Abstract
Premise of the study:
To examine patterns of genetic diversity and test possible hybridization events, microsatellite markers were identified and characterized in Hoya ledongensis (Apocynaceae), and cross-amplification was tested in a congener, H. jianfenglingensis.
Methods and Results:
Based on the transcriptome data of H. ledongensis, 46 microsatellite primer pairs were randomly selected for initial validation. From these, 28 primer pairs were successfully amplified, 12 of which were polymorphic in 36 individuals across three populations of H. ledongensis. The number of alleles per microsatellite locus ranged from two to 11. The observed and expected heterozygosities for the 12 loci ranged from 0.133 to 0.867 and 0.128 to 0.894, respectively. Cross-species amplification was successful for these 12 loci in the congeneric species H. jianfenglingensis.
Conclusions:
These polymorphic transcriptome-derived simple sequence repeat markers have the potential to be used as multilocus molecular markers to study the population genetics and natural hybridization in species of Hoya.
Keywords: Apocynaceae, conservation, genetic diversity, Hoya ledongensis, transcriptome-derived SSR markers
Hoya R. Br. (Apocynaceae) is composed of 200–300 species worldwide and is an important epiphyte component of tropical and subtropical forests (Liede and Albers, 1994). It is mainly distributed in the tropical rainforests of Southeast Asia, Australia, and islands of the Indian and Pacific oceans (Wanntorp, 2009). China is one of the main distribution areas of Hoya, with 39 species mainly occurring in Yunnan, Guangxi, Guangdong, and Hainan provinces (Li and Jiang, 1977; He et al., 2009a, 2009b, c, 2011a, b, 2012).
In China, many species of this genus occur in a very narrow distribution range. For example, H. ledongensis Shao Y. He & P. T. Li is restricted to the central mountain areas of Hainan Province and H. jianfenglingensis Shao Y. He & P. T. Li is only known from Jianfengling Nature Reserve, Hainan (He et al., 2011a, 2011b). For the latter species, it is estimated that there are fewer than 60 individuals in its whole range (He et al., 2011a). Therefore, conservation of these lands that provide narrow distribution ranges for these species should be prioritized. Knowledge of genetic diversity and population structure of Hoya species can provide important information for their conservation. Furthermore, both of these species occur at high elevations (ca. 1000 m) and are sympatric in the area of the Jianfengling Nature Reserve. Hoya ledongensis flowers from May to June, and H. jianfenglingensis flowers from May to July (He et al., 2011a, 2011b). The overlap in flowering time between the two species and the insect-pollination mating system for Hoya provide an opportunity for interspecific hybridization. Molecular markers can be used to address these evolutionary questions on conservation genetics and natural hybridization in this genus. With advances in high-throughput sequencing technologies, transcriptome-derived simple sequence repeat (SSR) markers can be easily obtained and are also increasingly used in conservation genetic studies (Yu et al., 2004; Chen et al., 2010; Wu et al., 2012). However, to date, there has been no report of SSR markers in Hoya. In the current study, we developed and characterized 12 transcriptome-derived SSR markers for H. ledongensis and tested their transferability to its congeneric species H. jianfenglingensis.
METHODS AND RESULTS
Fifteen individuals were sampled from each of two natural populations of H. ledongensis in Bawangling (CJL: 19°08′13.6″N, 109°10′37.7″E) and Baisha (BSL: 18°45′50.3″N, 108°57′48.8″E), and six individuals were sampled from the population in Jiangfengling (LDL: 18°46′27.3″N, 108°52′29.6″E) in Hainan Province. An additional six individuals of the congeneric species H. jianfenglingensis were collected from Bawangling (CJJ: 19°13′12.0″N, 109°08′07.6″E), Hainan Province (Appendix 1). Genomic DNA was extracted from silica-dried leaves using the cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). The leaf transcriptome of H. ledongensis was sequenced as described by Liu (2012); based on these data, we selected 46 pairs of transcriptome-derived primers with five or more repeats of dinucleotide or trinucleotide motifs.
To screen the expressed sequence tag (EST)–SSR primers, PCR amplification was conducted using two individuals from each of the two H. ledongensis populations (CJL and BSL) in a final reaction volume of 20 μL containing: 1.2 μL of DNA (15 ng/μL), 10 μL of 10× PCR KOD buffer, 4 μL of dNTPs (2.5 mM, Mg2+), 0.6 μL (10 μM) of each primer, and 0.6 μL KOD polymerase (TOYOBO Ideas & Chemistry, Osaka, Japan). PCR was performed under standard conditions for all primers using the following cycling conditions: 3 min of denaturation at 94°C; followed by 30 cycles of 40 s at 94°C, 45 s at the annealing temperature of each primer set, and 40 s at 72°C; with a final extension of 10 min at 72°C. The PCR products were first resolved with electrophoresis in a 1.5% agarose gel to assess if the amplification was successful for the expected sized products of each primer pair. These experiments produced PCR products with expected sizes that were successfully amplified from 28 primer pairs designed for H. ledongensis.
To test the polymorphism level of these 28 primer pairs, PCR was conducted using all of the H. ledongensis and H. jianfenglingensis samples in a final reaction volume of 20 μL, using the conditions detailed above. Amplified products were resolved in an 8% polyacrylamide gel electrophoresis (PAGE), and gels were stained with 0.1% silver nitrate. The band size was calculated by comparison with a 50-bp DNA ladder (TaKaRa Biotechnology Co., Dalian, China). Our results showed that 12 transcriptome-derived SSR markers were polymorphic in H. ledongensis (Table 1).
Table 1.
Characteristics of 28 transcriptome-derived SSR loci of Hoya ledongensis.
| Locus | Primer sequences (5′–3′) | Repeat motif | Allele size range (bp) | Ta (°C) | GenBank accession no. | BLAST top hit description [organism] | BLAST top hit accession no. | E-value |
| SSR-4 | F: GGGTGAGTCTTTGAGTGCCT | (AG)8 | 151–169 | 54 | KT206213 | serovar 6b str. SLCC5334 complete genome [Listeria welshimeri] | AM_263198 | 1.900 |
| R: CATGGTCCACACTAATCCCC | ||||||||
| SSR-6 | F: TCTTCGTCCTGTCCTGTGTG | (TC)8 | 264–274 | 57 | KT206214 | protein EPIDERMAL PATTERNING FACTOR 2-like [Nicotiana tomentosiformis] | XM_009616771 | 5e-56 |
| R: CAGGTGCATGTGTAAAGGGA | ||||||||
| SSR-8 | F: TGAACTCCAAGTCCAGGAGC | (AG)8 | 150–160 | 53 | KT206215 | zinc finger CCCH domain-containing protein 31 [Sesamum] | XR_847888 | 6e-10 |
| R: TTGACGCTGAGGATGACAAG | ||||||||
| SSR-41 | F: TCTCTTCACTCCGCACACAC | (AT)6 | 266–284 | 59 | KT206216 | complete genome, chromosome chr1 [Macaca fascicularis] | LT160000 | 0.014 |
| R: CCCATTTGACGACAACATCA | ||||||||
| SSR-43 | F: TATCGGGAGTTTCGTCCAAG | (ATC)5 | 255–268 | 55 | KT206217 | uncharacterized LOC104234001 (LOC104234001), transcript variant X5, mRNA [Nicotiana sylvestris] | XM_009787489 | 5e-117 |
| R: TTTGGGAAATGGGATGATGT | ||||||||
| SSR-45 | F: TGTCTGATTCTCCCCTGGTC | (AT)6 | 269–279 | 56 | KT206218 | uncharacterized LOC107015919 (LOC107015919), mRNA [Solanum pennellii] | XM_015216363 | 3e-56 |
| R: GCTGTTCCTCCTCCTGACAC | ||||||||
| SSR-44 | F: AGGCTCCCCGAGATCATTAC | (TC)8 | 262–282 | 56 | KT206219 | exocyst complex component EXO70B1 (LOC102586317), transcript variant X2, mRNA [Solanum tuberosum] | XM_006338307 | 0.000 |
| R: CAATTTGCTTGCTCCACAAC | ||||||||
| SSR-46 | F: CTGCCCTGTCAAGAAGAAGG | (TCA)6 | 239–314 | 56 | KT206220 | probable WRKY transcription factor 40 (LOC105165167), mRNA [Sesamum indicum] | XM_011084080 | 7e-82 |
| R: GACTGAACCCAGTGCTGTCA | ||||||||
| SSR-31 | F: CCCTTGCCAAATTTCTGTGT | (TA)6 | 241–257 | 56 | KT206221 | lysosomal beta glucosidase-like (LOC105168898), mRNA [Sesamum indicum] | XM_011089093 | 0.000 |
| R: AAAACCCCCTTGCTGATCTT | ||||||||
| SSR-17 | F: TGTGAGGTGAAAAGGGTGAA | (AT)8 | 118–126 | 57 | KT206223 | vinckei hypothetical protein partial mRNA [Plasmodium vinckei] | XM_008627391 | 2.700 |
| R: TCCCACCAGTCAAATGTTGT | ||||||||
| SSR-14 | F: CCCTGAAAATAGGCAGGAAA | (AT)8 | 142–160 | 56 | KT206224 | DNA chromosome 4, contig fragment No. 14 [Arabidopsis thaliana] | AL161502 | 4e-05 |
| R: TATAGGGTTCACACGCAATG | ||||||||
| SSR-23 | F: CAACAATGTAGCTAACTTTGAGGTC | (TA)8 | 124–154 | 56 | KT206222 | contig VV78X055473.3, whole genome shotgun sequence [Vitis vinifera] | AM483450 | 5.0 |
| R: CATCATGCTCACCAAGTGCT | ||||||||
| SSR-2 | F: GGTGGTCTTAGGGATGGCTAC | (AT)8 | 240 | 53 | KX084524 | genome assembly P. xenopodis South Africa, scaffold PXEA contig0165619 [Protopolystoma xenopodis] | LM904264 | 0.13 |
| R: TCCCTTTCTCACATCCCTGT | ||||||||
| SSR-12 | F: TCAAGTTTTCATGGCTGCTG | (AG)8 | 236 | 53 | KX084525 | contig VV78X093246.6, whole genome shotgun sequence [Vitis vinifera] | AM462769 | 5e-06 |
| R: GGCAATCAAGGGGAGGTAAT | ||||||||
| SSR-13 | F: AGGACACTGTTCCACCACAG | (GA)8 | 149 | 59 | KX084526 | genomic chromosome, chr_6 [Cucumis melo] | LN713260 | 5e-04 |
| R: CTCTATCTTCGTAGGCCCCC | ||||||||
| SSR-15 | F: TTTCCACAAATTCCCCTTTTT | (TG)7 | 151 | 56 | KX084527 | chromosome ch10 [Solanum lycopersicum] | HG975522 | 0.17 |
| R: AATGGAGAGGAAGCAAGCTG | ||||||||
| SSR-16 | F: CACACACTTGCACTTGTAGCTATG | (TA)8 | 154 | 54 | KX084528 | genomic scaffold, anchoredscaffold0000 [Cucumis melo] | LN681932 | 0.022 |
| R: TAACACAAATCACCCACCCA | ||||||||
| SSR-20 | F: ATCAAAATTCGGAGGCTTCA | (TA)8 | 247 | 56 | KX084529 | clone BAC 043A03 complete sequence [Saccharum hybrid cultivar R570] | KF184749 | 0.083 |
| R: AAGTCCCCTACTTTCTCCGC | ||||||||
| SSR-25 | F: CTGTCCAGCTAAACCCCCTT | (AG)8 | 212 | 56 | KX084530 | genome assembly T_regenti_v1_0_4, scaffold TRE_scaffold0011240 [Trichobilharzia regenti] | LL011240 | 2e-04 |
| R: CCCAGCCAAAGAAAAGACAA | ||||||||
| SSR-27 | F: TGGGAAGGTGCATTTTCAG | (GA)8 | 354 | 56 | KX084531 | chromosome 2 [Arabidopsis thaliana] | CP002685 | 4.4 |
| R: TCACCAGCTGTGGCAAATAC | ||||||||
| SSR-28 | F: CTCCACCCAAGCAAGTCCTA | (CT)9 | 196 | 56 | KX084532 | cation/H(+) antiporter 24-like (LOC104228225), mRNA [Nicotiana sylvestris] | XM_009780654 | 0.008 |
| R: CCATAGAAAATGCCAACGGT | ||||||||
| SSR-30 | F: TCCCTGTGTCTCCCCAATTA | (CT)9 | 157 | 53 | KX084533 | genome assembly S_erinaceieuropaei, scaffold SPER contig 0084196 [Spirometra erinaceieuropaei] | LN300345 | 1e-05 |
| R: TGGGATTCTTCCCACCAATA | ||||||||
| SSR-34 | F: GAAATGCAGGGAATGATTGAA | (AG)8 | 276 | 54 | KX084534 | protein DCL, chloroplastic-like (LOC105168792), mRNA [Sesamum indicum] | XM_011088943 | 2e-49 |
| R: GACACCGGGACCAATCTTTA | ||||||||
| SSR-35 | F: AAGGCCAATTCTTGTTGGTG | (TA)7 | 275 | 54 | KX084535 | 6-phosphogluconate dehydrogenase, decarboxylating 3, transcript variant X3, mRNA [Nicotiana sylvestris] | XM_009776029 | 0.0 |
| R: TCCATGCATTTGATTTTCCA | ||||||||
| SSR-36 | F: TCACCATGTCCATGGAAAATTA | (AT)6 | 276 | 57 | KX084536 | LP174 ribosomal protein L16 (rpl16) gene, partial sequence; chloroplast gene for chloroplast product [Stewartia serrata] | AY070303 | 0.017 |
| R: TTTTTGGTTCGTAGGCTGCT | ||||||||
| SSR-37 | F: TGCTGCACTTTAACCGAAGA | (ATT)6 | 276 | 56 | KX084537 | auxin response factor 9 (LOC105165118), mRNA [Sesamum indicum] | XM_011084003 | 0.0 |
| R: TGTTTGGTGCTGTTGAGAAGA | ||||||||
| SSR-40 | F: CGCAGAGGCATATGGAATTT | (TA)6 | 252 | 54 | KX084538 | SPX domain-containing protein 4 (LOC105167645), mRNA [Sesamum indicum] | XM_011087437 | 3e-158 |
| R: ATACAAATGAGGCGAGGCTG | ||||||||
| SSR-42 | F: GCCCAGAACCCTCATTCATA | (GA)8 | 263 | 52 | KX084539 | uncharacterized LOC105179451 (LOC105179451), mRNA [Sesamum indicum] | XM_011103071 | 0.0 |
Note: Ta = annealing temperature.
POPGENE version 1.31 (Yeh et al., 1999) was used to calculate the population genetics parameters for H. ledongensis and H. jianfenglingensis, respectively. Two to 11 alleles were detected for these loci (Table 2). These polymorphic loci had observed heterozygosity from 0.133 to 0.867 and expected heterozygosity from 0.128 to 0.894, respectively.
Table 2.
Genetic diversity of 12 polymorphic markers developed in three populations of Hoya ledongensis and one population of H. jianfenglingensis.a
| H. ledongensis | H. jianfenglingensis | |||||||||||
| CJL (N = 15) | BSL (N = 15) | LDL (N = 6) | CJJ (N = 6) | |||||||||
| Locus | A | Ho | Heb | A | Ho | Heb | A | Ho | Heb | A | Ho | Heb |
| SSR-4 | 4 | 0.333 | 0.404 | 4 | 0.467 | 0.728 | 4 | 0.500 | 0.772 | 3 | 0.500 | 0.681 |
| SSR-6 | 2 | 0.133 | 0.128 | 4 | 0.400 | 0.673 | 3 | 0.333 | 0.667 | 3 | 0.333 | 0.318 |
| SSR-8 | 6 | 0.533 | 0.747* | 3 | 0.466 | 0.662*** | 3 | 0.833 | 0.681* | 3 | 0.833 | 0.681 |
| SSR-41 | 4 | 0.400 | 0.605 | 4 | 0.200 | 0.659* | 2 | 0.500 | 0.409 | 4 | 0.833 | 0.772 |
| SSR-43 | 2 | 0.533 | 0.405 | 5 | 0.333 | 0.694 | 2 | 0.500 | 0.409 | 2 | 0.333 | 0.303 |
| SSR-45 | 5 | 0.333 | 0.740 | 4 | 0.466 | 0.705 | 2 | 0.333 | 0.484 | 3 | 0.333 | 0.439 |
| SSR-44 | 6 | 0.867 | 0.811 | 8 | 0.733 | 0.795*** | 3 | 0.500 | 0.439 | 2 | 0.333 | 0.303 |
| SSR-46 | 5 | 0.600 | 0.678*** | 11 | 0.533 | 0.894*** | 2 | 0.666 | 0.545 | 3 | 0.666 | 0.727* |
| SSR-31 | 5 | 0.400 | 0.698*** | 3 | 0.266 | 0.625** | 2 | 0.333 | 0.484 | 2 | 0.333 | 0.303 |
| SSR-17 | 2 | 0.866 | 0.508* | 4 | 0.400 | 0.600* | 2 | 0.166 | 0.166 | 2 | 0.333 | 0.303 |
| SSR-14 | 4 | 0.533 | 0.652* | 4 | 0.400 | 0.512 | 3 | 0.833 | 0.727 | 5 | 0.333 | 0.742 |
| SSR-23 | 4 | 0.333 | 0.627* | 4 | 0.266 | 0.643*** | 2 | 0.333 | 0.303 | 5 | 0.333 | 0.742 |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = number of individuals analyzed.
Population and voucher information are provided in Appendix 1.
Significant deviations from Hardy–Weinberg equilibrium after sequential Bonferroni corrections: *** represents significance at 0.1% nominal level; ** represents significance at 1% nominal level; * represents significance at 5% nominal level.
Out of the 12 polymorphic microsatellite loci, six, seven, and one in the CJL, BSL, and LDL populations of H. ledongensis, respectively, exhibited significant deviations from Hardy–Weinberg equilibrium (HWE; Table 2). The deviations from HWE might be an effect of null alleles at these loci, despite the fact that null homozygous individuals were absent in these populations. To test this, we used MICRO-CHECKER (version 2.2.3; van Oosterhout et al., 2004) to check if there were null alleles. We found that null alleles were present at five markers (SSR-8, SSR-41, SSR-45, SSR-46, and SSR-31) in the population BSL, at three markers (SSR-8, SSR-31, and SSR-23) in the population CJL, and at one marker (SSR-14) in the population CJJ. Because HWE was also observed in populations with null alleles at some loci, homozygote excess of populations should be another factor for the deviations from HWE. No significant linkage disequilibrium was observed between these markers; therefore, they can be considered independent across the genome. Furthermore, cross-species amplification of these 12 markers was successful in H. jianfenglingensis and only one locus in the CJJ population exhibited a significant deviation from HWE.
CONCLUSIONS
To the best of our knowledge, this is the first study to report SSR markers in a species of Hoya. We have identified and verified 12 markers for H. ledongensis that can also be used for the investigation of its congener species H. jianfenglingensis. The primers designed in this study can be applied to the investigation of genetic diversity and population structure of Hoya and other related species. Furthermore, natural hybridization between Hoya species can be tested with these markers. This work provides an important tool for the development of scientific conservation strategies and testing natural hybridization hypotheses in Hoya.
Appendix 1.
Voucher and location information for the Hoya species and populations used in this study. All voucher specimens are deposited at the herbarium of South China Agricultural University (CANT), Guangzhou, China.
| Species | Population code | Voucher no. | Collection locality | Geographic coordinates | N |
| Hoya ledongensis Shao Y. He & P. T. Li | CJL | LSYH20110924 | Changjiang, Hainan, China | 19°08′13.6″N, 109°10′37.7″E | 15 |
| BSL | LSYH20110928 | Ledong, Hainan, China | 18°45′50.3″N, 108°57′48.8″E | 15 | |
| LDL | LSYH20110926 | Changjiang, Hainan, China | 18°46′27.3″N, 108°52′29.6″E | 6 | |
| Hoya jiangfenglingensis Shao Y. He & P. T. Li | CJJ | JSYH20110924 | Changjiang, Hainan, China | 19°13′12.0″N, 109°08′07.6″E | 6 |
Note: N = number of individuals sampled.
LITERATURE CITED
- Chen C., Zhuang M., Li K. N., Liu Y. M., Yang L. M., Zhang Y. Y., Cheng F., et al. 2010. Development and utility of EST-SSR marker in cabbage. Acta Horticulturae Sinica 37: 221–228. [Google Scholar]
- Doyle J. J., Doyle J. L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- He S. Y., Li P. T., Lin J. Y., Yang X. H. 2009a. Hoya persicinicoronaria (Apocynaceae, Asclepiadoideae), a new species from Hainan, China. Novon 19: 475–478. [Google Scholar]
- He S. Y., Li P. T., Lin J. Y., Zeng M. L. 2009b. A new species of Hoya (Apocynaceae, Asclepiadoideae) from Hainan, China. Novon 19: 357–359. [Google Scholar]
- He S. Y., Zhuang X. Y., Li P. T., Li M. 2009c. Hoya baishaensis (Apocynaceae), a new species from Hainan, China. Annales Botanici Fennici 46: 155–158. [Google Scholar]
- He S. Y., Li P. T., Lin J. Y., Lin G. Y., Zeng H. L. 2011a. Hoya jianfenglingensis (Apocynaceae), a new species from Hainan, China. Novon 21: 343–346. [Google Scholar]
- He S. Y., Zhou R. C., Li P. T. 2011b. A new species of Apocynaceae from Hainan, China. Journal of Systematics and Evolution 49: 161. [Google Scholar]
- He S. Y., Wu W., Li P. T., Zeng M. L. 2012. Hoya daimenglongensis (Apocynaceae, Asclepiadoideae), a new species from Yunnan, China. Novon 22: 170–173. [Google Scholar]
- Li B. T., Jiang Y. 1977. Flora Reipublicae Popularis Sinicae, Vol. 63: 309–384. Science Press, Beijing, China. [Google Scholar]
- Liede S., Albers F. 1994. Tribal disposition of Asclepiadaceae genera. Taxon 43: 201–231. [Google Scholar]
- Liu H.2012. Molecular phylogeny and transcriptome analysis of the genus Hoya in China. Master’s thesis, South China Agricultural University, Guangzhou, China.
- van Oosterhout C., Hutchinson W. F., Wills D. P. M., Shipley P. 2004. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4: 535–538. [Google Scholar]
- Wanntorp L. 2009. Phylogenetic systematics of Hoya (Apocynaceae). Blumea 54: 228–232. [Google Scholar]
- Wu Z. M., Liu W. Q., Tang X., Cui J. J., Cheng J. W., Hu K. L. 2012. Development and application of EST-SSR marker in pepper. Journal of South China Agricultural University 33: 171–174. [Google Scholar]
- Yeh F. C., Yang R. C., Boyle T. 1999. POPGENE: Microsoft Windows–based Freeware for Population Genetic Analysis. Release 1.31. University of Alberta, Edmonton, Alberta, Canada. [Google Scholar]
- Yu J. K., Dake T. M., Singh S., Benscher D., Li W. L., Gill B., Sorrells M. E. 2004. Development and mapping of EST-derived simple sequence repeat (SSR) markers for hexaploid wheat. Genome 47: 805–818. [DOI] [PubMed] [Google Scholar]