. Epub 2014/05/27. 10.3201/eid2006.131430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Shan T, Wang C, Cui L, Yu Y, Delwart E, Zhao W, et al. Picornavirus salivirus/klassevirus in children with diarrhea, China. Emerg Infect Dis. 2010;16(8):1303–5. Epub 2010/08/04. 10.3201/eid1608.100087 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Han TH, Kim CH, Chung JY, Park SH, Hwang ES. Klassevirus infection in children, South Korea. Emerg Infect Dis. 2010;16(10):1623–5. Epub 2010/09/30. 10.3201/eid1610.100539 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li L, Victoria J, Kapoor A, Blinkova O, Wang C, Babrzadeh F, et al. A novel picornavirus associated with gastroenteritis. J Virol. 2009;83(22):12002–6. Epub 2009/09/18. 10.1128/JVI.01241-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 2013;30(12):2725–9. 10.1093/molbev/mst197 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32(5):1792–7. 10.1093/nar/gkh340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lyman WH, Walsh JF, Kotch JB, Weber DJ, Gunn E, Vinje J. Prospective Study of Etiologic Agents of Acute Gastroenteritis Outbreaks in Child Care Centers. J Pediatr-Us. 2009;154(2):253–7. 10.1016/j.jpeds.2008.07.057 . [DOI] [PubMed] [Google Scholar]
  • 18.Kojima S, Kageyama T, Fukushi S, Hoshino FB, Shinohara M, Uchida K, et al. Genogroup-specific PCR primers for detection of Norwalk-like viruses. J Virol Methods. 2002;100(1–2):107–14. . [DOI] [PubMed] [Google Scholar]
  • 19.da Silva AK, Le Saux JC, Parnaudeau S, Pommepuy M, Elimelech M, Le Guyader FS. Evaluation of removal of noroviruses during wastewater treatment, using real-time reverse transcription-PCR: different behaviors of genogroups I and II. Appl Environ Microbiol. 2007;73(24):7891–7. 10.1128/AEM.01428-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Gutierrez-Aguirre I, Steyer A, Boben J, Gruden K, Poljsak-Prijatelj M, Ravnikar M. Sensitive detection of multiple rotavirus genotypes with a single reverse transcription-real-time quantitative PCR assay. J Clin Microbiol. 2008;46(8):2547–54. 10.1128/JCM.02428-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gomara MI, Cubitt D, Desselberger U, Gray J. Amino acid substitution within the VP7 protein of G2 rotavirus strains associated with failure to serotype. J Clin Microbiol. 2001;39(10):3796–8. Epub 2001/09/28. 10.1128/JCM.39.10.3796-3798.2001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.EuroRotaNet. European Rotavirus Detection and Typing Methods 2009. Available: http://www.eurorota.net/docs.php.
  • 23.Gentsch JR, Glass RI, Woods P, Gouvea V, Gorziglia M, Flores J, et al. Identification of group A rotavirus gene 4 types by polymerase chain reaction. J Clin Microbiol. 1992;30(6):1365–73. Epub 1992/06/01. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Le Cann P, Ranarijaona S, Monpoeho S, Le Guyader F, Ferre V. Quantification of human astroviruses in sewage using real-time RT-PCR. Res Microbiol. 2004;155(1):11–5. Epub 2004/02/05. 10.1016/j.resmic.2003.09.013 S0923-2508(03)00230-4 [pii]. . [DOI] [PubMed] [Google Scholar]
  • 25.Noel JS, Lee TW, Kurtz JB, Glass RI, Monroe SS. Typing of human astroviruses from clinical isolates by enzyme immunoassay and nucleotide sequencing. J Clin Microbiol. 1995;33(4):797–801. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Oka T, Katayama K, Hansman GS, Kageyama T, Ogawa S, Wu FT, et al. Detection of human sapovirus by real-time reverse transcription-polymerase chain reaction. Journal of Medical Virology. 2006;78(10):1347–53. 10.1002/jmv.20699 . [DOI] [PubMed] [Google Scholar]
  • 27.Noel JS, Liu BL, Humphrey CD, Rodriguez EM, Lambden PR, Clarke IN, et al. Parkville virus: a novel genetic variant of human calicivirus in the Sapporo virus clade, associated with an outbreak of gastroenteritis in adults. J Med Virol. 1997;52(2):173–8. . [PubMed] [Google Scholar]
  • 28.Le Guyader F, Estes MK, Hardy ME, Neill FH, Green J, Brown DW, et al. Evaluation of a degenerate primer for the PCR detection of human caliciviruses. Arch Virol. 1996;141(11):2225–35. . [DOI] [PubMed] [Google Scholar]
  • 29.Allard A, Albinsson B, Wadell G. Rapid typing of human adenoviruses by a general PCR combined with restriction endonuclease analysis. J Clin Microbiol. 2001;39(2):498–505. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Yamashita T, Sugiyama M, Tsuzuki H, Sakae K, Suzuki Y, Miyazaki Y. Application of a reverse transcription-PCR for identification and differentiation of Aichi virus, a new member of the Picornavirus family associated with gastroenteritis in humans. J Clin Microbiol. 2000;38(8):2955–61. . [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ayouni S, Estienney M, Sdiri-Loulizi K, Ambert-Balay K, de Rougemont A, Aho S, et al. Relationship between GII.3 norovirus infections and blood group antigens in young children in Tunisia. Clin Microbiol Infect. 2015;21(9):874 e1-8. 10.1016/j.cmi.2015.05.015 . [DOI] [PubMed] [Google Scholar]
  • 32.Ayouni S, Sdiri-Loulizi K, de Rougemont A, Estienney M, Ambert-Balay K, Aho S, et al. Rotavirus P[8] Infections in Persons with Secretor and Nonsecretor Phenotypes, Tunisia. Emerg Infect Dis. 2015;21(11):2055–8. 10.3201/eid2111.141901 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Dai XQ, Hua XG, Shan TL, Delwart E, Zhao W. Human cosavirus infections in children in China. J Clin Virol. 2010;48(3):228–9. Epub 2010/06/12. 10.1016/j.jcv.2010.03.024 . [DOI] [PubMed] [Google Scholar]
  • 34.Stocker A, Souza BF, Ribeiro TC, Netto EM, Araujo LO, Correa JI, et al. Cosavirus infection in persons with and without gastroenteritis, Brazil. Emerg Infect Dis. 2012;18(4):656–9. Epub 2012/04/04. 10.3201/eid1804.111415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rezig D, Ben Farhat E, Touzi H, Meddeb Z, Ben Salah A, Triki H. Prevalence of human cosaviruses in Tunisia, North Africa. J Med Virol. 2015;87(6):940–3. 10.1002/jmv.24076 . [DOI] [PubMed] [Google Scholar]
  • 36.Sdiri-Loulizi K, Gharbi-Khelifi H, de Rougemont A, Chouchane S, Sakly N, Ambert-Balay K, et al. Acute infantile gastroenteritis associated with human enteric viruses in Tunisia. J Clin Microbiol. 2008;46(4):1349–55. Epub 2008/02/22. 10.1128/JCM.02438-07 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. GenBank Accession Numbers.

(DOCX)

Click here for additional data file. (11.8KB, docx)
S1 Table. Oligonucleotides used for detection and genotyping of classic enteric viruses in this study.

(PDF)

Click here for additional data file. (73.7KB, pdf)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES