Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2016 Sep 6;113(38):10666–10671. doi: 10.1073/pnas.1611481113

Actinomycin D enhances killing of cancer cells by immunotoxin RG7787 through activation of the extrinsic pathway of apoptosis

Xiu Fen Liu a, Laiman Xiang a, Qi Zhou a, Jean-Philippe Carralot b, Marco Prunotto b, Gerhard Niederfellner c, Ira Pastan a,2
PMCID: PMC5035863  PMID: 27601652

Significance

Because effective cancer therapy usually requires a combination of drugs, we searched for clinically used anticancer agents that would enhance the activity of immunotoxin RG7787 so they could be combined in humans. We show here that actinomycin D activates the extrinsic pathway of apoptosis and acts synergistically with RG7787 to kill a variety of cancer cell lines and cause striking tumor regression in mice. These data indicate that combining immunotoxins like RG7787 that kill cells by inhibiting protein synthesis with actinomycin D is a useful strategy to enhance their antitumor activity in humans.

Keywords: cancer therapy, apoptosis, immunotherapy, pancreatic cancer, mesothelioma

Abstract

RG7787 is a mesothelin-targeted immunotoxin designed to have low-immunogenicity, high-cytotoxic activity and fewer side effects. RG7787 kills many types of mesothelin-expressing cancer cells lines and causes tumor regressions in mice. Safety and immunogenicity of RG7787 is now being assessed in a phase I trial. To enhance the antitumor activity of RG7787, we screened for clinically used drugs that can synergize with RG7787. Actinomycin D is a potent transcription inhibitor that is used for treating several cancers. We report here that actinomycin D and RG7787 act synergistically to kill many mesothelin-positive cancer cell lines and produce major regressions of pancreatic and stomach cancer xenografts. Analyses of RNA expression show that RG7787 or actinomycin D alone and together increase levels of TNF/TNFR family members and NF-κB–regulated genes. Western blots revealed the combination changed apoptotic protein levels and enhanced cleavage of Caspases and PARP.


Recombinant immunotoxins (RITs) are chimeric proteins that contain an antibody fragment directed against a tumor-selective surface antigen attached to a protein toxin. We have constructed immunotoxins by attaching a 38 kDa fragment of Pseudomonoas exotoxin A (PE38) to the Fv portion of mAb that binds to cancer cells but not to essential tissues (1, 2). RITs kill cells by ADP-ribosylating and inactivating elongation factor (EF)-2, leading to protein synthesis arrest, a fall in MCL-1 levels, and induction of apoptosis (3, 4). SS1P is a RIT that targets mesothelin, a protein highly expressed on mesothelioma, pancreatic, ovarian, lung, and stomach cancers. Because SS1P contains a bacterial toxin, it is immunogenic and can only be given for one treatment cycle to most patients. However, when combined with pentostatin and cyclophosphamide to suppress antibody formation, SS1P has produced major and prolonged tumor regressions in some patients with advanced chemo-refractory mesothelioma (5–7).

RG7787 (now named LMB-100) is in clinical trials for refractory pancreatic cancer (NCT02810418) and mesothelioma (NCT02798536). It is a derivative of SS1P containing mutations that make it less immunogenic, more active in killing target cells, and better tolerated by patients (7). The targeting moiety of RG7787 is a humanized antimesothelin Fab; its effector moiety is a 24-kDa ADP ribosylation domain of PE fused via a furin cleavable linker to the Fab. The domain III variant used in RG7787 contains mutations that silence many human B-cell epitopes and some T-cell epitopes. RG7787 is cytotoxic to many mesothelin-expressing cell lines and when combined with pacilitaxel produces complete remissions in pancreatic cancer-bearing mice (7).

The mechanism by which immunotoxins kill cells is not completely understood. After binding to specific receptors, immunotoxins enter cells by endocytosis, and in the endocytic compartment, the furin separates the Fv from the toxin. Then the toxin is transferred in a retrograde fashion through the Golgi and endoplasmic reticulum into the cytosol. There the toxin catalyzes the ADP ribosylation of EF-2, leading to protein synthesis arrest and apoptosis (4).

Actinomycin D (Act D) is a polypeptide antibiotic isolated from the genus Streptomyces. Act D intercalates into DNA, preventing the progression of RNA polymerases (8, 9). It is widely used as a transcription inhibitor. RNA polymerase I, catalyzing ribosomal RNA transcription, is most sensitive to Act D (IC50, 0.05 µg/mL); RNAP II (0.5 µg/mL) and RNAP III (about 5 µg/mL) are less sensitive (9). Nanomolar concentrations of Act D block transcription of RNA polymerase I and induce nucleolar stress by interfering with ribosome biogenesis (10–12). Act D is the first antibiotic used for treating cancer; these cancers include gestational trophoblastic neoplasia, Wilms tumor, rhabdomyosarcoma, Ewing’s sarcoma, and NPM1-mutated acute myeloid leukemia (13). The mechanism by which Act D causes tumor cell death is not established.

Many anticancer drugs exert their effects by triggering apoptosis (14, 15). Apoptosis can be triggered by the extrinsic (receptor) pathway or at the mitochondrial level by the intrinsic pathway. Activation of members of the TNFR superfamily, such as FAS, TRAILR1 and R2, TNFR, and CD137, results in recruitment of death domain proteins and caspase-8 activation, which can result in the cleavage of Bid and activation of the intrinsic apoptotic pathway (16). TNFR superfamily activation leads to activation of NF-κB, a key regulatory protein that can initiate cell death (17–19).

To improve the antitumor activity of RG7787, we have screened nine DNA-damaging agents in clinical use that enhance RG7787 action. We report here that Act D and RG7787 act synergistically to increase killing of many mesothelin-expressing cancers and cause major tumor regressions in tumor-bearing mice. These data support the combined use of these agents in ongoing trials with RG7787.

Results

Act D Enhances Killing of KLM1 Cells by RG7787.

We screened seven DNA-damaging drugs and found that Act D dramatically synergized with RG7787 to kill 25 cancer cell lines (lung, pancreas, ovary) (Fig. S1 and Table S1). To determine the cytotoxic mechanism, we stained the treated cells with annexin V and 7AAD and used flow cytometry to measure cell apoptotic death. Fig. 1A shows that 9% of cells treated for 24 h with RG7787 at 100 ng/mL had died, Act D alone at 10 ng/mL did not cause cell death, but the combination was very effective, killing about 20% of the cells. To examine the effect of lower concentrations of these agents, we extended the treatment time to 72 h (Fig. 1B) or 96 h (Fig. 1C). Under both conditions, the combination was more than additive, and 60–75% of the cells underwent apoptosis. Fig. 1D shows photomicrographs of KLM1 cells after 4 d of treatment with RG7787 (10 ng/mL) or Act D (10 ng/mL) or both. Cells treated with Act D alone appeared larger and thinner, and there were fewer cells, indicating inhibition of cell growth. With RG7787 many cells died and small clusters of cells survived. In the combination group, only a few nonviable rounded cells were present on day 4, which did not grow out when the drugs were removed (Fig. 1D).

Fig. S1.

Fig. S1.

Combination screening of DNA-damaging agents. Combination screening of DNA-damaging agents with RG7787 was performed in 6 × 6 dose matrices in a panel of 25 cell lines (see Table S1). Briefly, cells were seeded at 500 cells per well in 384-well plates and allowed to adhere for 24 h at 37 °C/5% CO2. Cells were then incubated with compounds for 72 h, and cell viability was measured using ATPlite Luminescence Assay System from Perkin-Elmer and measured on an Envision plate reader (Perkin-Elmer). Prior combination screening, optimal dose range for RG77887, and each DNA-damaging agent was determined in single-agent studies. Viability data were analyzed using Chalice software from Horizon Discovery. Synergistic effect of each compound was determined using a synergy score (S) as described elsewhere (31). Briefly, the synergy score S sums up the activity in excess over Loewe additivity with weights to adjust for drug dilution factors Fx, Fy. S = ln(fX) ln(fY) Σdoses max(0,Zdata) (Zdata − ZLoewe).

Table S1.

Cell lines used for screening DNA-damaging drugs

Tissues Names of cell lines
Pancreas AsPC-1, BxPC-3, CAPAN-2, HPAF-II, HuP-T3, KLM-1, KP-3, NCI-H1437, Panc 04.03, PA-TU-8988S, T3M-4
Lung JL-1, MOR-CPR, NCI-H1623, NCI-H1869, NCI-H2126, NCI-H292, NCI-H596, RERF-LC-KJ, T3M-10
Ovarian COV644, EFO-21, KURAMOCHI, OVSAHO
Breast HCC1806

Fig. 1.

Fig. 1.

KLM1 cells are susceptible to Act D and RG7787 treatment. (A–C) KLM1 cells were treated with RG7787 with or without 10 nM Act D for 24 h (A, RG7787, 100 ng/mL), 72 h (B, RG7787, 10 ng/mL), or 96 h (C, RG7787, 5 ng/mL). The cells were stained with annexin V and 7AAD and analyzed by FACS. Percentages of dead cells in the graph are generated by subtracting dead cells from the untreated control group. The data were generated from at least three separate experiments. (D) Microscopy examination of cells treated with RG7787 (10 ng/mL) or Act D (10 ng/mL) for 4 d. (E) Act D accelerated and resulted in complete killing of tumor cells by RG7787. KLM1 cells were treated with Act D (10 ng/mL), RG7787 (10 ng/mL), or a combination. After 6, 24, or 48 h, the cells were changed to fresh media to let the surviving cells grow for 1 wk. The images were taken after cells were fixed and stained with crystal violet. Comb, combination of Act D and RG7787; Con, untreated control.

Act D Accelerates Killing of Tumor Cells.

Because immunotoxin RG7787 has a relatively short half-life in the circulation, it is important that cells are killed after a short exposure to RG7787 (20). To evaluate if Act D treatment shortens the time needed for RG7787 to kill cells, KLM1 cells were treated with low doses of RG7787 in combination with Act D for 6, 24, or 48 h, and the cells were transferred to drug-free medium and followed. Fig. 1E shows that exposure to each agent alone for 6 h had little effect on the cells, but the combination decreased cell numbers. Treatment with either agent for 24 or 48 h slightly decreased cell numbers, but there were very few cells after combination treatment for 24 h and no cells after 48 h of treatment.

Act D Enhances RG7787 Killing of Many Cancer Cells.

We next examined the stomach cancer line MKN28 (Fig. S2A shows photomicrographs of these cells). Because they die more slowly than KLM1 cells, we treated for 3 d and grew them in drug-free medium for 2 more days. After 5 d the MKN28 cells in the control and the Act D group reached confluence. RG7787 at 20 ng/mL killed some cells, but after 5 d, the surviving cells started to regrow. However, the combination of Act D and RG7787 eliminated almost all of the cells. Similar results were observed with the pancreatic cancer line, AsPC1 pancreatic cells, and RH16 human mesothelioma cells when treated with RG7787 and Act D (Fig. S2 B and C).

Fig. S2.

Fig. S2.

Multiple tumor cell lines are sensitive to the combined treatment with Act D and RG7787. (A) MKN28 cells were treated with 10 ng/mL Act D with or without 20 ng/mL RG7787. After 3 d, the medium was changed to a medium without drugs. Images were taken on the day when the drugs were given (day 1), 3 d after treatment, or 5 d after treatment. (B) AsPC1 cells were treated with 15 ng/mL Act D with or without 50 or 100 ng/mL RG7787 for 3 d. The medium was changed to a medium without drugs. Images were taken 5 d after treatment. (C) RH16 cells were treated with 5 ng/mL Act D and 10 or 30 ng/mL RG7787. Representative images are shown. Comb, combination; Con, untreated control.

To verify that the treated cells were dying by apoptosis and to quantify the effect, we used flow cytometry and stained cells with annexin V and 7AAD. Table 1 shows data from eight cell lines of diverse cancer types: pancreas, breast, stomach, lung, cervix, and mesothelioma. With all these cancer types, we found that killing by the combination was more than additive.

Table 1.

Synergistic killing of tumor cells with Act D and RG7787

Cell lines Tumor types Con Act D RG7787 Act D + RG7787
KLM-1 Pancreatic 4.5 ± 1.1 16 ± 3.1 23.6 ± 4.4 66.9 ± 4.0
HCC70 Breast 8.1 ± 1.7 15.9 ± 5.2 23.4 ± 7.5 64.4 ± 1.6
HAY Mesothelioma 6.8 ± 0.35 13.1 ± 1.1 21.7 ± 2.2 39.9 ± 3.5
RH16 Mesothelioma 6.8 ± 0.7 15.1 ± 5.8 23.3 ± 0.1 75.5 ± 4.5
MKN28 Stomach 6.1 ± 0.9 13.9 ± 0.7 8.9 ± 1.0 58.8 ± 16.7
NUGC4 Stomach 6.6 ± 0.25 10.6 ± 1.8 14.5 ± 2.3 37.8 ± 2.5
KB 31 Cervical 9.6 ± 0.3 15.4 ± 0.87 22.5 ± 1.6 68.0 ± 2.3
L55 Lung 6.5 ± 0.35 7.2 ± 0.04 20.5 ± 1 33.5 ± 0.85

Tumor cells were cultured with Act D at either 2.5 ng/mL (Hay), 5 ng/mL (RH16), 10 ng (KLM1, KB, MKN28, HCC70, NUGC4), or 15 ng/mL (L55) with or without RG7787 at 5 ng/mL (KLM1, KB, Hay, MKN28, NUGC4), 10 ng/mL (HCC70, RH16), or 50 ng/mL (L55) for 3 or 4 d (RH16). Cell death was determined by FACS analysis after staining of annexin V and 7AAD. The data were generated from two or three separate experiments.

The combination of Act D and RG7787 also caused rapid killing of pancreatic cancer AsPC-1 cells (Fig. S3A). In 6 h, the combination killed equivalent numbers of cells as RG7787 single treatment for 24 or 48 h. In addition, combined treatment for 24 or 48 h completely killed almost all of the cells. Hay and MKN28 cells were also efficiently killed by low doses of RG7787 when combined with Act D (Fig. S3 B and C).

Fig. S3.

Fig. S3.

Act D accelerated and resulted in complete killing of tumor cells by RG7787. (A) AsPC1 cells were treated with Act D (15 ng/mL) or RG7787 (20 ng/mL) or combination (Comb) after overnight growth on dishes. After 6, 24, or 48 h, the cells were changed to fresh media to let the surviving cells grow for 1 wk. The images were taken after cells were fixed and stained with crystal violet. (B and C) Hay cells (B) treated with Act D at 2.5 ng/mL or MKN28 (C) treated at 5 ng/mL with or without RG7787 at the indicated concentration for 3 d. Then the cells were shifted to fresh media and regrew for 1 wk; the surviving cells were similarly stained using crystal violet. All of the images were obtained after the dishes were scanned.

Mouse Experiments.

To evaluate the effect of combination treatment, we used KLM1 pancreatic tumors, which we previously showed were mainly growth-inhibited by RG7787 alone (21). Fig. 2A shows that tumors had reached 100 mm3 on day 6 after treatment was started. The PBS control group continued to grow and reached about 500 mm3 on day 15. Tumors in the RG7787 group had a slight decrease in size after the first cycle of treatment but had grown significantly by day 22. Treatment with Act D slowed tumor growth but did not cause tumor shrinkage. However, tumors in the combination group started to shrink from the second day of treatment. On day 30, five of eight mice had no measurable tumors, and three of eight had very small tumors below 20 mm3. On day 41, two mice still had no measurable tumors. The other six tumors started to grow, but all were below 50 mm3. No mice died from the therapy, although some mice in the combination group lost up to 10% of their weight during the first few days of treatment. They had fully recovered by the end of the second cycle of treatment. This experiment was repeated with similar results. We did not try three cycles of treatment.

Fig. 2.

Fig. 2.

Act D stimulated RG7787 killing of tumor cells in xenografts in mice. (A) KLM1 cells were s.c. injected and treated with Act D and RG7787 as described in Materials and Methods. There is a statistically significant difference between RG7787 and combination treatment beginning from day 11 (*P < 0.001, n = 8 per treatment group). (B) MKN28 cells were similarly injected and treated as in A at the indicated days. There are statistically significant differences between RG7787 and combination (*P ≤ 0.01, n = 6) starting from day 15 until the end of the experiment.

We also examined the effect of RG7787 and Act D on MKN28 tumors (Fig. 2B). MKN28 tumors grew slower than KLM1 tumors and had reached 100 mm3 on day 9, when we started treatment. Tumors in the control group (n = 6) reached 500 mm3 on day 20. Tumor growth slowed in both the RG7787 group (n = 6) and the Act D group (n = 6), but tumor shrinkage was not observed. In contrast, with combination treatment (Combo, n = 6), the tumors decreased in size up until day 21 and then began to regrow. The combination significantly inhibited the tumor growth much more than RG7787 or Act D single treatment (P < 0.01) from day 15 to day 28.

Mechanism Studies.

One way to increase immunotoxin action is to increase the rate and amount of immunotoxin taken into the cell. To measure uptake, cells were exposed to Alexa Fluor 647–RG7787, and the amount accumulated was measured in a flow cytometer. Fig. 3A shows that the uptake of Alexa–RG7787 is not changed by exposure to Act D when measured from 20 min to 3 h. After internalization and furin cleavage, the toxin is transferred to the endoplasmic reticulum and then to the cytosol, where it ADP-ribosylates EF-2. To determine if the modification and inactivation of EF-2 was stimulated by Act D treatment, cells were treated for 2, 6, and 24 h, and cell lysates were prepared for analysis of the state of EF-2. In extracts of untreated cells, EF-2 was modified by NAD-biotin in the presence of toxin, and the modified EF-2–biotin was detected on a Western blot (Fig. 3B). In cells treated with immunotoxin, EF-2 becomes resistant to modification with NAD-biotin, because the site is already modified. Fig. 3B shows that at 2 and 6 h, the EF-2 in RG7787-treated cells is resistant to ADP ribosylation and that Act D has no effect on this modification. Treatment for 24 h with Act D slightly decreased ADP ribosylation, but the combination with RG7787 did not further decrease levels of ADP–EF-2 (24 h longer exposure). This indicates that Act D does not affect the toxin trafficking to the endoplasmic reticulum, transfer to the cytosol, or EF-2 modification and must act on some subsequent step to arrest protein synthesis.

Fig. 3.

Fig. 3.

Act D did not increase cellular uptake of RG7787 and did not enhance ADP ribosylation. (A) KLM1 cells were treated with Alexa 647-labeled RG7787, and internalized RG7787 cells were determined by FACS analysis as described in Materials and Methods. (B) KLM1 cells were treated with RG7787 with or without Act D for 2, 6, or 24 h, and ADP ribosylation was performed in vitro as described in Materials and Methods. L.E., longer exposure.

Act D and RG7787 Changed Apoptotic Proteins.

Western blots were performed to determine which apoptotic proteins were changed by this treatment (Fig. 4A). The combination greatly increased levels of PARP, tBID, and Caspase-3, -8, and -9, all of which are proapoptotic proteins. Act D by itself had very little effect on these proteins, except for elevating BIM, which is antiapoptotic, but BIM levels were decreased by RG7787. RG7787 alone lowered levels of MCL-1, BIM, and BCLxl and had small effects on Caspase-8 and -9 and on PARP.

Fig. 4.

Fig. 4.

Western blot analysis of apoptotic proteins and signaling molecules. (A) Apoptotic proteins changed by Act D and RG7787. KLM1 cells were treated with 10 ng/mL Act D with or without RG7787 for 24 h, and cell lysates were analyzed by Western blot using anti-MCL1, anti-BCLxl, anti-Bim, anti-Bid, anti-cleaved Caspase-3, anti-cleaved Caspase-8, anti-cleaved Caspase-9, and anti-PARP. Actin is the loading control. (B) Increased level of TNF/TNFR superfamily and activation of NF-κB. Total protein lysates from KLM1 cells treated with 10 ng/mL Act D with or without 100 ng/mL RG7787 were blotted with anti-DR5, anti-CIAP2, anti–P-MAPK (p38), anti-MAPK (p38), anti–NF-κB (p65), or P-NF-κB (p65). Actin is the normalization for the loading. (C) After KLM1 cells were treated as above, the nuclear fraction was isolated using a cyto/nuc fractionation kit (Pierce). The nuclear fraction was used for Western blot with anti-total NF-κB and anti-HDAC2 (loading control). The relative numbers were obtained from scanning the Western blot using NIH image, and the ratios were calculated by setting the untreated control as 1. SE, short exposure.

RNA Changes Induced by Act D and RG7787.

Act D is an effective inhibitor of RNA polymerase 1, and this inhibition results in a decrease in the synthesis of ribosomal RNA (9). To determine if the low concentrations of Act D used in our experiments affected levels of RNA encoding proteins in the apoptotic pathway, we used a RNA array containing 84 different proapoptotic and antiapoptotic genes. KLM1 and RH16 cells were treated with Act D, RG7787, or both for 24 h and prepared RNA for analysis. The ratios of RNA levels compared with untreated cells are shown in Table S2. For both cell types, the levels of RNA for the control house-keeping genes (ACTB, B2M, GAPDH, RPLP0, or HPRT1) were largely unaffected. This result indicates that at the low concentration of Act D used in these experiments, there is not an overall inhibition of RNA synthesis. Unexpectedly, we observed that the level of many RNAs is increased by treatment with Act D or RG7787 or both. RNAs that changed over threefold are listed in Table 2. Act D produced dramatic increases in KLM-1 cells in many members of the TNF and TNFR superfamily, including TNFα and TNFβ, DR2, TNFR2, CD137, and CD27. Other genes whose expression is elevated by Act D are NF-κB target genes (BCL2A1, CIAP2, and GADD45α). In RH16 cells, there was an increase in Fas and CD27 but not other TNFR family members. RG7787 increased the levels of many of the same RNAs, and they were also elevated in cells treated with the combination. However, there were differences. For example, CD27 was elevated by Act D and the combination but was decreased by RG7787 alone.

Table S2.

Apoptotic array

KLM1 RH16 KLM1 RH16
Symbol Act D RG7787 Comb Act D RG7787 Comb Symbol Act D RG7787 Comb Act D RG7787 Comb
Abl 1 1.1 0.9 0.8 1 1.1 CRADD 0.7 2.1 0.7 0.7 1.5 0.8
Aif 1.8 1.8 2.3 0.9 1 1.1 cyt-c 1.8 0.7 2.2 1.5 1.1 1
akt1 1.3 1.1 1 0.8 0.8 0.8 DAPK1 0.6 1.5 0.6 0.5 1.7 0.8
apaf-1 1.3 0.6 0.7 1.8 1 1.9 DFFA 1.5 1 1.2 1.2 0.9 1.3
Bad 1.7 2.2 1.7 0.7 0.8 0.7 Diablo 1.8 2.9 2.8 1 1.1 1.4
bag-1 1.1 0.6 0.7 1.2 0.8 1.1 FADD 1.5 2.1 1.1 0.8 1.2 1.1
bag-3 0.9 1.2 1.4 1.3 1 1.7 Fas 1.1 2.4 1 5.9 0.1 6.1
Bak 1.2 1.6 0.9 1.3 0.7 1.4 Fas-ligand 1.1 0.7 1.6
Bax 1.5 1.3 1.6 1.4 0.7 1.7 GADD45A 4.1 63.1 30 4.5 4.1 21.2
Bcl-10 2.2 4.3 3.2 2.3 1.9 3.9 Harakiri 1.2 1.1 0.9 2.4 3.1 2.2
Bcl-2 2.2 0.6 0.4 0.7 0.9 0.3 IGF1R 0.7 2.6 0.8 0.7 0.9 0.8
BCL2A1 3.4 7.4 21.6 2.1 19.2 22.6 IL10 1.1 0.7 3.3
Bcl-xL 2.7 2.2 1.2 1.3 1 1.7 Mcl-1 1.4 1.1 0.6 1.7 1.1 1.8
Bcl-B 1.8 0.7 0.5 0.4 0.3 0.8 NAIP 0.5 0.9 0.5 1.4 0.8 0.8
Bim 3.1 0.7 2.3 1.8 0.7 1.7 NFkB 1.6 8.5 3.2 1.1 3.2 2.1
Bcl-w 1.4 1.4 1.7 1.3 1.2 1.1 NOD1 0.9 0.5 0.2 0.9 0.7 0.6
Bfar 1.4 1.6 1.1 0.7 0.8 0.8 NOL3 1.9 0.8 1.4 2 0.5 1.2
Bid 1.2 0.9 1.4 0.9 0.8 1 PYCARD 1.1 0.6 0.6 1.3 0.6 1.2
Bik 1.8 6.1 3.6 2.5 1.1 4.1 RIPK2 2.3 2.9 2.2 3.1 2.4 4.8
Birc2 1.5 2.5 1.9 3.1 1.5 2.1 TNF-α 10 147.6 103.1 1.2 6.9 11.2
CIAP 4.7 46.3 13.2 8.6 5.7 9.8 TNF-β 1.2 7.5 13.4 4.8 2.9 3.5
Birc5 2 1 3.2 0.2 0.6 0.3 TNFR3 1.4 1.3 1.2 2.4 0.8 2.2
Birc6 0.6 2.6 0.8 1.9 1.8 1.2 TRAILR1 1.7 1.9 1.4 1.7 0.9 3.4
Bnip-2 1.6 0.9 0.9 2.5 1.2 1.4 TRAILR2 2.7 8.3 4.6 2 1 3.9
Bnip-3 0.6 0.7 0.6 1.8 0.9 2.2 TNFRSF11B 2 0.5 0.6 0.6 4.1 2.2
Bnip-3L 1.3 0.4 1 3.7 1.2 2.2 TNFR1 0.9 1.3 0.7 0.7 0.7 0.9
Braf 0.8 2 0.9 1.6 1.6 1.5 TNFR2 10.5 15.5 8.1 0.5 0.6 0.4
Caspase-1 0.7 0.3 0.4 15 1.3 13.5 TNFRSF21 0.9 0.4 0.5 1.3 1.2 2
Caspase-10 2.1 1.9 3 3.6 1.5 5.4 TNFRSF25 1.1 0.5 0.2 2.6 0.6 1.4
Caspase-14 1.1 0.7 0.5 CD137 4.6 68.8 15.7 0.7 4.5 2.8
Caspase-2 1.6 1 1.5 0.9 1.1 0.7 TNFSF10 0.7 0.1 0.2 0.9 0.5 1
Caspase-3 2.9 1.4 3.8 1.8 1.6 2.4 TNFSF8 0.4 0.9 1
Caspase-4 2 0.9 1.5 2.9 0.9 2.1 TP53 2.4 5.6 8.8 1.5 1.1 1.6
Caspase-5 2.8 0.7 5.6 2.8 1.3 3.5 TP53BP2 1.6 5.8 3.7 1.6 1.7 1.8
Caspase-6 1.3 0.6 1.1 1.1 0.8 1.1 TP73 0.4 1.3 1.1 0.5 3.4 0.3
Caspase-7 3.4 1.1 2.2 1.2 0.9 1.8 TRADD 1.2 0.4 0.5 0.9 1 1.8
Caspase-8 1.7 1.1 1.1 2 0.9 1.3 TRAP 0.9 3.5 1.5 0.5 1.1 0.5
Caspase-9 1.9 2.4 3.2 1 3.4 2.4 TRAF3 0.9 3.8 1 0.7 1.1 0.8
CD27 3.4 0.2 6.2 2.4 0.5 1.8 XIAP 1.1 1.4 0.6 2.7 1.7 2.1
CD40 1.6 1.5 1.3 ACTB 1.4 1.8 1.8 1 1 0.9
CD40LG 1.1 0.7 1.1 1.2 0.5 0.6 B2M 2.3 1.7 2.4 1.7 1.2 1.5
CD70 2.7 4.1 3.3 1.6 1 2.8 GAPDH 1.9 1.4 1.8 1.1 0.9 1.2
Casper 1.8 2.9 2.5 1.7 1.5 2 HPRT1 1 1 1 0.5 1.1 0.6
CIDEA 1.1 1.1 1.2 2 2.6 0.6 RPLP0 1.1 1 1.2 1.1 0.8 1.1
CIDEB 1.3 1.1 1.5 1.2 0.9 1

KLM1 cells were treated with Act D 10 ng/mL with or without 100 ng/mL RG7787 or RH16 cells were treated with Act D at 5 ng/mL and RG7787 (200 ng/mL) for 24 h. Total RNA was extracted, and reverse transcription and real-time PCR were performed with an apoptotic array kit (Qiagen). The numbers are generated using web-based data analysis (Qiagen) by setting the untreated control as 1 and using ACTB, B2M, GAPDH, HPRT1, and RPLP0 as internal controls.

Table 2.

Genes affected by Act D or RG7787 using apoptotic array

KLM1 RH16
Symbol Act D RG7787 Comb Act D RG7787 Comb
TNFα 10 147.6 103.1 1.2 6.9 11.2
TNFβ 1.2 7.5 13.4 4.8 2.9 3.5
TNFSF7 (CD70) 2.7 4.1 3.3 1.6 1 2.8
Fas 1.1 2.4 1 5.9 0.1 6.1
TRAILR2/DR5 2.7 8.3 4.6 2 1 3.9
TNFR2 10.5 15.5 8.1 0.5 0.6 0.4
TNFRSF9 (CD137) 4.6 68.8 15.7 0.7 4.5 2.8
TNFRSF7 (CD27) 3.4 0.2 0.2 2.4 0.5 1.8
Caspase-1 0.7 0.3 0.4 15 1.3 13.5
Caspase-10 2.1 1.9 3 3.6 1.5 5.4
Caspase-3 2.9 1.4 3.8 1.8 1.6 2.4
Caspase-5 2.8 0.7 5.6 2.8 1.3 3.5
Caspase-7 3.4 1.1 2.2 1.2 0.9 1.8
Caspase-9 1.9 2.4 3.2 1 3.4 2.4
Bcl-10 2.2 4.3 3.2 2.3 1.9 3.9
BCL2A1 3.4 7.4 21.6 2.1 19.2 22.6
Bim 3.1 0.7 2.3 1.8 0.7 1.7
Bik 1.8 6.1 3.6 2.5 1.1 4.1
CIAP2 4.7 46.3 13.2 8.6 5.7 9.8
GADD45A 4.1 63.1 30 4.5 4.1 21.2
TP53 2.4 5.6 8.8 1.5 1.1 1.6
TP53BP2 1.6 5.8 3.7 1.6 1.7 1.8
RIPK2 2.3 2.9 2.2 3.1 2.4 4.8

KLM1 or RH16 cells were treated with Act D (KLM1, 10 ng/mL; RH16, 5 ng/mL) or RG7787 (KLM1, 100 ng/mL; RH16, 200 ng/mL) for 24 h. Then total RNA was isolated and apoptotic array performed. The numbers are generated using web-based data analysis (Qiagen) by setting the untreated control as 1 and using ACTB, B2M, GAPDH, HPRT1, and RPLP0 as the internal control. The genes that changed over threefold were selected and presented in the table.

To confirm the array findings, we chose several genes with the largest changes and performed real time-PCR using KLM1 RNA. As seen in Table S3, TNFα and TNFβ were elevated from 10- to 98-fold by either Act D, RG7787, or the combination. The TNFR family member CD137 was elevated 56-fold by RG7787 alone, and DR5 increased two- to threefold. The other NF-κB target genes—BCL2A1, BIK, CIAP2, and GADD45α—were also found to be elevated. We also performed real-time PCR with RNA from RH16 cells and confirmed the increased expression of the same genes as seen in the apoptotic RNA array experiments with RH16 cells (Table S2).

Table S3.

Real-time PCR confirmation of selected genes

KLM1 RH16
Symbol Act D RG7787 Comb Act D RG7787 Comb
TNFα 13.8 98.5 71.8 1 20.1 24.9
TNFβ 9.1 10.6 31.4 7.3 15.5 37.1
Fas 0.6 0.9 0.4 12.2 1.3 11.3
TRAILR2/DR5 1.8 3.2 2 2.3 1 4
TNFRSF9 (CD137) 3.6 56.1 14.7 1.6 3.5 2.8
Bcl-10/ 2.2 4.3 3.2 7 1.7 4.7
BCL2A1 1.9 1.2 4.6 0.9 8.2 5.4
Bik 3.7 3.2 5.3 1.4 0.8 5.3
CIAP2 4.9 41.5 8.4 13.9 4.7 11.8
GADD45α 4.2 73.2 33 3 5.3 23.1

KLM1 and RH16 cells were treated with 10 ng/mL Act D without 100 ng/mL RG7787 (KLM1) or 5 ng/mL Act D without RG7787 200 ng/mL (RH16) for 24 h; the total RNA were isolated and reverse-transcribed, and real-time PCR was performed using primers as indicated. The fold changes were normalized to actin as an internal control. The numbers were generated from triplicate PCR reactions and setting the untreated control as 1.

Changes in Proteins of the NF-κB Pathway.

Because activation of the TNF/TNFR pathway increases the activity or expression of NF-κB, we examined levels of proteins in the NF-κB pathway using KLM1 cells. Fig. 4B shows that P-MAPK (T202/Y204), the kinase that phosphorylates NF-κB, is undetectable in control cells, slightly increased in Act D-treated cells, dramatically elevated by RG7787, and further elevated by the combination. We also observed that total MAPK is increased by treatment with Act D, RG7787, or the combination. P-NF-κB (S536), which is the activated form of NF-κB, was also increased by Act D, RG7787, or combination treatment (1.8-, 2.7-, and 3.3-fold, respectively). Total NF-κB was only slightly increased (less than twofold). To confirm that NF-κB was activated, we isolated the nuclear fraction of cells, in which the activated form of NF-κB accumulates. As shown in Fig. 4C, nuclear NF-κB levels were increased 3.1-fold by Act D treatment, and over 50-fold by RG7787, and by combination treatment.

Role of TNF Family Members.

Because RNA and protein of members of the TNF/TNFR family were increased by Act D, we investigated if TNFα family members could have a direct role in RG7787-mediated cell killing. As shown in Fig. 5A, cells treated with either FASL or Trail or TNFα did not undergo cell death. However, when combined with RG7787, these agents increased cell death but not to the extent produced by Act D.

Fig. 5.

Fig. 5.

(A) TNF family members can stimulate RG7787 and Act D cell killing. KLM1 cells were incubated with 10 ng/mL of TNFα, FasL, or TRAIL with or without 10 ng/mL RG7787 for 3 d. The dead cells were measured by FACS after labeling with annexin V and 7AAD. Dead cells (%) represent the effects of the drug-treated group by subtracting the dead cells from untreated control cells. Graphs are generated from an average of at least two separate experiments. (B) Act D stimulated other protein synthesis inhibitors’ killing of KLM1 cells. KLM-1 was incubated with 10 ng/mL Act D with or without 200 ng/mL CHX, 90 pg/mL DT, 30 ng/mL PE, or 5 pg/mL HB21-FvPE40 (HB21), 1 μg/mL of gelonin (Gel) for 3 d. The dead cells were measured and graphed as described in A.

Effect of Act D with Other Inhibitors of Protein Synthesis.

There are a variety of protein toxins that kill cells by inhibiting protein synthesis. Diphtheria toxins (DPs) like PE ADP-ribosylates EF-2, whereas Gelonin inactivates the 60S ribosomal subunit. These toxins are also used to make immunotoxins (22, 23). To determine if there is also enhancement by Act D, KLM-1 cells were exposed to Act D and various toxins for 72 h and cell death was measured by flow cytometry. Because we do not have immunotoxins containing these toxins, we compared their activities with native PE. We find that killing of cells by Act D combined with PE or DT or Gelonin is more than additive (Fig. 5B). These data also show that Act D-stimulated cell killing is not mesothelin-dependent.

Discussion

We have found that Act D has remarkable synergy with immunotoxins targeting mesothelin-expressing malignancies. RNA and protein analyses showed that cells treated with RG7787 activated both the intrinsic and extrinsic apoptotic pathways. The synergy was found in various epithelial tumors with mesothelin expression. We also found the stimulatory effect of Act D is not restricted to PE-containing immunotoxins, because Act D also enhanced the killing of cells by other toxins that inhibit protein synthesis.

Act D is an old drug developed before apoptosis and other mechanisms of cell death were elucidated. It was developed as an anticancer agent in the 1950s and approved for treatment of humans in the 1960s (8). It is known that Act D can bind to GC-rich regions in DNA duplexes and is especially effective at disruption of ribosome RNA biogenesis (9, 10). It is also known that Act D is cytotoxic when used at high concentrations. In this study, we used relatively low (5–10 ng/mL) concentrations of Act D. Analysis of RNA arrays showed that the levels of RNA for the majority of the 86 genes in the apoptotic array, including several house-keeping genes, were not decreased in a major way compared with untreated cells. A decrease should have been observed if overall RNA synthesis had been inhibited. Instead, for many genes the levels of RNA were increased. The most affected genes are TNF/TNFR family members [TNFα, TNFβ, TNFR2 (KLM1), CD27, CD70 (KLM1), CD137 (KLM1), and TRAILR2/DR5, FAS (RH16)], NF-κB–regulated genes (BCL2A1, CIAP2, BCL10, GADD45α), caspase family members (Caspase-1, -3, -5, -7, -9, and -10, which vary between the two cell lines), and others (BIM and RIPK2). Both BIM RNA and protein were elevated by Act D treatment but not by RG7787. BIM is located in mitochondria and plays an important role in promoting apoptosis (24).

It is noteworthy that GADD45α is a target of both NF-κB and p53. It has been shown that Act D can stabilize p53 in the nucleolus and that targets of P53 are activated (10, 25). We found that Act D has very little effect on total NF-κB protein, but it enhances phosphorylation of NF-κB and its accumulation in the nucleus. It is likely the dramatic increase in GADD45α RNA could be due to both p53 and NF-κB accumulation in the nucleus.

We previously reported that immunotoxins targeting mesothelin-expressing cells sensitize the cells to killing by TRAIL (26), but we did not examine the mechanism of this effect. Our finding that RG7787 increases expression of TNFα, TNFβ, FAS, CD127, and DR5 and DR5 protein provides an explanation for that result. We also found that RG7787 activated the NF-κB pathway. NF-κB RNA increased in the apoptotic arrays from both KLM1 and RH16 cells (Table S1). Also NF-κB p65 phosphorylation and total NF-κB in the nuclear fraction were elevated. Expression of BCL10, CIAP2, and two NF-κB–regulated genes was also increased. It was recently reported that loss of diphthamide, which is an essential component for EF-2–ADP ribosylation, activates NF-κB and renders cells hypersensitive to TNF-mediated apoptosis (27). It is also possible that the arrest of protein synthesis caused by RG7787 induces cell stress, activates MAPK P38, and leads to phosphorylation of NF-κB, thereby sensitizing cells to apoptosis.

When we compared the RNAs that were increased by treatment with Act D and RG7787, we found many of the same RNAs were increased, suggesting that the two agents have overlapping mechanisms of action. Genes whose expression was increased include many members of the BCL-2 family (BIM, BID, BCL10, and BCL2A1), the Caspase family [Caspase-1 (RH16)], Caspase-10, Caspase-5, and Caspase-7 (KLM1)], and members of the TNF and TNFR family [TNFα and TNFβ (RH16), CD137, DR5, TNFR2 (KLM1), and Fas (RH16)]. These changes occurred in both KLM-1 and RH16 cells, indicating the changes are not limited to one type of cancer cell. In some but not all cases, the increase was larger in doubly treated cells (also seen in Fig. S3). The importance of the variable increase between singly and doubly treated cells is not clear, because we only measured RNA levels in cells after a 24-h treatment and some cells may have been dying, which could alter RNA levels. Possibly the increase in RNA will be larger in doubly treated cells.

The mechanism by which Act D and RG7787 act synergistically to kill target cells is complex. Most prominently, Act D dramatically enhanced RG7787-induced increases of cleaved Caspase-3, -8, and -9 and PARP. The enhancement could come from activation of NF-κB–mediated signaling. Secondly, Act D can interfere with ribosomal biogenesis and causes stabilization of P53 in the nucleolus (25). Increased P53 was shown to orchestrate a transcriptional response to stress and cause cell-cycle arrest and cell death (12). We observed an increase of both p53 and p53BP RNA in the KLM1 cells. We also found that the p53 responsive gene GADD45α increased in KLM1 and RH16 cells, which can lead to growth arrest. Because the addition of TNFα, FASL, or Trail produced only a small increase in cell death when combined with RG7787 whereas Act D addition is very potent (Fig. 5A), we conclude that Act D enhancement of RG7787 cytotoxic activity involves more genes and pathways than just death receptor-mediated cell death. Finally, our data strongly support the use of Act D to enhance immunotoxin action in humans.

Materials and Methods

RG7787 was made at Roche. Act D, TNFα, FasL, and TRAIL were from Sigma. Antibodies to EF-2; anti-BAX; BCLxl; BIM; Caspase-3, -8, and -9; cleaved Caspase-3, -8, and -9; PAPP; MAPK; P-MAPK (Thr180/Tyr182); CIAP2; RelA/p65 (NF-κB); and P-NF-κB (Ser-536) were from Cell Signaling; anti-DR5 was from ProSci. KLM1, AsPC1 (21), MKN28 (28), and KB31 (29) were all described. L55 was from S. Albelda, University of Pennsylvania, Philadelphia. NCI-Meso16 (RH16) was from R. Hassan, National Cancer Institute, National Institutes of Health, Bethesda, MD, and grown as described (29). Flow cytometry, ADP ribosylation of eEF-2, and real-time PCR were as described (30). Primers are listed in Table S4. Apoptotic array followed the manufacturer’s instructions (Qiagen). To make tumors, two million KLM1 or MKN28 cells were implanted s.c. into athymic nude mice. Mice received two cycles of treatment. Act D (0.6 mg/kg) was injected i.p. once a week for 2 wk; RG7787 was injected i.v. (2.5 mg/kg) three doses every other day for 2 wk. Tumor volumes were measured and calculated as described (21). The animal protocol was approved by the National Cancer Institute Animal Care and Use Committee.

Table S4.

PCR primer sequences

Gene name Orientation Primer sequences
FAS Forward AGATTGTGTGATGAAGGACATGG
Reverse TGTTGCTGGTGAGTGTGCATT
GADD45 Forward GAGAGCAGAAGACCGAAAGGA
Reverse CACAACACCACGTTATCGGG
TNFα Forward GAGGCCAAGCCCTGGTATG
Reverse CGGGCCGATTGATCTCAGC
TNFβ Forward CATCTACTTCGTCTACTCCCAGG
Reverse CCCCGTGGTACATCGAGTG
DR5 Forward GCCCCACAACAAAAGAGGTC
Reverse AGGTCATTCCAGTGAGTGCTA
CD137 Forward TCCACCAGCAATGCAGAGTG
Reverse CCAAAGCAACAGTCTTTACAACC
BCL10 Forward TCTGGACACCCTTGTTGAATCT
Reverse TGGAAAAGGTTCACAACTGCTAC
BCL12A1 Forward TACAGGCTGGCTCAGGACTAT
Reverse CGCAACATTTTGTAGCACTCTG
BIK Forward GACCTGGACCCTATGGAGGAC
Reverse CCTCAGTCTGGTCGTAGATGA
CIAP2 Forward TTTCCGTGGCTCTTATTCAAACT
Reverse GCACAGTGGTAGGAACTTCTCAT

Acknowledgments

This work was supported by the Intramural Research Program of the NIH, National Cancer Institute (NCI), Center for Cancer Research, and a Cooperative Research and Development Agreement between NCI and Roche.

Footnotes

The authors declare no conflict of interest.

1Retired.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1611481113/-/DCSupplemental.

References

  • 1.Pastan I, Hassan R, Fitzgerald DJ, Kreitman RJ. Immunotoxin therapy of cancer. Nat Rev Cancer. 2006;6(7):559–565. doi: 10.1038/nrc1891. [DOI] [PubMed] [Google Scholar]
  • 2.Wayne AS, Fitzgerald DJ, Kreitman RJ, Pastan I. Immunotoxins for leukemia. Blood. 2014;123(16):2470–2477. doi: 10.1182/blood-2014-01-492256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Du X, Youle RJ, FitzGerald DJ, Pastan I. Pseudomonas exotoxin A-mediated apoptosis is Bak dependent and preceded by the degradation of Mcl-1. Mol Cell Biol. 2010;30(14):3444–3452. doi: 10.1128/MCB.00813-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Weldon JE, Pastan I. A guide to taming a toxin--Recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer. FEBS J. 2011;278(23):4683–4700. doi: 10.1111/j.1742-4658.2011.08182.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Hassan R, et al. Phase I study of SS1P, a recombinant anti-mesothelin immunotoxin given as a bolus I.V. infusion to patients with mesothelin-expressing mesothelioma, ovarian, and pancreatic cancers. Clin Cancer Res. 2007;13(17):5144–5149. doi: 10.1158/1078-0432.CCR-07-0869. [DOI] [PubMed] [Google Scholar]
  • 6.Hassan R, Ho M. Mesothelin targeted cancer immunotherapy. Eur J Cancer. 2008;44(1):46–53. doi: 10.1016/j.ejca.2007.08.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hassan R, Alewine C, Pastan I. New life for immunotoxin cancer therapy. Clin Cancer Res. 2016;22(5):1055–1058. doi: 10.1158/1078-0432.CCR-15-1623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Farber S, D’Angio G, Evans A, Mitus A. Clinical studies on actinomycin D with special reference to Wilms’ tumor in children. Ann N Y Acad Sci. 1960;89:421–425. doi: 10.1111/j.1749-6632.1960.tb20165.x. [DOI] [PubMed] [Google Scholar]
  • 9.Bensaude O. Inhibiting eukaryotic transcription: Which compound to choose? How to evaluate its activity? Transcription. 2011;2(3):103–108. doi: 10.4161/trns.2.3.16172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Burger K, et al. Chemotherapeutic drugs inhibit ribosome biogenesis at various levels. J Biol Chem. 2010;285(16):12416–12425. doi: 10.1074/jbc.M109.074211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Andersen JS, et al. Nucleolar proteome dynamics. Nature. 2005;433(7021):77–83. doi: 10.1038/nature03207. [DOI] [PubMed] [Google Scholar]
  • 12.Rao B, Lain S, Thompson AM. p53-based cyclotherapy: Exploiting the ‘guardian of the genome’ to protect normal cells from cytotoxic therapy. Br J Cancer. 2013;109(12):2954–2958. doi: 10.1038/bjc.2013.702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Falini B, Brunetti L, Martelli MP. Dactinomycin in NPM1-mutated acute myeloid leukemia. N Engl J Med. 2015;373(12):1180–1182. doi: 10.1056/NEJMc1509584. [DOI] [PubMed] [Google Scholar]
  • 14.Fulda S, Debatin K-M. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene. 2006;25(34):4798–4811. doi: 10.1038/sj.onc.1209608. [DOI] [PubMed] [Google Scholar]
  • 15.Azijli K, Weyhenmeyer B, Peters GJ, de Jong S, Kruyt FA. Non-canonical kinase signaling by the death ligand TRAIL in cancer cells: Discord in the death receptor family. Cell Death Differ. 2013;20(7):858–868. doi: 10.1038/cdd.2013.28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Wei MC, et al. tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev. 2000;14(16):2060–2071. [PMC free article] [PubMed] [Google Scholar]
  • 17.Brenner D, Blaser H, Mak TW. Regulation of tumour necrosis factor signalling: Live or let die. Nat Rev Immunol. 2015;15(6):362–374. doi: 10.1038/nri3834. [DOI] [PubMed] [Google Scholar]
  • 18.Oeckinghaus A, Hayden MS, Ghosh S. Crosstalk in NF-κB signaling pathways. Nat Immunol. 2011;12(8):695–708. doi: 10.1038/ni.2065. [DOI] [PubMed] [Google Scholar]
  • 19.Ravi R, et al. Regulation of death receptor expression and TRAIL/Apo2L-induced apoptosis by NF-kappaB. Nat Cell Biol. 2001;3(4):409–416. doi: 10.1038/35070096. [DOI] [PubMed] [Google Scholar]
  • 20.Mason-Osann E, Hollevoet K, Niederfellner G, Pastan I. Quantification of recombinant immunotoxin delivery to solid tumors allows for direct comparison of in vivo and in vitro results. Sci Rep. 2015;5:10832. doi: 10.1038/srep10832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hollevoet K, et al. In vitro and in vivo activity of the low-immunogenic antimesothelin immunotoxin RG7787 in pancreatic cancer. Mol Cancer Ther. 2014;13(8):2040–2049. doi: 10.1158/1535-7163.MCT-14-0089-T. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lyu MA, Cao YJ, Mohamedali KA, Rosenblum MG. Cell-targeting fusion constructs containing recombinant gelonin. Methods Enzymol. 2012;502:167–214. doi: 10.1016/B978-0-12-416039-2.00008-2. [DOI] [PubMed] [Google Scholar]
  • 23.Li YM, Vallera DA, Hall WA. Diphtheria toxin-based targeted toxin therapy for brain tumors. J Neurooncol. 2013;114(2):155–164. doi: 10.1007/s11060-013-1157-8. [DOI] [PubMed] [Google Scholar]
  • 24.Harada H, Grant S. Targeting the regulatory machinery of BIM for cancer therapy. Crit Rev Eukaryot Gene Expr. 2012;22(2):117–129. doi: 10.1615/critreveukargeneexpr.v22.i2.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Rubbi CP, Milner J. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses. EMBO J. 2003;22(22):6068–6077. doi: 10.1093/emboj/cdg579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Du X, Xiang L, Mackall C, Pastan I. Killing of resistant cancer cells with low Bak by a combination of an antimesothelin immunotoxin and a TRAIL Receptor 2 agonist antibody. Clin Cancer Res. 2011;17(18):5926–5934. doi: 10.1158/1078-0432.CCR-11-1235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Stahl S, et al. Loss of diphthamide pre-activates NF-κB and death receptor pathways and renders MCF7 cells hypersensitive to tumor necrosis factor. Proc Natl Acad Sci USA. 2015;112(34):10732–10737. doi: 10.1073/pnas.1512863112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Alewine C, et al. Efficacy of RG7787, a next-generation mesothelin-targeted immunotoxin, against triple-negative breast and gastric cancers. Mol Cancer Ther. 2014;13(11):2653–2661. doi: 10.1158/1535-7163.MCT-14-0132. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liu XF, FitzGerald DJ, Pastan I. The insulin receptor negatively regulates the action of Pseudomonas toxin-based immunotoxins and native Pseudomonas toxin. Cancer Res. 2013;73(7):2281–2288. doi: 10.1158/0008-5472.CAN-12-3436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Liu X, Müller F, Wayne AS, Pastan I. Protein kinase inhibitor H89 enhances the activity of Pseudomonas exotoxin A-based immunotoxins. Mol Cancer Ther. 2016;15(5):1053–1062. doi: 10.1158/1535-7163.MCT-15-0828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lehár J, et al. Synergistic drug combinations tend to improve therapeutically relevant selectivity. Nat Biotechnol. 2009;27(7):659–666. doi: 10.1038/nbt.1549. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES