Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2016 Jul 29;291(38):19800–19812. doi: 10.1074/jbc.M116.724088

iniBAC induction Is Vitamin B12- and MutAB-dependent in Mycobacterium marinum*

Maikel Boot 1, Marion Sparrius 1, Kin Ki Jim 1, Susanna Commandeur 1, Alexander Speer 1, Robert van de Weerd 1, Wilbert Bitter 1,1
PMCID: PMC5025670  PMID: 27474746

Abstract

Tuberculosis can be treated with a 6-month regimen of antibiotics. Although the targets of most of the first-line antibiotics have been identified, less research has focused on the intrabacterial stress responses that follow upon treatment with antibiotics. Studying the roles of these stress genes may lead to the identification of crucial stress-coping mechanisms that can provide additional drug targets to increase treatment efficacy. A three-gene operon with unknown function that is strongly up-regulated upon treatment with isoniazid and ethambutol is the iniBAC operon. We have reproduced these findings and show that iniBAC genes are also induced in infected host cells, although with higher variability. Next, we set out to elucidate the genetic network that results in iniBAC induction in Mycobacterium marinum. By transposon mutagenesis, we identified that the operon is highly induced by mutations in genes encoding enzymes of the vitamin B12 biosynthesis pathway and the vitamin B12-dependent methylmalonyl-CoA-mutase MutAB. Lipid analysis showed that a mutA::tn mutant has decreased phthiocerol dimycocerosates levels, suggesting a link between iniBAC induction and the production of methyl-branched lipids. Moreover, a similar screen in Mycobacterium bovis BCG identified that phthiocerol dimycocerosate biosynthesis mutants cause the up-regulation of iniBAC genes. Based on these data, we propose that iniBAC is induced in response to mutations that cause defects in the biosynthesis of methyl-branched lipids. The resulting metabolic stress caused by these mutations or caused by ethambutol or isoniazid treatment may be relieved by iniBAC to increase the chance of bacterial survival.

Keywords: antibiotics, gene regulation, mycobacteria, stress response, tuberculosis, iniBAC, mutAB, vitamin B12

Introduction

Mycobacterium tuberculosis, the causative agent of tuberculosis, is responsible for 1.5 million deaths annually, making it the most deadly bacterial pathogen known to mankind (1). Although tuberculosis can be treated effectively with a long term multidrug regimen, failure to complete treatment has led to increasing occurrence of drug resistance, which in turn complicates treatment (1, 2). Therefore, the need to develop new anti-mycobacterial compounds is evident. An attractive target for drug therapy is the mycobacterial cell wall, which is composed of non-canonical elements providing the opportunity to specifically target mycobacteria (3). In the past several antibiotics that target the mycobacterial cell wall have been identified and have proven to be effective in treatment of tuberculosis. Well known examples of specific anti-cell wall antibiotics for mycobacteria are ethambutol (EMB)2 and isoniazid (INH). Ethambutol targets the polymerization of arabinan, an essential component of the mycobacterial cell wall involved in covalently linking the peptidoglycan layer to the outer membrane (4). The prodrug isoniazid is activated by the peroxidase KatG and subsequently forms adducts with NAD+ to inhibit InhA, a NADH-dependent enoyl-ACP (acyl carrier protein) reductase (5). As a consequence, biosynthesis of mycolic acids, the most abundant lipid of the mycobacterial outer membrane, is inhibited, causing an aberrant and lethal deformation of the cell wall (6). Recent research efforts have emphasized that also other essential steps in the biogenesis of the mycobacterial cell wall can serve as new targets for anti-tuberculosis interventions (7, 8).

Although our knowledge on cell wall biosynthesis in mycobacteria has greatly increased over the last decades, the bacterial stress responses that follow after treatment with antibiotics targeting the mycobacterial cell wall have yet to be elucidated. By mapping the intra-bacterial responses upon treatment with antibiotics, key pathways that are necessary to cope with antibiotics or with antibiotic-induced stress can be identified. Moreover, mapping bacterial stress levels may help to explain the observed heterogeneity, displayed by bacterial subpopulations, to antibiotic treatment within patients (9). Together, these findings might pave the way for novel drug targets that sensitize or enhance currently used antibiotics.

Despite the availability of gene expression data after exposure of mycobacteria to anti-tuberculosis drugs, there is no comprehensive map of the stress response pathways that follow upon treatment. Moreover, antibiotic stress regulation pathways were not addressed in general. Insights into the pathways that mycobacteria deploy when confronted with antibiotic treatment will lead to a better understanding of the bacterial adaptive strategies and may consequently pinpoint drug-induced blind spots that can be targeted by novel compounds. Some individual genes or gene clusters that are regulated in response to antibiotic treatment have been well characterized. For instance, the acyl carrier protein kasA has been found to be up-regulated in response to isoniazid (10). Another set of genes that was found to be highly induced by sublethal concentrations of ethambutol and isoniazid in M. tuberculosis and Mycobacterium bovis BCG is the iniBAC operon (11, 12). This operon was found to be induced specifically by these two cell wall targeting antibiotics but not by general cell wall stress caused by disruption of the membrane integrity through the activity of granulysin or lysozyme (12). Further studies by the same group showed that overexpression of iniA seemed to confer tolerance to INH treatment in M. bovis BCG but not in M. tuberculosis (13). This suggests a function for iniA in coping with the stress that is induced by INH or EMB treatment in M. bovis BCG. Despite these early studies, not much is known about the pathways that lead to induction of these three genes with unknown function.

In Escherichia coli, disruption of cell wall biosynthesis can be sensed by extracytoplasmic function sigma factor E (14). Similarly, mycobacterial sigE has been shown to respond to heat-shock and oxidative stresses (15). Although sigE is not a specific sensor for cell wall stress, other sigma factors may play a role in the stress network that is activated upon iniBAC induction. A few publications have addressed the regulation of the iniBAC operon. Colangeli et al. (16) have shown that lsr2, among regulating a large set of other genes, negatively regulates iniBAC expression, whereas recent studies have also implicated operon regulation by mtrA and the alleged INH binding regulation element inbR (17, 18).

In this study we aimed to elucidate the genetic network that revolves around the induction of the iniBAC operon. We found that the operon can be induced by mutations in vitamin B12 biosynthesis or the vitamin B12-dependent methylmalonyl-CoA mutase MutAB in Mycobacterium marinum. Mutants in mutAB show decreased phthiocerol dimycocerosate (PDIM) and phenolic glycolipid (PGL) levels but no altered antibiotic susceptibility.

Results

The iniBAC Operon Is Induced upon EMB and INH Treatment in M. marinum

To investigate the response of the iniBAC operon to stress, we generated a reporter gene construct by placing the gene encoding green fluorescent protein mEos3.1 under control of the M. marinum iniB promoter region, optimized as previously reported for M. tuberculosis (12). The reporter construct was transformed into M. marinum cells, and activity was assessed using the inducing antibiotics INH or EMB. The initial induction experiments were carried out by the addition of the antibiotics EMB or INH at their minimal inhibitory concentration (MIC) followed by flow cytometry analysis. Starting from day 1, we observed a strong induction of the iniBAC reporter construct after the addition of the antibiotic, as compared with the non-treated M. marinum cells; fluorescence was 114-fold (EMB) and 121-fold (INH) higher. The induction increased over time and reached a 357-fold difference by day 5 for EMB and 643-fold for INH (Fig. 1A).

FIGURE 1.

FIGURE 1.

The iniBAC operon is induced upon treatment with EMB and INH both in culture and in vitro. A, flow cytometry plots of untreated cultures (black line) compared with cultures treated with ethambutol (red line) and isoniazid (blue line) with the MIC concentration. For each condition 30,000 events are plotted, mean fluorescence intensity is shown on the x axis per the amount of cells (y axis). Induction folds are indicated per day and calculated as treated sample mean fluorescence intensity divided by untreated sample mean fluorescence intensity. B, plots of induction patterns in THP-1 and CLC cells on day 3 after infection. EMB and INH were added 3 hpi. C, induction over time in THP-1 cells and CLC cells, plotted as the percentage of cells that fall into the “mEos3.1 positive” gate. The graph shows the average percentage of induction of three independent experiments. The S.D. values were too small to be displayed. RFI, relative fluorescence intensity.

Next, we tested reporter activity in cell infection experiments. Carp leukocyte cells (CLC) and THP-1 macrophages were infected with M. marinum harboring the iniBAC reporter construct, and analysis of induction kinetics was tracked by flow cytometry. To differentiate between infected and non-infected macrophages and to assess which proportion of the infected cells expressed the iniBAC reporter construct, the red fluorescent protein crimson E2 was constitutively expressed on an episomal construct. We combined this with an integrative version of the stress marker containing the iniB promoter and mEos3.1. As such we could determine which proportion of the total pool of infected, crimson-positive cells was also iniBAC-induced and, thus, mEos3.1 positive. After infection, the phagocytized bacteria were challenged with 1× MIC of EMB or INH, and flow cytometry was used to measure induction of the iniBAC reporter on days 0, 1, 2, and 3. Fig. 1B shows a representative measurement of an experiment performed in triplicate. In THP-1 cells the population of macrophages that contained bacteria with induced iniBAC increased to 41.6% (S.D. 0.4%) on day 3 for ethambutol. Isoniazid showed a faster induction pattern in THP-1 cells with 13.4% (S.D. 0.4%) becoming mEos3.1-positive on day 1, increasing to 38.6% (S.D. 0.7%) on day 3 (Fig. 1, B and C). In CLC infection assays, similar patterns were observed (Fig. 1, B and C).

In summary, the induction of the iniBAC reporter during intracellular infection seems to increase over time but does not seem to affect all bacteria, which was observed in culture. THP-1 cells were also analyzed by confocal imaging on days 1 and 2 (Fig. 2). Confocal imaging confirmed the observations of flow cytometry assays. Moreover, the EMB- and INH-treated macrophages showed a clear pattern of heterogeneity from day 2 onward, coinciding with the significant increase in induction seen by flow cytometry for both antibiotics.

FIGURE 2.

FIGURE 2.

Induction of iniBAC in THP-1 macrophages reveals heterogeneity. A, THP-1 cells 1 day after infection without antibiotics (−), treated with 1 μg/ml EMB or with 10 μg/ml INH. In each panel a representation of three images is shown, where the THP-1 nucleus is stained with DAPI (blue), and M. marinum constitutively expresses CrimsonE2 (red) and conditionally expresses mEos3.1 as a measure for iniBAC induction (green). B, same layout as in A but for day 2 after infection of THP-1 cells.

In conclusion, we have confirmed that M. marinum expresses iniBAC upon treatment with EMB and INH. Furthermore, this induction is observed in culture and in two different cell types using a cell infection assay. However, induction is more variable during cell infection as compared with culture.

Mutations in Vitamin B12 Biosynthesis and the Vitamin B12-dependent mutAB Cause Up-regulation of iniBAC in M. marinum

Next we set out to probe which genes and regulation networks play a role in iniBAC induction. For this, a wild type M. marinum MUSA containing an exosomal variant of the iniBAC stress marker was used as a parent strain to create a transposon library. The resulting mutants were plated out and selected for high fluorescence. Analysis of the transposon insertion site was performed for a total of 50 positive mutants. Strikingly, 32 of the 50 transposons insertions were identified in genes that are responsible for cobalamin synthesis, the so-called cob family genes (Fig. 3A). These genes are part of the set of 25 genes that are required for vitamin B12 biosynthesis in mycobacteria (19). Furthermore, 12 mutants were identified in methylmalonyl-CoA-mutase encoding genes MutAB or in the gene coding for its alleged foldase, meaB (20). The MutAB enzyme plays a role in propionate metabolism, converting (S)-methylmalonyl-CoA, a precursor for methyl-branched lipids, to (R)-methylmalonyl-CoA, which is further processed to succinyl-CoA to enter the tricarboxylic acid or glyoxylate cycle (Fig. 3B). The methyl-branched lipids synthesized from (S)-methylmalonyl-CoA include PDIM, diacyl trehalose/penta-acyl trehalose, and SL-1 (21). MutAB is vitamin B12-dependent, suggesting that the mutants affected in vitamin B12 biosynthesis were most likely identified because of their downstream effect on MutAB. Besides identification of most known cobalamin biosynthesis genes, this screen also confirms that MMAR_4563, is probably coding for the vitamin B12 biosynthesis enzyme CobF (data not shown), and MaeB is indeed functionally linked to MutAB. Other mutants that showed induction, albeit to a lesser extent, include mutations in pks16, mshD, or mas, genes that are all involved in cell wall lipid biosynthesis (Table 1).

FIGURE 3.

FIGURE 3.

Mutants that show a strong up-regulation of iniBAC are in the vitamin B12 biosynthesis pathway or mutAB-associated. A, a pie chart depicts the distribution of mutants that were found in the transposon mutagenesis screen. In total, 50 mutants were analyzed genetically. B, schematic overview of the propionate degradation pathway adjusted from (20). PCC, propionyl-CoA carboxylase; MMCE, methylmalonyl-CoA epimerase; SCS, succinate synthase; MCS, methyl citrate synthase; MCD, methyl citrate dehydratase; ACN, aconitase; MCL, 2-methylisocitrate lyase; PDHC, pyruvate dehydrogenase complex; TCA, tricarboxylic acid.

TABLE 1.

List of M. marinum mutants identified in transposon mutagenesis screen

This table contains an overview of the unique M. marinum mutants that were identified in this study. The H37Rv orthologue, if present, the gene length and the number of unique mutants per gene are indicated.

Gene ID Gene product H37Rv orthologue Gene length Transposon position(s) within gene (bp from 5` of gene)
MMAR_0989 PE_PGRS 3153 2149
MMAR_1350 tetR repressor Rv3208 684 421
MMAR_1768 mas Rv2940c 5616 1173
MMAR_1885 cobB Rv2848 1377 148, 194, 416, 429, 597, 610, 905, 1271, 1290, 1293, 1324
MMAR_2302 mutA Rv1492 1878 14, 225, 427, 1836
MMAR_2303 mutB Rv1493 2262 6, 41, 521, 1095, 1724, 2179
MMAR_2304 meaB Rv1496 1011 204, 379
MMAR_3037 cobN Rv2062c 3573 76, 129, 311, 1486, 3374, 3394
MMAR_3045 cobH Rv2065 627 123
MMAR_3046 cobI Rv2066 1470 256
MMAR_3052 cobK Rv2070c 729 11
MMAR_3053 cobM Rv2071c 740 715
MMAR_3054 cobL Rv2072c 1173 1093
MMAR_3251 cobU Rv0254c 561 75
MMAR_3252 cobT Rv2207 1077 525
MMAR_3307 cobC Rv2231c 1053 273
MMAR_3311 cobD Rv2236c 942 792
MMAR_4476 pks16 Rv1013 1635 652
MMAR_4563 cobF none 744 30, 134, 155, 232, 610
MMAR_4863 mshD Rv0819 963 469, 526
iniBAC Induction in Vitamin B12 Biosynthesis Mutants Can Be Rescued by Exogenous Vitamin B12

To confirm that the effects seen on the induction of the iniBAC stress marker were due to abrogated vitamin B12 biosynthesis, we compared the induction of three mutants, mutA::tn, mshD::tn, and cobN::tn. Without the addition of vitamin B12, both mutA::tn and cobN::tn showed clear expression of mCherry (Fig. 4A). As expected, the cobN transposon mutant clearly reverts from high iniBAC induction to a near background expression level by the addition of 10 μg/ml vitamin B12 (Fig. 4B). We also tested which concentration of vitamin B12 was required to phenotypically complement the cob mutants. Lowering the concentration to <100 ng/ml vitamin B12 abrogated complementation, which was also confirmed by flow cytometry (data not shown). Because usually only trace amounts of vitamin B12 are required, this means that M. marinum does not efficiently transport vitamin B12 under these conditions. The other two mutants, mutA::tn and mshD::tn, were unaffected by the addition of vitamin B12, as confirmed by fluorescence microscopy (data not shown).

FIGURE 4.

FIGURE 4.

M. marinum deficient in vitamin B12 production can be complemented by the addition of exogenous vitamin B12 in vitro. A, mutants mutA::tn, mshD::tn, and cobN::tn compared with a WT M. marinum containing the pSMT3-iniB4-mCherry and WT M. marinum without the addition of vitamin B12 on the plate. B, the same mutations when exposed to 10 μg/ml vitamin B12 (cyanocobalamin). Genetic complementation (C) was also performed by introduction of an integrative vector containing an intact copy of the mutated genes. C, the resulting strains were analyzed in triplicate by flow cytometry and are compared in mean fluorescence induction (MFI) to their mutant counterparts.

Besides complementation with vitamin B12, a genetic complementation was also performed for three mutants, i.e. cobB::tn, mshD::tn, and mutA::tn. The resulting complementing strains were analyzed by flow cytometry for fluorescence induction of the stress marker as compared with their mutant parent strain. This confirmed that complementation of cobB::tn and mshD::tn was achieved by introducing an intact copy of the respective gene (Fig. 4C). The mutA::tn mutant did not complement when only mutA was reintroduced in the mutant strain, suggesting that the transposon mutant we obtained in mutA likely also disturbs expression of the downstream genes mutB and MMAR_2304 (meaB orthologue). Complementation was achieved when we introduced mutA, mutB, and MMAR_2304, as fluorescence induction was restored to wild type levels.

Addition of Acetic Acid or Propionic Acid to Transposon Mutants in mutA or cobB Does Not Affect Viability or iniBAC Induction

To assess whether we could find the metabolic cue that induces iniBAC, we performed an experiment on HdB minimal medium plates containing only acetic acid, propionic acid, or valeric acid as carbon source. Because acetic acid and propionic acid are both major players in the pathways in which MutAB operates, we suspected that the addition of these fatty acids could influence either bacterial growth of some of our mutants or iniBAC induction. Glucose and glycerol served as a growth control. However, we did not observe any significant growth differences upon the addition of 0.1% acetic acid, propionic acid, or valeric acid when comparing a cobB::tn and mutA::tn mutant versus a WT M. marinum (Fig. 5A). We also analyzed the iniBAC induction of the bacteria that grew on these plates by flow cytometry. Also in this experiment, we did not observe any significant changes in induction (Fig. 5B). These results suggest that the induction of the iniBAC operon is probably not dependent directly on the level of metabolic intermediates or fluxes in the routes outlined in Fig. 3.

FIGURE 5.

FIGURE 5.

The addition of acetic acid, propionic acid, and valeric acid to M. marinum WT and cobB::tn and mutA::tn mutants shows no obvious effect on bacterial viability. A, the left row indicates the bacterial fold dilution, and below each panel the corresponding carbon source and concentration are denoted. B, flow cytometry was performed to quantify the induction on glucose, acetic acid, and propionic acid.

Analysis of M. marinum Mutants in Vivo Reveals a Temporary iniBAC Induction Phenotype Independent of Vitamin B12 Availability

To assess whether vitamin B12 availability can complement the cob mutants in vivo, three different mutants (cobN::tn, mutA::tn, and mshD::tn) were selected for analysis in a zebrafish embryo hindbrain infection model using WT as a control. All four strains contained a constitutive, integrated hsp60-mEos3.1 for visualization of infection and an episomal version of the mCherry iniB stress marker. After 24 h of infection, a homogeneous induction of iniBAC was seen for all three mutants, indicating that the induction has not changed in this period of time (Fig. 6), which is not unexpected because the bacteria were already highly expressing mCherry and the protein is relatively stable. However, after 120 h post infection (hpi), a clear reduction of mCherry was observed in all three mutants, whereas the green fluorescent signal, i.e. mEos3.1, was still present or even increased.

FIGURE 6.

FIGURE 6.

iniBAC induction of transposon mutants in mutA, cobN, and mshD is transient and decreases over time. Confocal images of zebrafish embryos infected with WT M. marinum MUSA, mutA::tn, cobN::tn, or mshD::tn containing a plasmid pmv-hsp60-mEos3.1 and piniB-mCherry. Zebrafish were injected in the hindbrain ventricle and fixated in PFA. The top panel shows an fluorescence induction overlay of mCherry (stress marker) and mEos3.1 (total infection) for 24 hpi, whereas the lower panel shows this for time point 120 hpi.

In summary, we show that iniBAC induction is declining in vivo, with virtually no induction after 120 h. The decrease in induction was seen for all tested mutants and, therefore, seems to be independent of vitamin B12 availability.

Mutants in mutA and cobB Have Decreased Levels of Methyl-branched Lipids PDIM and PGL

Because MutAB mediates the isomerization of (R)-methyl-malonyl-CoA to succinyl-CoA, we hypothesized that a mutA transposon mutant could have an excess amount of (R)-methylmalonyl-CoA. Consequently, this could influence the amount of methyl-branched lipids that are synthesized, such as PGLs/PDIMs (Fig. 3B). To assess whether this was the case, we performed TLC analysis to detect both PDIM and PGL variants for WT MUSA and transposon mutants in genes mas, mutA, and cobB. Strikingly, when comparing the amount of PDIMs of the mutA and cobB transposon mutants, a significant reduction in PDIM types A, B, and C can be distinguished (Fig. 7A). This reduction is phenotypically similar to a mas transposon mutant, which is known to be strongly affected in PDIM production (22). Moreover, PGL production was also severely decreased in mutA::tn and cobB::tn compared with WT, whereas the mas mutant, as expected, showed a null phenotype for this lipid (Fig. 7B). In conclusion, abrogation of vitamin B12 biosynthesis or mutation of mutAB caused a decrease in methyl-branched lipids PGL and PDIM in M. marinum.

FIGURE 7.

FIGURE 7.

Lipid analysis reveals differences in PDIM levels in mutA::tn and cobB::tn mutants. A, after isolation of apolar lipids, the presence of PDIMs was analyzed by two-dimensional TLC. For the first dimension phosphatidylethanolamine (PE):ethyl ether (98:2) was used, and for two-dimensional PE:acetone(98:2) was used. Molybdophosphoric acid was used as a coloring agent. The presence of different PDIM types A, B, and C is indicated with black arrows. The figure compares WT MUSA to transposon mutants in mas, cobB, and mutA. B, the presence of PGL was analyzed by one-dimensional TLC. As a solvent, chloroform:methanol (90:10) was used. Orcinol was used as a coloring agent.

The Antibiotic Susceptibility of mutAB and cobB Mutants to First-line Antibiotics Is Unchanged

To see whether the mutations that induce iniBAC are also changed in antibiotic susceptibility, we determined the MIC values of mutA::tn, mutB::tn, mshD::tn, and cobB::tn upon exposure to five first-line antibiotics. There were no differences observed for the four mutants tested, indicating that, although differences in PDIM and PGL can be seen for mutA::tn and cobB::tn, this does not seem to affect antibiotic susceptibility (Table 2). This finding seems to contradict the previously published results by Colangeli et al. (13), where they stated that up-regulation of iniA in M. tuberculosis caused a moderate but significantly increased resistance phenotype against ethambutol.

TABLE 2.

MIC determination on M. marinum mutants shows no change in antibiotic susceptibility

Measurements were performed in triplicate. The concentration at which no visible growth was seen is denoted as the MIC value in μg/ml. For the triplicate measurements, three identical values were found. As such, the S.D. is zero and, therefore, not written behind the values in the table.

Strain Rifampicin Ethambutol Isoniazid Streptomycin Ciprofloxacin
μg/ml μg/ml μg/ml μg/ml μg/ml
WT 0.32 1.6 32 4 4
mutA::tn 0.32 0.8 32 4 4
mutB::tn 0.32 0.8 32 4 4
cobB::tn 0.32 0.8 32 4 4
mshD::tn 0.32 0.8 32 4 4
The Induction of iniBAC Is Not Caused by General Cell Wall Stress

The array of mutants that show an increased induction of the iniBAC operon seem to revolve around methyl-branched lipid biosynthesis. To see whether a defect in lipid biosynthesis and cell envelope integrity in general would also cause induction of the operon, we transformed a kasB::tn mutant, a mutant known to produce truncated mycolic acids, with the iniBAC stress marker (23). This mutant shows reduced growth and is attenuated in zebrafish embryos.3 Comparison of induction on plate to a mutA::tn and mshD::tn mutant revealed that the kasB::tn mutant does not seem to be highly induced on plate (data not shown).

Subsequent analysis by flow cytometry revealed that the iniBAC operon is indeed only 1.4-fold induced in this mutant, comparable with a mshD::tn mutant, whereas a mutA transposon mutant showed a 14.2-fold induction compared with a WT expressing the stress marker (Fig. 8). Therefore, not all genes that cause cell wall alterations contribute equally to the induction of the iniBAC operon.

FIGURE 8.

FIGURE 8.

A flow cytometry plot analyzing the iniBAC expression of the transposon mutants in kasB (in blue), mshD (in green), and mutA (in red) versus a WT M. marinum (in black) harboring the stress marker construct with mCherry.

Mutants in PDIM Biosynthesis Operon Show Induction of iniBAC in M. bovis BCG

Although most genes coding for vitamin B12 biosynthesis enzymes are present in species belonging to the M. tuberculosis complex, research by Warner et al. (24) has shown that M. tuberculosis does not seem produce vitamin B12 in vitro. This bacterium, therefore, seems to depend on the import of exogenous vitamin B12 (24, 25).

Because of this difference, we wondered what genes would affect iniBAC induction in these species. To explore this, we created a transposon mutant library in an M. bovis BCG Copenhagen strain containing the iniBAC stress reporter. In total, we identified 29 mutants that showed a high induction of the stress reporter. Genetic analysis of these mutants showed that we did not obtain any transposon insertion in genes involved in the vitamin B12 biosynthesis pathway, as expected. Most of these mutants were affected in the PDIM biosynthesis operon, including tesA, ppsB-E, papA5, and mas, similar to what had been found for M. marinum. A list of the unique mutants identified in this screen can be found in Table 3.

TABLE 3.

List of M. bovis BCG mutants identified in transposon mutagenesis screen

Table containing unique mutants that were found, with their H37Rv gene ID and gene length. Genes that are part of the PDIM biosynthesis cluster are shown in bold.

Gene ID Gene product H37Rv orthologue Gene length Transposon position(s) within gene (bp from 5` of gene)
Mb0016c pbpA Rv0016c 1476 252, 652, 995
Mb0673 Carotenoid oxygenase Rv0654 1506 178
Mb1041 pks16 Rv1013 1635 538
Mb1069c PE protein Rv1040c 828 260
Mb1445c MFS transporter Rv1410c 1557 661
Mb1951c PPE34 Rv1917 4380 942
Mb2370 lppQ Rv2341 420 8
Mb2720c suhB Rv2701c 873 340
Mb2953 tesA Rv2928 786 96
Mb2956 ppsB Rv2932 4617 330, 1385, 3528
Mb2958 ppsC Rv2933 6567 2764, 3227
Mb2959 ppsD Rv2934 5484 244, 903, 1370, 5342
Mb2960 ppsE Rv2935 4467 1370, 4172
Mb2964 papA5 Rv2939 1269 99, 361
Mb2965c mas Rv2940c 6336 778, 1400, 3259
Mb3024 lppY Rv2999 966 877

To determine whether these mutations had an effect on bacterial viability, MIC values for five first-line antibiotics were determined for the M. bovis BCG transposon mutants papA5::tn and mas::tn. Both mutants were compared with their WT parent strain harboring the stress marker. No differences of >2-fold were observed when comparing mutant to parent, again indicating that there is no correlation between iniBAC up-regulation and antibiotic susceptibility (Table 4), as was also observed in M. marinum. Together, these data show that mutants in two different mycobacterial species mutations or changes in PDIM biosynthesis induce the iniBAC operon, further supporting the link between iniBAC induction and the biosynthesis of methyl-branched lipids.

TABLE 4.

MIC values for the M. bovis BCG mutants

MIC values for a papA5::tn mutant and the parent WT strain with pSMT3-piniB-mCherry (WT-B) and mas::tn mutant with its WT parent strain containing the stress marker pSMT3-piniB4-mCherry (WT-B4). Measurements were done in triplicate. For the triplicate measurements, three identical values were found. As such, the S.D. is zero and therefore not written behind the values in the table.

Strain Rifampicin Ethambutol Isoniazid Streptomycin Ciprofloxacin
μg/ml μg/ml μg/ml μg/ml μg/ml
WT-B 0.0008 2 0.5 0.45 0.25
papA5::tn 0.0016 2 0.5 0.27 0.25
WT-B4 0.01 2 0.5 0.45 0.25
mas::tn 0.005 2 0.5 0.45 0.25

Discussion

In this work we show that the induction of the iniBAC operon as a result of EMB or INH treatment takes place both in cultured M. marinum and in intracellular bacteria, confirming previous observations of iniBAC induction in Mycobacterium smegmatis and M. bovis BCG by Alland et al. (12). We also show that the induction seems to be heterogeneous within THP-1 macrophages. Heterogeneity upon antibiotic treatment is a phenomenon that is well known for mycobacteria, and this phenotype plays an important role in patient treatment outcomes (9). Therefore, the observed variation in iniBAC induction underlines the importance of studying antibiotic response networks.

Previously, induction of the iniBAC operon was defined as a general cell wall stress operon that was induced upon the addition of cell wall biogenesis antibiotics EMB and INH (12, 13). In this study we show that the induction of iniBAC seems to be more specific and linked to the biosynthesis of methyl-branched lipids. M. marinum transposon mutants in mutAB or cob genes responsible for vitamin B12 biosynthesis caused strong induction of iniBAC. Moreover, these strains showed a strong decrease in the amount of PDIM and PGL lipids but no altered antibiotic susceptibility. Interestingly, in M. bovis BCG, mutations in the PDIM biosynthesis operon cause induction of the iniBAC operon and, therefore, point to a similar induction signal as the PDIM-deprived M. marinum transposon mutants.

One theory that could explain why the iniBAC operon is highly induced in both species is that one of the lipid precursors (S)-methylmalonyl-CoA, (R)-methylmalonyl-CoA, or propionyl-CoA accumulates. Mycobacteria are highly sensitive to increases in the pool of intermediates of fatty acids but also propionyl-CoA and propionyl-CoA itself. High levels of propionyl-CoA have been found to be toxic unless detoxified by the methyl citrate cycle (26). Because the methyl citrate cycle is intact in the iniBAC-inducing mutants, the accumulation of (S)-methylmalonyl-CoA or (R)-methylmalonyl seem to be the most likely accumulating candidates. In M. marinum, prevention of conversion of (R)-methylmalonyl-CoA to succinyl-CoA causes induction of the iniBAC operon, whereas M. bovis BCG probably does not have MutAB activity in culture due to an incomplete vitamin B12 biosynthesis pathway. Subsequently, M. marinum shows lowered PDIM levels upon mutations in the methyl-malonyl pathway, and M. bovis BCG shows induction of the operon when PDIM biosynthesis is disturbed, possibly leading to accumulation of a toxic intermediate. When we assessed growth of WT M. marinum and its isogenic cobB::tn and mutA::tn mutants on minimal medium, there was no clear difference in growth or iniBAC induction for any of the carbon sources used. This suggests that metabolites of the different pathways indicated in Fig. 3 do not seem to play a direct role in iniBAC stress.

Another hypothesis is that a misbalance occurs between the methyl-malonyl pathway because of disturbance of outflow due to mutations in PDIM biosynthesis or blocking of MutAB and the methyl citrate cycle. This is supported by work from Lee et al. (27), where it was found that the relative abundance of acetyl-CoA determined the toxicity of propionyl-CoA or its three-carbon intermediates. Because in M. marinum both pathways are constitutively active in vitro, a blockade can lead to an overflow of the methyl-citrate cycle and may cause iniBAC induction. The iniBAC operon might be involved in rescuing the bacterium from these otherwise toxic intermediates. It seems that the outflow of possibly accumulated (S)-methylmalonyl-CoA and (R)-methylmalonyl-CoA is not simply managed by conversion to methyl-branched lipids. As we did not assess the relative balance of these two intermediates, it might be worthwhile to investigate the relative abundance of acetyl-CoA and propionyl-CoA by metabolomics. Surprisingly, the M. marinum mutAB mutants have lower PGL and PDIM levels, confirming research by Jain et al. (28) who showed that a mutAB overexpression strain has increased PDIM levels. Therefore, a regulation pathway may be in place that reduces the methylmalonyl pathway when toxic metabolites in this cycle reach a certain threshold. Alternatively, another unidentified outflow of these metabolites is present, as some of these enzymes in the pathway are duplicated in M. marinum.

The function of the iniBAC operon has been previously addressed by Colangeli et al. (13). They predicted that IniA might serve as an efflux pump that leads to tolerance to EMB and INH treatment (13). We also tested this hypothesis using our overexpression mutants. In our system iniBAC overexpression took place under more natural conditions and, therefore, possibly included overexpression of accessory genes that have not been identified yet. Based on the antibiotic susceptibility assays with high expressing iniBAC mutants in M. marinum and M. bovis BCG, we notice that induction of the operon did not alter antibiotic susceptibility. Our results, therefore, do not support the hypothesis that this operon forms an efflux pump that influences bacterial resistance to EMB and INH.

In line with this, sequence analysis shows that both iniA and iniC contain a GTPase domain that shows a high similarity to dynamin family proteins. This suggests that these proteins might have a function that allows them to vesiculate possible toxic intermediates. Bacterial dynamin-like proteins (DLPs) have first been discovered in a cyanobacterium, Nostoc punctiforme (29). It was shown that an N. punctiforme DLP could form tubulations in lipid bilayers and facilitate both fission and fusion of vesicles in a GTP-dependent manner (30). More recently, E. coli has been shown to contain a triplet of DLPs, leoABC, that mediate toxin release via membrane vesicles. It is worth noting that bacterial DLPs are often found in tandem, like E. coli leoA and leoC, and mycobacterial iniA and iniC (31). It is tempting to hypothesize that the iniBAC genes are dynamin-like proteins that allow vesiculation of toxic molecules in mycobacteria, and this is definitely something that future research can address. Recently, it has been suggested that DLP of Bacillus subtilis is involved in membrane stress (32). Perhaps overproduction of some mycobacterial lipids, such as PDIM, could also trigger membrane stress.

In this work we established that M. marinum produces vitamin B12 in vitro and that MMAR_4563 is indeed a functional gene in this biosynthesis route, as previously suggested by Weerdenburg et al. (33). Therefore, we propose to call this gene cobF. The vitamin B12 mutants that we identified seem to have reduced PDIM levels. Although we did not confirm reversion of PDIM levels upon vitamin B12 supplementation by TLC, we assume that this is the case. Because PDIMs are important for virulence in mycobacteria (34), this may suggest a direct link between vitamin B12 biosynthesis, cell homeostasis, and virulence. Evidence for the effect of vitamin B12 homeostasis and virulence was presented by Weerdenburg et al. (33), where it was shown that mutations in the vitamin B12 biosynthesis genes caused an increased fitness for M. marinum in Acanthamoeba infection experiments. Although there are two enzymes in M. marinum that need vitamin B12 as a cofactor, methionine synthase MetH and methylmalonyl-CoA mutase MutAB (24, 25), based on our results the absence of MutAB could explain the observed virulence effects because the mycobacterial lipid profile is altered. In this paper and a previous study by Gopinath et al. (25), it was shown that mycobacteria are able to take up vitamin B12 in vitro. Because vitamin B12 is present in the host (35), there is a reservoir for vitamin B12 that can be scavenged during infection, thereby altering lipid expression.

Although our in vivo experiments show that iniBAC induction is absent after 120 hpi independent of vitamin B12 availability, we cannot rule out that vitamin B12 plays a role in vivo. In light of this we find it interesting that both mutA::tn and cobN::tn mutants showed a significantly milder infection phenotype than mshD::tn and WT M. marinum, indicating that abrogation of the MutAB pathway or vitamin B12 biosynthesis may influence the outcome of infection.

Future experiments should be performed to elucidate the role of the iniBAC genes in EMB and INH-induced stress. Most importantly, the possibility that iniBAC plays a role in coping with toxic intermediates may very well lead to the identification of novel therapeutic targets that allow potentiation of current mycobacterial drug therapy.

Experimental Procedures

Bacterial Strains and Culturing Conditions

E. coli strain DH5α was used to for cloning and propagation of plasmid DNA. Cultures were grown at 37 °C in LB broth with the addition of antibiotics hygromycin B (50 μg/ml), kanamycin (25 μg/ml), or streptomycin (30 μg/ml) where necessary.

M. marinum wild type MUSA (36) was used as a basis for mycobacterial experiments, and mutants were derived from this parent strain. M. marinum MUSA and M. bovis BCG Copenhagen were used for transposon mutagenesis experiments. Cultures were grown in Middlebrook 7H9 liquid medium supplemented with Middlebrook ADC and 0.05% Tween 80 with the addition of the aforementioned antibiotic concentrations when required. Additional antibiotics isoniazid (Sigma) and ethambutol (Sigma) were routinely added to log-phase cultures at the indicated final concentrations. Cyanocobalamin (Sigma) was added where indicated at a concentration of 10 μg/ml. Middlebrook 7H10 solid agar supplemented with Middlebrook OADC was used for bacterial plating. Both cultures and plates were grown at 30 °C. Sauton plates were prepared according to a protocol published by D. W. Allen (37). Human monocytic cell line THP-1 and carp leukocyte cell line CLC were cultured in RPMI 1640 supplemented with 10% fetal bovine serum (Gibco) and Glutamax (Gibco). THP-1 cells were grown in 37 °C with 5% CO2, whereas CLCs were grown at 30 °C with 5% CO2.

Construction of Plasmids

All plasmids used in this study are listed in Table 5, whereas all primers used in this study can be found in Table 6. Anchored primers containing either an XbaI site or BamHI site were used to amplify a 588-bp fragment that included the iniB promoter from M. marinum MUSA genomic DNA. The resulting product and a pAL5000 derivative containing pSMT3-hsp60-mCherry (38) were both digested with XbaI and BamHI, mixed, and ligated, resulting in pSMT3-piniB-mCherry. A 3′ promoter truncation was created as described by Alland et al. (12) by modeling the M. bovis BCG promoter sequence onto the M. marinum MUSA promoter sequence. Anchored primers containing an XbaI site for the 5′ primer and BamHI site for the 3′ primer were used to amplify a 211-bp fragment from M. marinum MUSA genomic DNA. The insert and pAL5000 derivative were digested with XbaI and BamHI, mixed, and ligated, creating pSMT3-piniB4-mCherry. Subsequently, GFP variant mEos3.1 (39) was amplified with anchored primers (BamHI for the 5′ primer and BsrGI for the 3′ primer) and subsequently digested together with pSMT3-piniB4-mCherry with BamHI and BsrGI creating pSMT3-piniB4-mEos3.1. Integrative plasmids were derived from pMV361, and all integrative constructs were created with InFusion (Clontech) cloning (40). The insert piniB4-mEos3.1 was amplified from pSMT3-piniB4-mEos3.1 and cloned via InFusion into a promoterless version of pMV361 that was digested with PmlI and NsiI creating pMV-piniB4-mEos3.1. A previously constructed variant pMV-hsp60-mEos3.1 (41) was digested with NheI and ClaI to serve as a backbone for complementation constructs pMV-hsp60-cobB and pMV-hsp60-mshD. Both cobB and mshD were amplified from M. marinum MUSA genomic DNA and cloned into the digested vector with InFusion to create pMV-hsp60-cobB and pMV-hsp60-mshD, respectively. The aforementioned promoterless version of pMV361 was digested with HindIII to introduce mutA and mutAB+MMAR_2304 to create pMV-mutA and pMV-mutAB-MMAR_2304.

TABLE 5.

List of plasmids used in this study

Name Features Source
pSMT3-hsp60-mCherry hsp60 promoter, mCherry, hygR (38)
pSMT3-piniB-mCherry iniB promoter, mCherry, hygR This study
pSMT3-piniB4-mCherry Truncated iniB promoter, mCherry, hygR This study
pSMT3-piniB4-mEos3.1 Truncated iniB promoter, mEos3.1, hygR This study
pMV361 hsp60 promoter, L5 attP and aph, oriE, strR (40)
pMV-piniB4-mEos3.1 Truncated iniB promoter, mEos3.1, L5 attP and aph, oriE, strR This study
pMV-hsp60-mEos3.1 hsp60 promoter, mEos3.1, L5 attP and aph, oriE, strR (41)
pMV-hsp60-cobB hsp60 promoter, cobB, L5 attP and aph, oriE, strR This study
pMV-hsp60-mshD hsp60 promoter, mshD, L5 attP and aph, oriE, strR This study
pMV361-nohsp60 L5 attP and aph, oriE, strR This study
pMV-mutA mutA, L5 attP and aph, oriE, strR This study
pMV-mutAB-MMAR_2304 mutA, mutB, MMAR_2304, L5 attP and aph, oriE, strR This study
pTEC19-MSP-crimsonE2 msp promoter, crimsonE2, hygR Addgene
TABLE 6.

List of primers used this study

Name Sequence (5` → 3`)
iniB-FW TTCTAGAACTCGTTCTCGCCGCATGTT
iniB-RV TTTGGATCCTTGTCCCTTCAATCGAATGT
iniB4-FW TTTTTCTAGACGTCATTGGTGTTTGACGTGCAGA
iniB4-RV TTTTGGATCCTTGTTCGCCGAAACGACCGGCGCTC
iniB4mEos-FW TTTTGGATCCGAGGAATCACGCTAGCATGA
iniB4mEos-RV TTTTTGTACACCTTATCGTCTGGCATTGTC
pmv-hsp60mEos-FW GAACCACTTAATTAACTTGTTGTCGTTGGCGGTCA
pmv-hsp60mEos-RV TTAATATTCCATCACTTATCGTCTGGCATTGTCAG
pmv-B4-mEos-FW GAACCACTTAATTAACGTCATTGGTGTTTGACGTGC
pmv-B4-mEos-RV TTAATATTCCATCACTTATCGTCTGGCATTGTCAG
pmv-cobB-FW GAGGAATCACGCTAGCGGTGACGGCAAGGGCAAG
pmv-cobB-RV ACTACGTCGACATCGATAGTGGTGACCGCCAGCG
pmv-mutA-FW CGACATCGATAAGCTGCTGTCACAATCACCCAGAGT
pmv-mutA-RV AGGTTAATTAAAGCTCTACGCTCCCAACCGCG
pmv-mshD-FW GAGGAATCACGCTAGCGTGACGGCGGTGCAATGG
pmv-mshD-FW ACTACGTCGACATCGATCTAGGCCAACGCCGCG
pmv-mutAB2304-FW CGACATCGATAAGCTCACGGTGCTGACCTTGCG
pmv-mutAB2304-RV AGGTTAATTAAAGCTATTGACTCCGATGTCTACCGTCAC
Transposon Mutagenesis

Transposon mutagenesis was performed in M. marinum MUSA and M. bovis BCG Copenhagen, both containing pSMT3-piniB4-mCherry. Both strains were infected with the mycobacterial phage phiMycoMarT7 that contains the Himar 1 transposon (42). Transposon mutants were assessed for increased mCherry expression, indicating induction of iniBAC by fluorescence microscopy. Colonies that showed a vast increase in fluorescence were isolated, and the transposon insertion site was determined by ligation-mediated PCR as described previously (36).

Flow Cytometry Analysis

The induction of the iniBAC was assessed by flow cytometry. Bacteria were grown to an A600 of 0.3, and antibiotics were added at the indicated concentrations for a specified amount of time. For each time point, 1 ml was culture was collected by centrifugation and washed with PBS with 0.05% Tween 80. The bacterial pellet was collected by centrifugation, and bacterial cells were resuspended in PBS containing 0.05% Tween 80 and subsequently analyzed on a BD Accuri C6 flow cytometer (BD Biosciences) equipped with a 488-nm laser and 585/40-nm filter for mEos3.1 and a 640 laser and 675/25 filter to detect CrimsonE2. In total, 30,000 gated events were collected per sample per time point, and data were analyzed using BD CFlow software.

M. marinum MUSA Infection of THP-1 Cells and CLCs

For infection of THP-1 and CLCs, 1 × 107 cells per well were seeded in 100-mm plates (Corning) and grown for 24 h. THP-1 monocytes were differentiated for 48 h by the addition of 25 ng/ml phorbol 12-myristate 13-acetate (Sigma). M. marinum containing plasmid MSP-Crimson alone and a strain with both MSP-crimson and integrative construct pMV-piniB4-mEos3.1 were grown to an A600 of 0.8 and washed in RPMI 1640 previous to infection. Bacterial cells were subsequently added at a multiplicity of infection of 5. THP-1 cells were incubated at 33 °C and CLCs at 30 °C. After three h, extracellular mycobacteria were removed by washing 3 times with RPMI 1640. Amikacin was added to a concentration of 200 μg/ml for 3 h to kill any remaining extracellular mycobacterial cells. This point was considered time point 0 h, and cells were subsequently harvested at 0, 24, 48, and 72 hpi. THP-1 and CLC cells were both collected by the addition of 1× Accutase® (Sigma). Infected cells were spun down at 1000 rpm and washed with RPMI 1640 and resuspended in PBS for flow cytometry analysis. For confocal analysis, cells were fixated in 4% PFA in PBS, washed in PBS, and spun down on a coverslip using a cytospin. Vectashield (Vector Laboratories) with DAPI was added on the coverslip, and cells were subsequently analyzed with a Leica TCS SP8 confocal microscope.

Sole Carbon Source Experiments on HdB Plates

HdB plates were prepared as previously described by Hartman and De Bont (44). Acetic acid, propionic acid, and valeric acid (Sigma) were dissolved by sonification in HdB medium containing 0.02% tyloxapol to an end concentration of 0.1%. Glucose was added to a final concentration of 1%, and a plate with no carbon source was taken along as growth control. Bacterial cells were washed 3× in PBS containing 0.02% tyloxapol and subsequently 3 μl of 10-fold dilutions of WT M. marinum, and transposon mutants in cobB and mutA were added to the plates. Plates were incubated for 14 days and imaged to visualize bacterial growth. Flow cytometry was performed by resuspending the resulting bacterial colonies in PBS plus 0.05% Tween.

Infection of Zebrafish Embryos

To visualize M. marinum in zebrafish embryos, pMV-hsp60-mEos3.1 was introduced in M. marinum MUSA strains that already contained the stress marker construct pSMT3-piniB4-mCherry. Zebrafish embryos were injected with 2000 cfus by microinjection in the hindbrain ventricle as previously described (45, 46). Infection was monitored at specified times by means of fluorescence microscopy. For confocal analysis, zebrafish embryos were fixated in 4% paraformaldehyde dissolved in PBS for 24 h and subsequently stored in 0.5% paraformaldehyde. For confocal microscopy, zebrafish were immobilized in 1% low melting point agarose in PBS and imaged with a Leica TCS SP8 confocal microscope.

Mycobacterial Lipids Extraction and TLC Analysis

M. marinum transposon mutants mas::tn, cobB::tn, and mutA::tn were grown to an A600 of 1.0. Then, 50 absorbance units were collected by centrifugation and washed three times with PBS. The extraction of the cell envelope lipids was performed in three steps to harvest the apolar, polar, and mycolic acid lipid fractions as previously described (47, 48). Both apolar and polar lipid fractions were analyzed with two-dimensional TLC for PDIM and the LOS lipid contents system A and system E, respectively, as earlier described by Besra (43). Briefly, equal amounts of lipid fractions were spotted on silica-60 TLC plates (Merck) and separated by a two-dimensional TLC system A (one-dimensional, petroleum ether:ethyl acetate 98/2 (v/v); two-dimensional, petroleum ether:acetone 98/2 (v/v)) and system E (one-dimensional, chloroform:methanol:H2O 60/30/6 (v/v/v) and two-dimensional, chloroform:acetic acid:methanol:H2O 40/25/3/6 (v/v/v/v)). Subsequently, the lipids were visualized by addition of 5% molybdophosphoric acid in methanol (for PDIM analysis) or 0.2 g of orcinol in 100 ml of 20% H2SO4 coloring agents (for LOS analysis). Lipid contents were visualized by TLC-plate charring at 150 °C for 10 min.

