Abstract
Four enterovirus D68 (EV-D68) strains from four children with influenza-like illness were identified in Shenzhen, southern China, in late 2015. Here, we announce the availability of these viral genomes in GenBank. The genomic sequences of these EV-D68 strains showed the closest phylogenetic relationship to strains from northern China.
GENOME ANNOUNCEMENT
Enterovirus D68 (EV-D68), a member of the enterovirus D species of the family Picornaviridae, is a single stranded, positive-sense RNA virus with an ~7.3-kb genome (1, 2). Its genome comprises a 5′ untranslated region (5′-UTR), structural polypeptide P1, nonstructural polypeptides P2 and P3, and a 3′ untranslated region (3′-UTR). P1, P2, and P3 are cleaved into four structural proteins (VP1 to VP4), three nonstructural proteins (2A to 2C), and four nonstructural proteins (3A to 3D), respectively. EV-D68 was originally isolated from four American children with respiratory illness in 1962 (3). Since then, EV-D68 had not caused public concern until its outbreaks in the United States in the second half of 2014 (4–7). Subsequently, some retrospective and field epidemiological investigations on the prevalence of EV-D68 associated with respiratory infections were successively reported in different geographic regions (8–10). These data have demonstrated an increasing number of patients with EV-D68 infections and the wide spread of EV-D68 across the world in recent years.
Between 16 November 2015 and 16 December 2015, four EV-D68 strains from four children with influenza-like illness were identified by real-time reverse transcription PCR and sequencing of VP1 genes in Shenzhen, southern China (11). Next, two sets of primers pairs, EVD68-1F21 (TTAAAACAGCTCTGGGGTTGT)/EVD68-4570R27 (ATTTTGCATTAAATCATCCATAAGGAC) and EVD68-4394F26 (TCAAGTCCAAATCTCGCATTGAACCG)/EVD68-7340R27 (GTCCCCAAGTGACCAAAATTTACCTCT), were designed to amplify two overlapping fragments encompassing the complete genome of EV-D68. Amplified DNA products were sequenced by TaKaRa using a primer-walking method. The two overlapping fragments were assembled into a complete genome using Lasergene version 7.1. The assembled genome sequences were examined using BioEdit version 7.2.5 before submission to GenBank.
The complete genome sequences of the four EV-D68 strains from the study were composed of 7,293 nucleotides (nt), excluding the poly(A) tail. The 5′-UTR contains 699 nt, followed by an open reading frame encoding the structural protein P1 (2,583 nt), the nonstructural proteins P2 (1,728 nt) and P3 (2,253 nt), and the 3′-UTR (27 nt). The base compositions of the full genomes of the four EV-D68 strains are 31.58 to 31.67% A, 20.35 to 20.47% C, 21.34 to 21.42% G, and 26.53 to 26.64% U. The complete nucleotide sequences and complete amino acid sequences (2,188 aa) of the four EV-D68 strains showed 0 to 2.9% and 0 to 0.8% differences to each other, respectively. No sequence insertion or deletion was observed in the complete genome region of the four EV-D68 strains compared to the closest known strains. Genome-wide sequence analysis indicated that these four EV-D68 strains belonged to the latest clade comprising some sporadic strains from China.
Recent EV-D68 strains have evolved worldwide into distinct clades, which shows the trend of further geographical spread (6, 12–18). Since there is no epidemiological data on EV-D68 infections in southern China at present, this study urges us to investigate the prevalence of EV-D68 as quickly as possible and strengthen surveillance of EV-D68 to prevent its outbreak.
Accession number(s).
The complete genome sequences of four EV-D68 strains from the present study have been deposited in GenBank under the accession numbers KU982558 to KU982561.
ACKNOWLEDGMENTS
Internal fundings for this research were provided by Shenzhen CDC and Shenzhen International Travel Healthcare Center, Shenzhen, China. Views and conclusions from this report are those of the authors and do not necessarily represent the official opinion of Shenzhen CDC or Shenzhen International Travel Healthcare Center.
Funding Statement
This research received no specific grant from any funding agency.
Footnotes
Citation Chen L, Shi L, Yang H, Gu D-Y, Meng J, Xu Y-Q, Yao X-J, Zhang H-L, Cheng J-Q, Ma H-W, Zhang R-L, He Y-Q. 2016. Identification and whole-genome sequencing of four enterovirus D68 strains in southern China in late 2015. Genome Announc 4(5):e01014-16. doi:10.1128/genomeA.01014-16.
REFERENCES
- 1.Oberste MS, Maher K, Schnurr D, Flemister MR, Lovchik JC, Peters H, Sessions W, Kirk C, Chatterjee N, Fuller S, Hanauer JM, Pallansch MA. 2004. Enterovirus 68 is associated with respiratory illness and shares biological features with both the enteroviruses and the rhinoviruses. J Gen Virol 85:2577–2584. doi: 10.1099/vir.0.79925-0. [DOI] [PubMed] [Google Scholar]
- 2.Smura TP, Junttila N, Blomqvist S, Norder H, Kaijalainen S, Paananen A, Magnius LO, Hovi T, Roivainen M. 2007. Enterovirus 94, a proposed new serotype in human enterovirus species D. J Gen Virol 88:849–858. doi: 10.1099/vir.0.82510-0. [DOI] [PubMed] [Google Scholar]
- 3.Schieble JH, Fox VL, Lennette EH. 1967. A probable new human picornavirus associated with respiratory diseases. Am J Epidemio 85:297–310. [DOI] [PubMed] [Google Scholar]
- 4.Midgley CM, Jackson MA, Selvarangan R, Turabelidze G, Obringer E, Johnson D, Giles BL, Patel A, Echols F, Oberste MS, Nix WA, Watson JT, Gerber SI. 2014. Severe respiratory illness associated with enterovirus D68–Missouri and Illinois, 2014. Morb Mortal Wkly Rep 63:798–799. [PMC free article] [PubMed] [Google Scholar]
- 5.Farrell JJ, Ikladios O, Wylie KM, O’Rourke LM, Lowery KS, Cromwell JS, Wylie TN, Melendez ELV, Makhoul Y, Sampath R, Bonomo RA, Storch GA. 2015. Enterovirus D68-associated acute respiratory distress syndrome in adult, United States, 2014. Emerg Infect Dis 21:914–916. doi: 10.3201/eid2105.142033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Huang W, Wang G, Zhuge J, Nolan SM, Dimitrova N, Fallon JT. 2015. Whole-genome sequence analysis reveals the enterovirus D68 isolates during the United States 2014 outbreak mainly belong to a novel clade. Sci Rep 5:15223. doi: 10.1038/srep15223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Oermann CM, Schuster JE, Conners GP, Newland JG, Selvarangan R, Jackson MA. 2015. Enterovirus D68: a focused review and clinical highlights from the 2014 United States outbreak. Ann Am Thorac Soc 12:775–781. doi: 10.1513/AnnalsATS.201412-592FR. [DOI] [PubMed] [Google Scholar]
- 8.Esposito S, Bosis S, Niesters H, Principi N. 2015. Enterovirus D68 infection. Viruses 7:6043–6050. doi: 10.3390/v7112925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Principi N, Esposito S. 2015. Enterovirus D-68: an emerging cause of infection. Expert Rev Respir Med 9:711–719. doi: 10.1586/17476348.2015.1109451. [DOI] [PubMed] [Google Scholar]
- 10.Holm-Hansen CC, Midgley SE, Fischer TK. 2016. Global emergence of enterovirus D68: a systematic review. Lancet Infect Dis 16:e64–e75. doi: 10.1016/S1473-3099(15)00543-5. [DOI] [PubMed] [Google Scholar]
- 11.Nix WA, Oberste MS, Pallansch MA. 2006. Sensitive, seminested PCR amplification of VP1 sequences for direct identification of all enterovirus serotypes from original clinical specimens. J Clin Microbiol 44:2698–7204. doi: 10.1128/JCM.00542-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Tan Y, Hassan F, Schuster JE, Simenauer A, Selvarangan R, Halpin RA, Lin X, Fedorova N, Stockwell TB, Lam TT, Chappell JD, Hartert TV, Holmes EC, Das SR. 2016. Molecular Evolution and Intraclade Recombination of enterovirus D68 during the 2014 outbreak in the United States. J Virol 90:1997–2007. doi: 10.1128/JVI.02418-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Xiao Q, Ren L, Zheng S, Wang L, Xie X, Deng Y, Zhao Y, Zhao X, Luo Z, Fu Z, Huang A, Liu E. 2015. Prevalence and molecular characterizations of enterovirus D68 among children with acute respiratory infection in China between 2012 and 2014. Sci Rep 5:16639. doi: 10.1038/srep16639. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ng KT, Oong XY, Pang YK, Hanafi NS, Kamarulzaman A, Tee KK. 2015. Outbreaks of enterovirus D68 in Malaysia: genetic relatedness to the recent US outbreak strains. Emerg Microbes Infect 4:e47. doi: 10.1038/emi.2015.47. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Midgley SE, Christiansen CB, Poulsen MW, Hansen CH, Fischer TK. 2015. Emergence of enterovirus D68 in Denmark, June 2014 to February 2015. Euro Surveill 20:21105. [DOI] [PubMed] [Google Scholar]
- 16.Furuse Y, Chaimongkol N, Okamoto M, Imamura T, Saito M, Tamaki R, Saito M, Tohoku-RITM Collaborative Research Team, Lupisan SP, Oshitani H.. 2015. Molecular epidemiology of enterovirus D68 from 2013 to 2014 in Philippines. J Clin Microbiol 53:1015–1018. doi: 10.1128/JCM.03362-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Levy A, Roberts J, Lang J, Tempone S, Kesson A, Dofai A, Daley AJ, Thorley B, Speers DJ. 2015. Enterovirus D68 disease and molecular epidemiology in Australia. J Clin Virol 69:117–121. doi: 10.1016/j.jcv.2015.06.079. [DOI] [PubMed] [Google Scholar]
- 18.Lau SK, Yip CC, Zhao PS, Chow WN, To KK, Wu AK, Yuen KY, Woo PC. 2016. Enterovirus D68 infections associated with severe respiratory illness in elderly patients and emergence of a novel clade in Hong Kong. Sci Rep 6:25147. doi: 10.1038/srep25147. [DOI] [PMC free article] [PubMed] [Google Scholar]
