Abstract
Premise of the study:
Adenophora palustris (Campanulaceae) is an endangered wetland plant species in Japan. Although it is widely distributed in East Asia, only six extant populations are known in Japan, with fewer than 1000 individuals in total. We developed 15 microsatellite markers for this species and confirmed their utility for the closely related species A. triphylla var. japonica.
Methods and Results:
Ten polymorphic loci were characterized for genetic variation within three populations of A. palustris. The number of alleles per locus ranged from four to 15, with an average of 9.3; the expected heterozygosity ranged from 0.48 to 0.89, with an average of 0.74. Nine loci were successfully amplified in A. triphylla var. japonica, and three of these loci showed polymorphism.
Conclusions:
These markers are useful for investigating genetic diversity and gene flow within and among remnant populations of A. palustris in Japan, and the results will provide crucial information for conservation.
Keywords: Adenophora palustris, Campanulaceae, endangered plant species, microsatellite, molecular marker
Adenophora palustris Kom. (Campanulaceae) is a perennial herb that inhabits small wetland areas in hilly regions. Adenophora palustris is widely distributed in East Asia, including eastern China, Korea, and Japan (Miyajima Natural Botanical Garden of Hiroshima University and Hiba Society of Natural History, 1997; Hong et al., 2011). However, only six extant populations are known in Japan—five in western Japan and one in central Japan. Although approximately 800 individuals grow in the largest population, which is located in the Sera region of western Japan, only a few to a few dozen individuals grow in the other populations. Consequently, fewer than 1000 individuals are estimated to remain in Japan, and A. palustris is currently classified as “critically endangered” in the Japanese Red Data Book (Ministry of the Environment Japan, 2015). Therefore, understanding its genetic diversity will play a key role in the future management of the species.
Masumoto et al. (2011) developed eight microsatellite markers for A. palustris. Although four of the eight loci showed moderate polymorphism (5–8 alleles among 31 individuals), the other loci had limited polymorphism (2–4 alleles). Therefore, we have newly developed highly polymorphic genomic microsatellite markers to investigate the genetic diversity and gene flow within remnant populations of A. palustris. This paper reports 15 markers developed using next-generation sequencing technology.
METHODS AND RESULTS
A fresh leaf sample was taken from a ramet growing in a native population in the Sera region, Hiroshima Prefecture, Japan (Appendix 1). Genomic DNA was extracted using the hexadecyltrimethylammonium bromide mini-prep procedure (Stewart and Via, 1993) and used for library preparation with a TruSeq Nano DNA Sample Prep Kit (Illumina, San Diego, California, USA). The amplified DNA fragments were sequenced using a MiSeq Benchtop Sequencer (Illumina) in 2 × 300-bp read mode, and the data were assembled into contigs in fastq-join software (Aronesty, 2011), resulting in a total of 1,738,214 contigs. Contigs were screened using Primer3 version 2.2.3 software (Rozen and Skaletsky, 1999) embedded in MSATCOMMANDER version 1.0.8 software (Faircloth, 2008) to identify dinucleotide motifs with a minimum of 15 repeats. Consequently, a total of 5049 primer pairs were designed. In the amplification trial using four ramets of A. palustris, 15 of 48 randomly selected primer pairs showed a clear, strong, single band for each allele.
To test the genetic variation of the 15 selected microsatellite markers, we sampled three A. palustris populations in the Sera and Toyosaka regions, Hiroshima Prefecture (western Japan), and the Ena region, Gifu Prefecture (central Japan; Appendix 1). To prevent illegal collection, we have withheld the exact locations of the sites. The sample size ranged from eight to 12 individuals per population, with a total sample size of 32. To confirm the utility of the 15 selected microsatellite markers for a close relative, one population of A. triphylla (Thunb.) A. DC. var. japonica H. Hara (n = 8) was also sampled (34°30′31″N, 132°44′06″E; Appendix 1).
PCR amplifications were performed in a final volume of 10 μL, which contained 5 ng of extracted DNA, 0.2 μL of KOD FX Neo polymerase (Toyobo, Osaka, Japan), 5 μL of 2× PCR buffer, 0.4 mM dNTPs, and 0.2 μM primers (forward primer with a bar-coded split tag, reverse primer, and fluorescent bar-coded split tag primer). A bar-coded split tag (BStag), comprising a common basal region among six BStags, a three-nucleotide “bar-code” sequence, and a mismatched nucleotide at the middle position, was added at the 5′ end of the forward primer of each locus to enable postlabeling (Shimizu and Yano, 2011). We labeled the BStag primers with fluorescent dyes to create F9GAC-FAM (5′-CTAGTATCAGGACGAC-3′), F9GTC-VIC (5′-CTAGTATGAGGACGTC-3′), F9TAC-NED (5′-CTAGTATCAGGACTAC-3′), F9GCC-PET (5′-CTAGTATTAGGACGCC-3′), F9CCG-FAM (5′-CTAGTATTAGGACCCG-3′), and F9AGG-VIC (5′-CTAGTATTAGGACAGG-3′) (Shimizu and Yano, 2011). The sequences of forward and reverse primers are listed in Table 1. Amplification was performed with a Veriti Thermal Cycler (Life Technologies, Carlsbad, California, USA) under the following conditions: initial denaturation at 94°C for 2 min; 30 cycles of denaturation at 98°C for 10 s, annealing at 58°C for 30 s, and extension at 68°C for 30 s; 12 cycles of 98°C for 10 s, 49°C for 30 s, and 68°C for 10 s; and a final extension at 68°C for 7 min. The size of the PCR products was measured using an ABI PRISM 3130XL Genetic Analyzer (Life Technologies) by GeneMapper software (Life Technologies). We conducted PCR amplifications twice in four randomly selected individuals because microsatellite markers with a high number of repeat units may cause unstable results due to PCR error (Shinde et al., 2003).
Table 1.
Characteristics of the 15 microsatellite markers of Adenophora palustris.
| Locus | Primer sequences (5′–3′) | Repeat motif | Fluorescent label | Allele size range (bp) | GenBank accession no. |
| AP01585 | F: [F9AGG] TGCAAGTACGAGTCGGTCC | (AT)16 | VIC | 386 | LC127427 |
| R: GTCACCAACGGGCATTCTAG | |||||
| AP02665 | F: [F9CCG] GGGTGTCAACTTCATGTCAGG | (AG)25 | FAM | 305–353 | LC122486 |
| R: CGGTCTGCTAACTGGAGAGA | |||||
| AP04413 | F: [F9GCC] ACGGGAGGGTAGATAGGTCC | (AC)18 | PET | 280 | LC127428 |
| R: GCCAAACATTCTTCCCAAGGT | |||||
| AP04430 | F: [F9GTC] GGAACACTGCTCCTTGACTC | (GA)17 | VIC | 158–206 | LC122487 |
| R: GTAACACCATTGCTGCCTCC | |||||
| AP07350 | F: [F9CCG] TTTGAGATCACCCGAAACGC | (GT)19 | FAM | 335–355 | LC122488 |
| R: AAGGGCCGCAAATTGGATTG | |||||
| AP07489 | F: [F9AGG] GCTCAAACACCAAATTCAAC | (AG)20 | VIC | 355–385 | LC122489 |
| R: ACCTTCCAACCCACTAATCCC | |||||
| AP08053 | F: [F9TAC] AAACGGACGGAGGGAGTAG | (AG)21 | NED | 255–275 | LC122490 |
| R: TGCGTTATTGGAGGAGGGTG | |||||
| AP08837 | F: [F9CCG] CGCGGATCATGAGCTAAACC | (CT)24 | FAM | 232 | LC127429 |
| R: GGCGTCTCCTTCAGAAATGG | |||||
| AP12435 | F: [F9GAC] ACAAGACTGGGACCACTCTC | (AC)18 | FAM | 135–175 | LC127430 |
| R: CTCCAAGGTAGGCAGTGTATTG | |||||
| AP14144 | F: [F9GCC] AGTTTCTTTGAGCCGCGTTG | (AG)19 | PET | 298–316 | LC122491 |
| R: AAATCTGAGGACTTGTGCGC | |||||
| AP14331 | F: [F9GAC] GCCATTCCTCCATCTTC | (AG)16 | FAM | 138 | LC122492 |
| R: TCCGCCATGACAAGCAATTC | |||||
| AP14371 | F: [F9AGG] ACAGATGCAGATAGGTGGCC | (AG)22 | VIC | 403–409 | LC122493 |
| R: ACAGATGCAGATAGGTGGCC | |||||
| AP15792 | F: [F9GCC] GTGATTATTCCTGCTGGCCG | (AG)19 | PET | 288–314 | LC122494 |
| R: CCTCCGTGCCATTGTGAAAG | |||||
| AP15867 | F: [F9GAC] AGTTCATAGCCCGTCGAAATTC | (AG)16 | FAM | 150 | LC127431 |
| R: GGGACCTCTTCAACAACCAAC | |||||
| AP20216 | F: [F9CCG] GCCGAGATGATATAAAGAGCC | (AT)25 | FAM | 289–321 | LC122495 |
| R: AGTGGGTATTCGGGAGCAAG |
The genetic polymorphism at each locus was assessed by calculating the observed number of alleles (A), observed heterozygosity (Ho), and expected heterozygosity (He). Deviations from Hardy–Weinberg equilibrium in each population and linkage disequilibrium were tested using FSTAT version 2.9.3 software (Goudet, 1995) and the web version 4.2 of GENEPOP software (Raymond and Rousset, 1995), respectively. Significance levels were adjusted using the Bonferroni correction for multiple comparisons.
Of the 15 loci tested, 10 were polymorphic and five were monomorphic. PCR slippage was not observed. The evaluation of polymorphism in all 32 individuals showed that the 10 polymorphic loci had moderate to high levels of polymorphism (Table 2). A ranged from four (AP14371) to 15 (AP02665), with an average of 9.3 alleles per locus. He for each locus was generally high, ranging from 0.48 (AP14371) to 0.89 (AP02665). At the population level, A ranged from one to 13 (average: 5.4), Ho from 0.00 to 1.00 (average: 0.62), and He from 0.00 to 0.89 (average: 0.63). Among all loci in the three populations, five combinations of locus and population deviated significantly from Hardy–Weinberg equilibrium (P < 0.01; Table 2). There was no evidence of significant linkage disequilibrium (P < 0.05) in any pair of loci. Nine loci were successfully amplified in A. triphylla var. japonica, and of these, three loci showed polymorphism (Table 2).
Table 2.
Genetic variation of the 10 polymorphic microsatellite loci for three populations of Adenophora palustris and one population of A. triphylla var. japonica.a
| A. palustris | A. triphylla var. japonica | ||||||||||||
| Sera (n = 12) | Toyosaka (n = 12) | Ena (n = 8) | Hiroshima (n = 5) | ||||||||||
| Locus | AT | A | Ho | He | A | Ho | He | A | Ho | He | Ab | Ho | He |
| AP02665 | 15 | 13 | 0.667* | 0.886 | 9 | 0.750 | 0.809 | 6 | 1.000 | 0.781 | 4 (1) | 0.400 | 0.640 |
| AP04430 | 11 | 8 | 0.667 | 0.583 | 7 | 0.750 | 0.694 | 5 | 0.500 | 0.624 | — | — | — |
| AP07350 | 9 | 8 | 0.750 | 0.756 | 6 | 0.917* | 0.750 | 3 | 0.750 | 0.594 | — | — | — |
| AP07489 | 8 | 4 | 0.250* | 0.642 | 6 | 0.333 | 0.659 | 2 | 0.875 | 0.491 | 1 (0) | 0.000 | 0.000 |
| AP08053 | 10 | 5 | 0.250 | 0.517 | 6 | 0.750 | 0.743 | 5 | 0.750 | 0.702 | 3 (2) | 0.600 | 0.480 |
| AP12435 | 8 | 4 | 0.000* | 0.513 | 4 | 0.917* | 0.642 | 3 | 0.250 | 0.593 | — | — | — |
| AP14144 | 10 | 9 | 0.833 | 0.816 | 7 | 0.917 | 0.827 | 4 | 0.750 | 0.608 | — | — | — |
| AP14371 | 4 | 4 | 0.500 | 0.538 | 3 | 0.583 | 0.434 | 2 | 0.500 | 0.375 | 4 (2) | 1.000 | 0.640 |
| AP15792 | 8 | 6 | 0.583 | 0.611 | 4 | 0.500 | 0.632 | 3 | 0.750 | 0.507 | 1 (1) | 0.000 | 0.000 |
| AP20216 | 10 | 6 | 0.750 | 0.781 | 8 | 0.750 | 0.792 | 1 | 0.000 | 0.000 | — | — | — |
Note: — = not amplified; A = number of alleles per population; AT = total number of alleles observed in A. palustris; He = expected heterozygosity; Ho = observed heterozygosity.
Voucher and locality information are provided in Appendix 1.
Numbers in parentheses are the numbers of alleles only observed in the A. triphylla var. japonica population.
Significant deviation from Hardy–Weinberg equilibrium expectations (P < 0.01).
CONCLUSIONS
The microsatellite markers described here will be useful for investigating genetic diversity and gene flow within and among remnant native populations of the critically endangered A. palustris in Japan. Assessment of their genetic variation will also contribute to elucidating how A. palustris populations in Japan have been declining, and the results will play a key role in the future management of the species. Furthermore, these markers have enough resolution to detect localities of individuals that were illegally collected and marketed, and the results will provide crucial information for revitalization of populations by complementary planting of illegally collected individuals.
Appendix 1.
Voucher information for Adenophora populations used in this study. One voucher was collected from each population sampled.
| Species | Collection locality | Voucher collection no.a |
| A. palustris Kom. | Sera, Hiroshima Prefecture, Japan | K. Otake0001 |
| A. palustris | Toyosaka, Hiroshima Prefecture, Japan | K. Otake0003 |
| A. palustris | Ena, Gifu Prefecture, Japan | K. Otake0006 |
| A. triphylla (Thunb.) A. DC. var. japonica H. Hara | Higashi-Hiroshima, Hiroshima Prefecture, Japan | K. Otake0007 |
All vouchers were deposited in the Herbarium of the Graduate School for International Development and Cooperation, Hiroshima University, Hiroshima, Japan. To prevent illegal collection, we have withheld the exact locations of the sites.
LITERATURE CITED
- Aronesty E. 2011. ea-utils: Command-line tools for processing biological sequencing data. Website https://expressionanalysis.github.io/ea-utils/ [accessed 22 August 2016].
- Faircloth B. C. 2008. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Molecular Ecology Resources 8: 92–94. [DOI] [PubMed] [Google Scholar]
- Goudet J. 1995. FSTAT (version 1.2): A computer program to calculate F-statistics. Journal of Heredity 86: 485–486. [Google Scholar]
- Hong D., Ge S., Lammers T. G., Klern L. L. 2011. Adenophora. In Z. Wu, R. H. Raven, and D. Hong [eds.], Flora of China, vol. 19, 536–551. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Masumoto I., Kaneko S., Otake K., Isagi Y. 2011. Development of microsatellite markers for Adenophora palustris (Campanulaceae), a critically endangered wetland plant species in Japan. Conservation Genetics Resources 3: 163–165. [Google Scholar]
- Ministry of the Environment Japan 2015. Red Data Book 2014–Threatened wildlife of Japan, Vol. 8: Vascular Plants. Gyousei, Tokyo, Japan. [Google Scholar]
- Miyajima Natural Botanical Garden of Hiroshima University and the Hiba Society of Natural History 1997. Flora of Hiroshima prefecture, Japan. Chugoku Shimbun, Hiroshima, Japan.
- Raymond M., Rousset F. 1995. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. [Google Scholar]
- Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Shimizu T., Yano K. 2011. A post-labeling method for multiplexed and multicolored genotyping analysis of SSR, indel and SNP markers in single tube with bar-coded split tag (BStag). BMC Research Notes 4: 161. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shinde D., Lai Y., Sun F., Arnheim N. 2003. Taq DNA polymerase slippage mutation rates measured by PCR and quasi-likelihood analysis: (CA/GT)n and (A/T)n microsatellites. Nucleic Acids Research 31: 974–980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stewart C. N., Jr, Via L. E. 1993. A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other applications. BioTechniques 14: 748–775. [PubMed] [Google Scholar]