Antibiotic Susceptibility Assay

Both M. marinum and M. bovis BCG transposon mutants were grown in 7H9 supplemented with ADC to an A600 of 0.6–1. Subsequently 104 cells were distributed per well in a 96-well plate, and serial 2-fold dilutions of ciprofloxacin, ethambutol, isoniazid, streptomycin, and rifampicin were added (Sigma). The MIC was determined as the concentration of antibiotics that inhibited visible growth. Wells without the addition of antibiotics were used as a growth control, and experiments were performed at least in triplicate.

Author Contributions

W. B. and M. B. conceived and designed the experiments. M. S., R. v d W., K. K. J., A. S, S. C., and M. B. performed the experiments. W. B. and M. B. analyzed the data. W. B. and M. B. wrote the paper.

Acknowledgments

We thank Astrid M. van der Sar, Christina M. J. E. Vandenbroucke-Grauls, and Ben J. Appelmelk for fruitful discussions. We thank Janneke J. Maaskant, Jeroen Kole, and René J. P. Musters for technical assistance.

*

This work has received funding from the Innovative Medicines Initiative Joint Undertaking, resources of which are composed of financial contributions from the European Union's Seventh Frame-work Programme (FP7/2007–2013) and EFPIA (European Federation of Pharmaceutical Industries and Associations) companies (imi (Innovative Medicines Initiative)), under Grant 115337. This work has also received funding from the Joint Programme Initiative AMR programme noTBsec. The authors declare that they have no conflicts of interest with the contents of this article

3

E. Stoop, G. van den Brink, A. van der Sar, and W. Bitter, unpublished results.

2
The abbreviations used are:
EMB
ethambutol
INH
isoniazid
CLC
carp leukocyte cell
PDIM
phthiocerol dimycocerosate
MIC
minimal inhibitory concentration
hpi
hours post infection
DLP
dynamin-like protein.

References

  • 1. World Health Organization (2013) Global Tuberculosis Report 2013
  • 2. Mitnick C. D., Shin S. S., Seung K. J., Rich M. L., Atwood S. S., Furin J. J., Fitzmaurice G. M., Alcantara Viru F. A., Appleton S. C., Bayona J. N., Bonilla C. A., Chalco K., Choi S., Franke M. F., and Fraser H. S. (2008) Comprehensive treatment of extensively drug-resistant tuberculosis. N. Engl. J. Med. 359, 563–574 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Brennan P. J., and Nikaido H. (1995) The envelope of mycobacteria. Annu. Rev. Biochem. 64, 29–63 [DOI] [PubMed] [Google Scholar]
  • 4. Belanger A. E., Besra G. S., Ford M. E., Mikusová K., Belisle J. T., Brennan P. J., and Inamine J. M. (1996) The embAB genes of Mycobacterium avium encode an arabinosyl transferase involved in cell wall arabinan biosynthesis that is the target for the antimycobacterial drug ethambutol. Proc. Natl. Acad. Sci. U.S.A. 93, 11919–11924 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Vilchèze C., and Jacobs W. R. (2007) The mechanism of isoniazid killing: clarity through the scope of genetics. Annu. Rev. Microbiol. 61, 35–50 [DOI] [PubMed] [Google Scholar]
  • 6. Winder F. G., and Collins P. B. (1970) Inhibition by isoniazid of synthesis of mycolic acids in Mycobacterium tuberculosis. J. Gen. Microbiol. 63, 41–48 [DOI] [PubMed] [Google Scholar]
  • 7. Kieser K. J., Baranowski C., Chao M. C., Long J. E., Sassetti C. M., Waldor M. K., Sacchettini J. C., Ioerger T. R., and Rubin E. J. (2015) Peptidoglycan synthesis in Mycobacterium tuberculosis is organized into networks with varying drug susceptibility. Proc. Natl. Acad. Sci. U.S.A. 112, 13087–13092 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Stanley S. A., Kawate T., Iwase N., Shimizu M., Clatworthy A. E., Kazyanskaya E., Sacchettini J. C., Ioerger T. R., Siddiqi N. A., Minami S., Aquadro J. A., Grant S. S., Rubin E. J., and Hung D. T. (2013) Diarylcoumarins inhibit mycolic acid biosynthesis and kill Mycobacterium tuberculosis by targeting FadD32. Proc. Natl. Acad. Sci. U.S.A. 110, 11565–11570 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Liu Q., Via L. E., Luo T., Liang L., Liu X., Wu S., Shen Q., Wei W., Ruan X., Yuan X., Zhang G., Barry C. E. 3rd, and Gao Q. (2015) Within patient microevolution of Mycobacterium tuberculosis correlates with heterogeneous responses to treatment. Sci. Rep. 5, 17507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Wilson M., DeRisi J., Kristensen H. H., Imboden P., Rane S., Brown P. O., and Schoolnik G. K. (1999) Exploring drug-induced alterations in gene expression in Mycobacterium tuberculosis by microarray hybridization. Proc. Natl. Acad. Sci. U.S.A. 96, 12833–12838 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Alland D., Kramnik I., Weisbrod T. R., Otsubo L., Cerny R., Miller L. P., Jacobs W. R. Jr., and Bloom B. R. (1998) Identification of differentially expressed mRNA in prokaryotic organisms by customized amplification libraries (DECAL): The effect of isoniazid on gene expression in Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. U.S.A. 95, 13227–13232 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Alland D., Steyn A. J., Weisbrod T., Aldrich K., and Jacobs W. R. Jr. (2000) Characterization of the Mycobacterium tuberculosis iniBAC promoter, a promoter that responds to cell wall biosynthesis inhibition. J. Bacteriol. 182, 1802–1811 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Colangeli R., Helb D., Sridharan S., Sun J., Varma-Basil M., Hazbón M. H., Harbacheuski R., Megjugorac N. J., Jacobs W. R. Jr., Holzenburg A., Sacchettini J. C., and Alland D. (2005) The Mycobacterium tuberculosis iniA gene is essential for activity of an efflux pump that confers drug tolerance to both isoniazid and ethambutol. Mol. Microbiol. 55, 1829–1840 [DOI] [PubMed] [Google Scholar]
  • 14. Erickson J. W., and Gross C. A. (1989) Identification of the sigE subunit of Escherichia coli RNA polymerase: a second alternate sigma factor involved in high-temperature gene expression. Genes Dev. 3, 1462–1471 [DOI] [PubMed] [Google Scholar]
  • 15. Manganelli R., Voskuil M. I., Schoolnik G. K., and Smith I. (2001) The Mycobacterium tuberculosis ECF sigma factor sigE:role in global gene expression and survival in macrophages. Mol. Microbiol. 41, 423–437 [DOI] [PubMed] [Google Scholar]
  • 16. Colangeli R., Helb D., Vilchèze C., Hazbón M. H., Lee C. G., Safi H., Sayers B., Sardone I., Jones M. B., Fleischmann R. D., Peterson S. N., Jacobs W. R. Jr., and Alland D. (2007) Transcriptional Regulation of multi-drug tolerance and antibiotic-induced responses by the histone-like protein Lsr2 in M. tuberculosis. Plos Pathog. 3, e87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Li Y., Zeng J., Zhang H., and He Z. (2010) The characterization of conserved binding motifs and potential target genes for M. tuberculosis MtrAB reveals a link between the two-component system and the drug resistance of M. smegmatis. BMC Microbiol. 10, 242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Yang M., Gao C. H., Hu J., Zhao L., Huang Q., and He Z. G. (2015) InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG. Sci. Rep. 5, 13969. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Gopinath K., Moosa A., Mizrahi V., and Warner D. F. (2013) Vitamin B12 metabolism in Mycobacterium tuberculosis. Future Microbiol. 8, 1405–1418 [DOI] [PubMed] [Google Scholar]
  • 20. Savvi S., Warner D. F., Kana B. D., McKinney J. D., Mizrahi V., and Dawes S. S. (2008) Functional characterization of a vitamin B12-dependent methylmalonyl pathway in Mycobacterium tuberculosis: implications for propionate metabolism during growthon fatty acids. J. Bacteriol. 190, 3886–3895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Minnikin D. E., Kremer L., Dover L. G., and Besra G. S. (2002) The methyl-branched fortifications of Mycobacterium tuberculosis. Chem. Biol. 9, 545–553 [DOI] [PubMed] [Google Scholar]
  • 22. Azad A. K., Sirakova T. D., Rogers L. M., and Kolattukudy P. E. (1996) Targeted replacement of the mycocerosic acid synthase gene in Mycobacterium bovis BCG produces a mutant that lacks mycosides. Proc. Natl. Acad. Sci. U.S.A. 93, 4787–4792 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Bhatt A., Fujiwara N., Bhatt K., Gurcha S. S., Kremer L., Chen B., Chan J., Porcelli S. A., Kobayashi K., Besra G. S., and Jacobs W. R. (2007) Deletion of kasB in Mycobacterium tuberculosis causes loss of acid-fastness and subclinical latent tuberculosis in immunocompetent mice. Proc. Natl. Acad. Sci. U.S.A. 104, 5157–5162 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Warner D. F., Savvi S., Mizrahi V., and Dawes S. S. (2007) A riboswitch regulates expression of the coenzyme B12-independent methionine synthase in Mycobacterium tuberculosis: implications for differential methionine synthase function in strains H37Rv and CDC1551. J. Bacteriol. 189, 3655–3659 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Gopinath K., Venclovas C., Ioerger T. R., Sacchettini J. C., McKinney J. D., Mizrahi V., and Warner D. F. (2013) A vitamin B12 transporter in Mycobacterium tuberculosis. Open Biol. 3, 120175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Upton A. M., and McKinney J. D. (2007) Role of the methylcitrate cycle in propionate metabolism and detoxification in Mycobacterium smegmatis. Microbiology 153, 3973–3982 [DOI] [PubMed] [Google Scholar]
  • 27. Lee W., VanderVen B. C., Fahey R. J., and Russell D. G. (2013) Intracellular Mycobacterium tuberculosis exploits host-derived fatty acids to limit metabolic stress. J. Biol. Chem. 288, 6788–6800 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Jain M., Petzold C. J., Schelle M. W., Leavell M. D., Mougous J. D., Bertozzi C. R., Leary J. A., and Cox J. S. (2007) Lipidomics reveals control of Mycobacterium tuberculosis virulence lipids via metabolic coupling. Proc. Natl. Acad. Sci. U.S.A. 104, 5133–5138 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Low H. H., and Löwe J. (2006) A bacterial dynamin-like protein. Nature 444, 766–769 [DOI] [PubMed] [Google Scholar]
  • 30. Low H. H., Sachse C., Amos L. A., and Löwe J. (2009) Structure of a bacterial dynamin-like protein lipid tube provides a mechanism for assembly and membrane curving. Cell 139, 1342–1352 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Michie K. A., Boysen A., Low H. H., Møller-Jensen J., and Löwe J. (2014) LeoA, B and C from Enterotoxigenic Escherichia coli (ETEC) are bacterial dynamins. Plos One 9, e107211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Sawant P., Eissenberger K., Karier L., Mascher T., and Bramkamp M. (2015) A dynamin-like protein involved in bacterial cell membrane surveillance under environmental stress. Environ. Microbiol. 10.1111/1462-2920.13110 [DOI] [PubMed] [Google Scholar]
  • 33. Weerdenburg E. M., Abdallah A. M., Rangkuti F., Abd El Ghany M., Otto T. D., Adroub S. A., Molenaar D., Ummels R., Ter Veen K., van Stempvoort G., van der Sar A. M., Ali S., Langridge G. C., Thomson N. R., Pain A., and Bitter W. (2015) Genome-wide transposon mutagenesis indicates that Mycobacterium marinum customizes its virulence mechanisms for survival and replication in different hosts. Infect. Immun. 83, 1778–1788 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Camacho L. R., Ensergueix D., Perez E., Gicquel B., and Guilhot C. (1999) Identification of a virulence gene cluster of Mycobacterium tuberculosis by signature-tagged transposon mutagenesis. Mol. Microbiol. 34, 257–267 [DOI] [PubMed] [Google Scholar]
  • 35. Hardlei T. F., Obeid R., Herrmann W., and Nexo E. (2013) Cobalamin analogues in humans: a study on maternal and cord blood. Plos One 8, e61194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Abdallah A. M., Verboom T., Hannes F., Safi M., Strong M., Eisenberg D., Musters R. J., Vandenbroucke-Grauls C. M., Appelmelk B. J., Luirink J., and Bitter W. (2006) A specific secretion system mediates PPE41 transport in pathogenic mycobacteria. Mol. Microbiol. 62, 667–679 [DOI] [PubMed] [Google Scholar]
  • 37. Allen B. W. (1998) Mycobacteria: general culture methodology and safety considerations. Methods Mol. Biol. 101, 15–30 [DOI] [PubMed] [Google Scholar]
  • 38. Meijer A. H., van der Sar A. M., Cunha C., Lamers G. E., Laplante M. A., Kikuta H., Bitter W., Becker T. S., and Spaink H. P. (2008) Identification and real-time imaging of a myc-expressing neutrophil population involved in inflammation and mycobacterial granuloma formation in zebrafish. Dev. Comp. Immunol. 32, 36–49 [DOI] [PubMed] [Google Scholar]
  • 39. Zhang M., Chang H., Zhang Y., Yu J., Wu L., Ji W., Chen J., Liu B., Lu J., Liu Y., Zhang J., Xu P., and Xu T. (2012) Rational design of true monomeric and bright photoactivatable fluorescent proteins. Nat. Methods 9, 727–729 [DOI] [PubMed] [Google Scholar]
  • 40. Pashley C. A., and Parish T. (2003) Efficient switching of mycobacteriophage L5-based integrating plasmids in Mycobacterium tuberculosis. FEMS Microbiol. Lett. 229, 211–215 [DOI] [PubMed] [Google Scholar]
  • 41. van de Weerd R., Boot M., Maaskant J., Sparrius M., Verboom T., van Leeuwen L. M., Burggraaf M. J., Paauw N. J., Dainese E., Manganelli R., Bitter W., Appelmelk B. J., and Geurtsen J. (2016) Inorganic phosphate limitation modulates capsular polysaccharide composition in mycobacteria. J. Biol. Chem. 291, 11787–11799 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Sassetti C. M., Boyd D. H., and Rubin E. J. (2003) Genes required for mycobacterial growth defined by high density mutagenesis. Mol. Microbiol. 48, 77–84 [DOI] [PubMed] [Google Scholar]
  • 43. Besra G. S. (1998) Preparation of cell-wall fractions from mycobacteria. Methods Mol. Biol. 101, 91–107 [DOI] [PubMed] [Google Scholar]
  • 44. Hartman S., and De Bont J. A. M. (1992) The genus Mycobacterium-nonmedical. In The Prokaryotes, a handbook on the biology of bacteria: ecophysiology, isolation, application. (Balows A., et al., Ed.) pp. 1215–1237, Springer-Verlag New York Inc., New York [Google Scholar]
  • 45. Stoop E. J., Schipper T., Rosendahl Huber S. K., Nezhinsky A. E., Verbeek F. J., Gurcha S. S., Besra G. S., Vandenbroucke-Grauls C. M., Bitter W., and van der Sar A. M. (2011) Zebrafish embryo screen for mycobacterial genes involved in granuloma formation reveals a novel ESX-1 component. Dis. Model Mech. 4, 526–536 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. van Leeuwen L. M., van der Kuip M., Youssef S. A., de Bruin A., Bitter W., van Furth A. M., and van der Sar A. M. (2014) Modeling Tuberculous meningitis in zebrafish using Mycobacterium marinum. Dis. Model Mech. 7, 1111–1122 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Carrère-Kremer S., Blaise M., Singh V. K., Alibaud L., Tuaillon E., Halloum I., van de Weerd R., Guérardel Y., Drancourt M., Takiff H., Geurtsen J., and Kremer L. (2015) A new dehydratase conferring innate resistance to thiacetazone and intra-amoebal survival of Mycobacterium smegmatis. Mol. Microbiol. 96, 1085–1102 [DOI] [PubMed] [Google Scholar]
  • 48. Minnikin D. E., Dobson G., and Parlett J. H. (1985) Extraction and Chromatographic Analysis of Characteristic Mycobacterial Lipids. pp. 274–282, Springer Verlag, Berlin/Heidelberg [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES