Skip to main content
NCBI home page
Cellular and Molecular Immunology logoLink to Cellular and Molecular Immunology
. 2015 Jul 20;13(5):669–677. doi: 10.1038/cmi.2015.50

Interleukin-13 interferes with activation-induced t-cell apoptosis by repressing p53 expression

Li Yang 1,2, Ling-Zhi Xu 3, Zhi-Qiang Liu 3,4,4, Gui Yang 3,4,4, Xiao-Rui Geng 3,4,4, Li-Hua Mo 3, Zhi-Gang Liu 3, Peng-Yuan Zheng 2, Ping-Chang Yang 3
PMCID: PMC5037282  PMID: 26189367

Abstract

The etiology and the underlying mechanism of CD4+ T-cell polarization are unclear. This study sought to investigate the mechanism by which interleukin (IL)-13 prevents the activation-induced apoptosis of CD4+ T cells. Here we report that CD4+ T cells expressed IL-13 receptor α2 in the intestine of sensitized mice. IL-13 suppressed both the activation-induced apoptosis of CD4+ T cells and the expression of p53 and FasL. Exposure to recombinant IL-13 inhibited activation-induced cell death (AICD) along with the expression of p53, caspase 3, and tumor necrosis factor-α in CD4+ T cells. Administration of an anti-IL-13 antibody enhanced the effect of specific immunotherapy on allergic inflammation in the mouse intestine, enforced the expression of p53 in intestinal CD4+ T cells, and enhanced the frequency of CD4+ T-cell apoptosis upon challenge with specific antigens. In summary, blocking IL-13 enhances the therapeutic effect of antigen-specific immunotherapy by regulating apoptosis and thereby enforcing AICD in CD4+ T cells.

Keywords: activation-induced cell death, apoptosis, interleukin 13, T lymphocytes, Th2 polarization

Introduction

CD4+ T-cell polarization plays an important role in a number of immune disorders, such as allergic asthma,1 allergic dermatitis,2 and inflammatory bowel disease.3 A common feature of these illnesses is the higher number of CD4+ T cells, together with the higher level of T-helper (Th)2 cytokines, in the inflammatory tissue and peripheral blood.4 The factors that initiate CD4+ T-cell polarization is not yet completely understood.

Maintaining proper T-cell homeostasis is critical for human health; therefore, several associated regulatory mechanisms have been recognized, including the induction of T-cell anergy, the generation of regulatory T cells, and activation-induced cell death (AICD). After activation, most T cells, including Th1, Th2, or CD8+ T cells, become apoptotic and die; this phenomenon is known as AICD. This mechanism controls the size of activated T-cell populations after initial expansion and is critical to maintaining immune homeostasis.5 However, in some immune disorders, the mechanism of AICD is impaired. In these disorders, although CD4+ T cells still express Fas, the death receptor, AICD is blocked by unknown mechanisms. It has been suggested that Th2 cytokines may be responsible for preventing AICD in activated CD4+ T cells in immune inflammation;6 however, the underlying mechanisms require further investigation.

Apoptosis is the major pathway of AICD. Upon activation, T cells often become apoptotic and are soon eliminated to avoid tissue damage. Fas and FasL are the major mediators of AICD.6 Apart from Fas/FasL, a number of other molecules are involved in the course of apoptosis, including Bax, Bcl-2, and p53. The p53 protein is also called tumor suppressor protein because it induces apoptosis in tumor cells, preventing further tumor formation and growth.7 Deregulation of p53 has been proposed to play an important role in the pathogenesis of tumors.7 The p53 protein can modulate the cell cycle, repair damaged DNA, and initiate apoptosis when damaged DNA cannot be repaired. The role of skewed CD4+ T-cell polarization in immune inflammation is mediated by a dysfunction of apoptosis of CD4+ T cells, though the functions of p53 in this process have not been fully investigated.

Interleukin (IL)-13 plays a critical role in the pathogenesis of immune inflammation.8 Recent reports indicate that IL-13 may play an important role in the innate immune response because this molecule can be released by injured or inflamed epithelia.9 We hypothesize that IL-13 induces the dysfunction of p53 in CD4+ T cells, which results in the induction of skewed CD4+ T-cell polarization. In this study, we observed that CD4+ T cells from sensitized mice expressed IL-13R2α. Exposure to IL-13 interfered with AICD-induced CD4+ T-cell apoptosis, and blocking IL-13 enforced the efficacy of antigen-specific immunotherapy (ASIT).

Materials and methods

Reagents

The ovalbumin (OVA)-specific IgE enzyme-linked immunosorbent assay (ELISA) kit was purchased from EIAab (Wuhan, China). The ELISA kit for IL-4 and neutralizing anti-IL-13 mAb werepurchased from R&D Systems (Shanghai, China). Reagents for quantitative real-time polymerase chain reaction (qRT-PCR) and western blotting were purchased from Invitrogen (Shanghai, China). Antibodies specific for p53, Bax, Bcl-2, FasL, CD3, CD28, mouse mast cell protease-1 (mMCP-1), major basic protein, p53 shRNA, and STAT6 shRNA were purchased from Santa Cruz Biotech (Guangzhou, China). Magnetic bead-conjugated antibodies were purchased from Miltenyi Biotec (Shanghai, China). The Annexin V kit, protein A Sepharose beads, ChIP kit, phorbol-12-myristate-13-acetate (PMA), and ionomycin were purchased from Sigma Aldrich (Shanghai, China). The DNA purification kit was purchased from Promega (Beijing, China).

Mice

Male BALB/c mice and DO11.10 mice (6–8 weeks old) were obtained from the Beijing Experimental Animal Center and were maintained in a pathogen-free environment. The experimental procedures were approved by the Animal Ethics Committee at Zhengzhou University and Shenzhen University.

Establishment of intestinal allergic inflammation in mice

BALB/c mice were orally administered 50 μg of OVA mixed with 10 µg of cholera toxin weekly for four weeks. One week later, the mice were killed, and samples were taken from individual mice for analysis. The sera were collected, and the levels of IL-4, IL-5, IL-13, and OVA-specific IgE were measured by ELISA, using commercial kits. Lamina propria mononuclear cells (LPMCs) were isolated from the small intestine with the procedures described below. CD4+ T cells were further isolated with commercial reagent kits following the manufacturer's instructions. The core temperature of the mice was recorded by measuring the temperature in the rectum with a digital thermometer before and 30 min after the oral challenge with OVA. The mice were also observed for 2 h to record diarrhea after the OVA challenge. Jejunal segments were excised for immunohistochemical analysis. Each group consisted of six mice. Samples from individual mice were processed separately. The body weight was recorded weekly.

Isolation of lamina propria mononuclear cells

The small intestine was opened longitudinally and washed in saline to remove adherent debris. To remove the epithelium, tissue was incubated in a shaking water bath at 37°C for 30 min in calcium-magnesium-free HBSS containing 1 mM EDTA, 50 μg/mL gentamicin, 100 U/mL penicillin, and 100 μg/mL streptomycin. The intestinal tissue was then cut into smaller pieces and digested in a shaking water bath at 37°C for 1 h with 0.5 mg/mL collagenase and 1 mg/mL hyaluronidase in RPMI 1640. Cells were pelleted by centrifugation (500g for 5 min), resuspended in RPMI 1640 medium, and then filtered through a 70-μm cell strainer. The filtrate was then centrifuged over a Ficoll-Hypaque density gradient. LPMC were recovered, washed twice in RPMI 1640 medium, and the cells were cultured for further experiments.

Isolation of CD4+ T cells

The CD4+ CD25− T cells were isolated from the mouse spleens and intestine using CD4 and CD25 microbeads according to the manufacturer's protocol. The CD4+ T cells were isolated first, and this was followed by collection of the CD25+ T cells. The purity of the CD4+ CD25− T cells was >98%, as checked by flow cytometry.

Cell culture

Cells were cultured at 37°C and 5% CO2 in RPMI 1640 medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 2 mM L-glutamine, and 0.1 mg/mL streptomycin. The medium was changed every three days.

Viability assay of cultured cells

Cells were collected from the culture and the viability of the cells was assessed by the trypan blue exclusion assay.

Induction of AICD in vitro

Isolated CD4+ T cells were cultured in the presence of PMA (10 ng/mL) overnight for preactivation. The cells were collected, washed with culture medium, and cultured in a microplate coated with 10 μg/mL anti-CD3 mAb. Soluble anti-CD28 mAb (5 μg/mL) was added to the culture for costimulation. Three days later, cells were stained with propidium iodide (PI; 5 µg/mL; 15 min) and Annexin V reagents according to the manufacturer's protocol. The cells were analyzed by flow cytometry.

Flow cytometry

Cells were fixed with 2% paraformaldehyde for 2 h, and 0.1% Triton X-100 was added to the fixative in cases of intracellular staining. After blocking with 1% bovine serum albumin (BSA) for 30 min, the cells were incubated with the fluorochrome-labeled antibodies for 1 h at room temperature. After washing with PBS, the cells were analyzed by a flow cytometer (FACSCanto I, BD Biosciences, Shanghai, China).

Quantitative real-time polymerase chain reaction

With the TRIzol reagent, the total RNA was extracted from the cultured cells. The cDNA was synthesized with a reverse transcription reagent kit. qPCR was performed with a MiniOpticon PCR system (Bio-Rad Life Science, Shanghai, China). The results were calculated with the 2−ΔΔCt method and are presented as relative changes. The primers used in the study are listed in Table 1.

Table 1. Primers used in this study.

Molecules Forward primers Reverse primers NCBI number
FasL tcagatgcaagtgagtgggt gggtaattcatgggctgctg NM_010177.4
Bcl-2 ttgtaattcatctgccgccg aatgaatcgggagttggggt NM_007527.3
Bax tcatgaagacaggggccttt gtccacgtcagcaatcatcc NM_007527.3
p53 acagtcggatatcagcctcg gcttcacttgggccttcaaa AB021961
Open in a new tab

Immunoprecipitation

Cell lysates were mixed with 3 μg of either IL-13Rα2 or anti-STAT6 antibody overnight at 4°C and then precipitated with 40 μl of protein A Sepharose beads overnight at 4°C. After washing with lysis buffer three times, the beads were incubated with SDS loading buffer, boiled for 10 min, and subjected to western blotting.

Western blotting

Total protein was extracted from cells, separated by the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto a nitrocellulose membrane. The membrane was blocked with 5% skim milk for 30 min at room temperature, incubated with the primary antibodies (50–100 ng/mL), and then incubated with the secondary antibodies (conjugated to horseradish peroxidase). The membrane was washed with Tris-buffered saline and Tween 20 (TBST) after antibody incubation. The immune complex on the membrane was developed with enhanced chemiluminescence and the results were imaged using the UVP BioSpectrum Imaging System (Upland, CA, USA).

ELISA

The levels of OVA-specific IgE, IL-4, IL-5, and IL-13 were determined by ELISA with commercial kits following the manufacturers' instructions.

Chromatin immunoprecipitation (ChIP)

The cells were fixed with 1% formaldehyde and digested with micrococcal nuclease to induce optimal genomic DNA fragmentation. The cells were then lysed in lysis buffer and sonicated; immunoprecipitation was performed with the samples and antibodies specific for IL-13Rα2, pSTAT6, or IgG. A portion of the DNA was set aside for use as the input DNA. The antibody-protein-DNA complex was precipitated by adding the protein A Sepharose beads. Then, the complex was treated with proteinase K at 65°C to obtain the IP DNA, which was purified afterwards. With the IP DNA, the relative amount of accessible p53-promoter DNA was analyzed by qPCR (MiniOpticon PCR system, Bio-Rad Life Science). The primers used were: forward, agagtgcattaccgttccca; reverse, tgaggtgtaggcaaagtcgt. The enriched DNA after qPCR was presented as the % of input.

RNA interference (RNAi)

The p53 gene in CD4+ T cells was knocked down by RNAi with purchased reagent kits (p53 shRNA Lentiviral Particles: sc-44219-V) following the manufacturer's instruction (see website for details: http://www.scbt.com/protocols.html?protocol=crispr_lenti_activation). The gene knockdown effect was checked by western blotting.

ASIT

The sensitized mice were treated with oral ASIT according to published procedures10 with minor modifications. Briefly, OVA was gavage-fed with doses of 1 mg (days 1 and 2), 5 mg (days 3 and 4), 10 mg (days 5–7), 25 mg (days 8 and 9), and 50 mg (days 10–14). Control mice were treated with saline.

Statistical analysis

The data are presented as the mean ± SD. Differences between groups were determined by ANOVA. p < 0.05 was set as the significance criterion.

Results

Allergy increases IL-13 receptor expression on CD4+ T cells in the mouse intestine

Although IL-13 is a well-known Th2 cytokine, it is unclear whether the IL-13 receptor is expressed in CD4+ T cells. To investigate this question, we sensitized mice with OVA. In addition to the Th2 response parameters detected in the mouse intestine (Figure 1a–c), IL-13Rα1 was detected on the intestinal CD4+ T cells of both naïve mice and sensitized mice. IL-13Rα2 was present at significantly higher (81.6%) levels in the CD4+ T cells of sensitized mice (Figure 1d–l) than in mesenteric lymph node CD4+ T cells (5.10%), naïve mouse spleen CD4+ T cells (4.63%), CD8+ T cells (1.63%), and B cells (2.25%), or sensitized mouse LPMC CD8+ T cells (2.43%) and B cells (2.27%) (Figure 1m–r). These results suggest that allergic reactions can up-regulate the levels of IL-13α2in CD4+ T cells of the intestine.

Figure 1.

Figure 1

Open in a new tab

CD4+ T cells express IL-13Rα2. BALB/c mice were sensitized to OVA. The sera and lamina propria mononuclear cells (LPMCs) were prepared and analyzed by ELISA and flow cytometry. a–c, ELISA data sIgE: OVA-specific IgE. b, the levels of mMCP1 (used as an indicator of mast cell activation). d, g, j, samples from allergic mice. e, h, k, samples from naïve mice. d and e, the dot plots indicate the frequency of CD4+ T cells among LPMC; the summarized frequency is presented in f. The frequencies of IL-13 receptors (α1 and α2) in the gated cell populations of d and e are presented in g, j, h, and K, respectively.m–r, the histograms show the levels of IL-13R2α in the indicated cell types. MLN, mesenteric lymph node. TC, T cell. BC, B cell. The data of bars represent the mean ± SD. *p < 0.01, compared with naïve group (a–c), or D (f), or G (i), or J (l). #p < 0.01, compared with IL-4. Each group consisted of six mice. Samples from individual mice were processed separately and represent six independent experiments.

IL-13 suppresses AICD-induced CD4+ T-cell apoptosis

The data shown in Figure 1 suggest that CD4+ T cell-produced IL-13 may modulate CD4+ T-cell activities. To test this possibility, we next stimulated the preactivated CD4+ T cells with Th2 cytokines. The results showed that recombinant IL-13 (rIL-13), but not IL-4 or IL-5, significantly increased the number of viable CD4+ T cells after reactivation (Figure 2a). To gain further insight into the underlying mechanism, CD4+ T cells were stimulated with anti-CD3/CD28 Ab and analyzed by flow cytometry. The results showed that approximately 50% of CD4+ T cells were apoptotic after reactivation and that the addition of rIL-13, but not rIL-4 or rIL-5, markedly reduced the proportion of apoptotic cells (Figure 2b–h). In addition, CD4+ CD25− T cells were labeled with carboxyfluorescein succinimidyl ester (CFSE) and stimulated with anti-CD3/CD28 with or without the addition of rIL-13 to the culture. These results showed that rIL-13 did not influence polyclonal CD4+ T-cell proliferation (Figure 2i and j). Further analysis showed that rIL-13 did not alter the activation markers CD69, CD62L, and CD44 (Figure 2k–p) in CD4+ T cells. These data suggest that rIL-13 has the capacity to reduce the frequency of AICD-induced CD4+ T-cell apoptosis.

Figure 2.

Figure 2

Open in a new tab

IL-13 attenuates AICD of CD4+ T cells. CD4+ CD25− T cells (Teff) were isolated from the mouse spleen, preactivated in the culture overnight with PMA (10 ng/mL), and cultured with anti-CD3/CD28 (Ab) for three days. Additional treatments are noted above each subpanel. The cells were analyzed by trypan blue exclusion assay and flow cytometry. a, the bars indicate the cell counts. b, the bars indicate the summarized frequency of PI+ and/or Annexin V+ cells. c–h, representative flow cytometry dot plots of PI+ and/or Annexin V+ cells. The treatments are noted above each dot plot panel. Concentrations of rIL-13, rIL-5, and rIL-4 in the culture were 30 ng/mL, 20 ng/mL, and 10 ng/mL, respectively (determined by preliminary experiments). i and j, the histograms represent the level of Teff cell proliferation (Teff cells were labeled with CFSE). k–p, the histograms indicate the frequencies of Teff phenotypes (shown below the histograms). The data in a and b represent the mean ± SD. *p < 0.01, compared to medium group. Data shown are representative of three independent experiments.

IL-13 modulates the expression of FasL, p53, Bax, and Bcl-2 in CD4+ T cells

To understand the mechanism by which IL-13 reduces AICD in CD4+ T cells, we analyzed the expression of p53, FasL, Bax, and Bcl-2 in CD4+ T cells. Compared with naïve controls, exposure to anti-CD3/CD28 Ab in the culture for 72 h significantly increased the expression of p53 in CD4+ T cells, and this effect was abolished by the addition of IL-13 to the culture (Figure 3a and b). We also assessed the expression of FasL, Bax, and Bcl-2 in the CD4+ T cells. The changes in FasL expression paralleled the changes in p53 expression (Figure 3a and c), whereas the changes in Bcl-2 expression were inversely correlated with the changes in p53 expression (Figure 3a and d). The results suggest that exposure to IL-13 suppresses the expression of p53 and FasL and increases the expression of Bcl-2 in CD4+ T cells. To further confirm the results, we isolated CD4+ CD25− T cells from BALB/c mice (Figure 3g–l) and DO11.10 mice (Figure 3m–r). The cells were reactivated in culture. The results showed that reactivation-induced CD4+ T-cell apoptosis was inhibited by the presence of rIL-13, and this effect was abolished by knockdown of the p53 gene in CD4+ T cells (Figure 3g–r).

Figure 3.

Figure 3

Open in a new tab

IL-13 modulates the expression of p53, FasL, and Bcl-2 in CD4+ T cells. Naïve CD4+ T cells were activated by exposure to anti-CD3 (10 μg/mL)/-CD28 (2 μg/mL) antibodies (Ab) and/or IL-13 (30 ng/mL) in the culture for 72 h. The cell extracts were analyzed by qRT-PCR and western blotting. a, the bars indicate the mRNA levels of p53, FasL, Bcl-2, and Bax. b–f, the western blots indicate the levels of p53 (b, c), FasL (d), Bcl-2 (e), and Bax (f). The saline and BSA are control reagents. c, the results of p53 gene silencing. g–n, the histograms indicate apoptotic cells. g–l, cells are from naïve mice. m–r, cells are from DO11.10 mice ((cultured in the presence of OVA (5 μg/mL) and DC (DC:T cell = 2 × 105:1 × 106/mL)). P53 null: cells were treated with p53 shRNA. l, The bars show the summarized data of g–k. r, The bars show the summarized data of m–q. The data bars represent the mean ± SD; *p < 0.01, compared with saline group (a), or G (l), or M (r). Data shown are representative of three independent experiments.

IL-13 modulates p53 gene transcription in CD4+ T cells

The data in Figure 3 indicate that after activation, the expression of p53 is increased and that exposure to IL-13 in culture suppresses p53 expression in activated CD4+ T cells. We next assessed the p53 gene transcription status in CD4+ T cells. The results showed that, after exposure to rIL-13 in the culture for 48 h, the levels of pSTAT6 increased in CD4+ T cells in an rIL-13 dose-dependent manner (Figure 4a). A complex of pSTAT6 and IL-13Rα2 was detected in the cell extracts of the CD4+ T cells (Figure 4b). A ChIP assay also showed that the complex of pSTAT6 and IL-13Rα2 bound to the p53 promoter (Figure 4c). Thus, exposure to rIL-13 repressed the expression of p53 at both the mRNA (Figure 4d) and the protein (Figure 4e) level.

Figure 4.

Figure 4

Open in a new tab

IL-13 modulates p53 transcription. CD4+ T cells in culture were stimulated with rIL-13 for 48 h. The cell extracts were analyzed. a, the western blots indicate the levels of STAT6 and pSTAT6. b, the western blots indicate a complex of pSTAT6 and IL-13Rα2. c, the bars indicate the p53-promoter binding frequency of the pSTAT6 and IL-13Rα2 complex. d, the bars indicate the mRNA levels of p53. e, the blots indicate the protein levels of p53. The bars represent the mean ± SD. *p < 0.01, compared to naïve group. The data represent three independent experiments.

Blocking IL-13 enhances the therapeutic effect of ASIT by preventing antigen-specific CD4+ T-cell polarization

The data in Figure 4 indicate that the presence of IL-13 may be a causative factor in the pathogenesis of Th2 polarization. We inferred that blocking IL-13 in an allergy environment should therefore attenuate the Th2 polarization status and promote the efficacy of immunotherapy in allergic disorders. To test this hypothesis, we created a food-allergy mouse model. Upon re-exposure to specific antigens, the food-allergy mice showed increases in serum-specific IgE (Figure 5a), serum IL-4 (Figure 5b), infiltration of mast cells and eosinophils in the intestine (Figure 5c), diarrhea (Figure 5d), and an increased drop in core temperature (Figure 5e). Decreases were observed in p53 expression in the intestine (Figure 5f). The mice were treated with specific immunotherapy with or without anti-IL-13 Ab. The results showed that the addition of anti-IL-13 Ab significantly enhanced the therapeutic efficacy by improving the allergic response in the mice and modulating the expression of p53 in the intestine (Figure 5a–f).

Figure 5.

Figure 5

Open in a new tab

Anti-IL-13 Ab enhances the effect of ASIT (antigen-specific immunotherapy). Mice were sensitized to OVA and treated with oral ASIT and/or anti-IL-13 Ab (anti-IL-13; 30 ng/g body weight; intraperitoneal; using isotype IgG as a control antibody; cAb), or BSA (a control protein; 30 ng/mL). The data represent the mean ± SD. *p < 0.01, compared with BSA group. #p < 0.01, compared with ASIT group. In panel f, the immune blots indicate the p53 levels of isolated intestinal CD4+ T cells. The table above the immune blots shows the integrated density of the immune blots. sIgE: OVA-specific IgE. Each group consisted of six mice. Samples from individual mice were processed separately.

IL-13 inhibits expression of caspase 3 and TNF-α in CD4+ T cells

Caspase 3 and TNF-α are important molecules in the induction of apoptosis. We wondered whether IL-13 suppresses the expression of caspase 3 and TNF-α in CD4+ T cells. To this end, we isolated CD4+ T cells from the LPMCs of the sensitized mice. The cells were exposed to anti-CD3/-CD28 and/or IL-13 (30 ng/mL) in culture for 48 h. As shown by RT-qPCR and western blotting, exposure to anti-CD3/-CD28 markedly increased the levels of caspase 3 and TNF-α in the CD4+ T cells, and this effect was abolished in the presence of IL-13 (Figure 6). The results indicate that IL-13 also inhibits caspase 3 and TNF-α in the intestinal CD4+ T cells in sensitized mice.

Figure 6.

Figure 6

Open in a new tab

Assessment of caspase 3 and TNF-α expression in CD4+ T cells. CD4+ T cells were isolated from the intestine of sensitized mice. The CD4+ T cells were cultured with anti-CD3/-CD28 (Ab) and/or IL-13 (30 ng/mL) for 48 h. The cells were analyzed by RT-qPCR and western blotting. a–b, the bars indicate the mRNA levels of caspase 3 (a) and TNF-α (b). c–d, the western blots indicate the protein levels of caspase 3 (a) and TNF-α (b). The bars represent the mean ± SD. *p < 0.01, compared with the medium group. The data are representative of three independent experiments.

Discussion

The reason that a large number of antigen-specific CD4+ T cells gather at sites of inflammation in immune disorders has remained an enigma. This pathological phenomenon is termed skewed CD4+ T-cell polarization. The present study reveals that, in the presence of IL-13, the AICD mechanism is dysfunctional in activated CD4+ T cells. IL-13 interferes with the apoptotic pathway in CD4+ T cells by repressing the expression of p53, caspase 3, and TNF-α. The data suggest that IL-13 plays an important role in the induction of skewed Th2 polarization and that blocking IL-13 may facilitate the regulation of skewed Th2 polarization status. This inference is supported by the data from a food-allergy animal model study. Although administration of either anti-IL-13 Ab or ASIT can ameliorate the allergic response, a combination of anti-IL-13 and ASIT significantly promotes the inhibition of allergic inflammation in the intestine.

In addition to its involvement in suppressing tumor growth, p53 is associated with many other cell activities, such as sirtuin 1-mediated anti-inflammatory and anti-oxidant activities,11 the pathogenesis of atherosclerosis,12 and the negative regulation of IgE-mediated mast cell activation.13 The present study adds novel information to study of p53 by exposing the protein's critical role in the AICD of CD4+ T cells. FasL is a major factor in the AICD of CD4+ T cells.14 In line with other reports,14 our data show that the expression of FasL was significantly increased in activated CD4+ T cells. In addition, we assessed the expression of the apoptosis-related molecules Bax and Bcl-2, which was altered in activated CD4+ T cells. This result is significant because a cell's apoptotic capacity is dependent on the balance of Bcl-2 and Bax; accordingly, the ratio of Bax and Bcl-2 protein expression is an indicator of apoptosis.15 The knockdown of p53 abolished activation-induced apoptosis of CD4+ T cells. The results highlight the critical role of p53 in the AICD of CD4+ T cells. Published data indicate that the interaction of Fas with FasL plays a major role in the induction of AICD.14 The present data show that IL-13 suppresses both FasL and p53 in CD4+ T cells, which coincides with the evasion of CD4+ T cells from AICD. These result simply that p53 may modulate FasL activity, as previous studies have proposed.16 However, further investigation is needed to definitively elucidate the underlying mechanism.

Our data show that exposure to IL-13 induces binding of the p53 promoter by a complex of IL-13Rα2 and STAT6, and this is followed by a marked suppression of p53 expression; therefore, IL-13 is a critical suppressor of p53 gene expression. Ooi et al. have suggested that IL-13 can modulate the transcription of over 100 genes.17 Our results are in line with the previous reports by showing that the addition of rIL-13 to the culture markedly represses p53 transcription. It is well documented that both IL-13 and STAT6 are involved in the pathogenesis of Th2 cell polarization in cases of allergic inflammation.18 IL-13 can increase STAT6 activity.19 There are many downstream effects of STAT6 activation, including Th2 cell differentiation,20 eosinophilic inflammation,21 and mast cell activation.22 STAT6 activation is also involved in p53 expression. Li et al. have indicated that STAT6-deficient cancer cells overexpress the p53 protein,23,24 suggesting that STAT6 represses the expression of p53. Our results show that the exposure to IL-13 represses the p53 gene expression in CD4+ T cells, which can be abolished by knockdown of p53.

The present data indicate that IL-13 plays a critical role in compromising the AICD mechanism in CD4+ T cells, which may be a causative factor in Th2 cell polarization. In conditions associated with skewed Th2 polarization, such as allergic inflammation, the high levels of Th2 cells and Th2 cytokines can be detected in the local tissue. IL-13 is one of the major Th2 cytokines. Thus, IL-13 inhibitors have been developed to inhibit allergic inflammation.25 Consistently with previous reports, our data show that treatment with anti-IL-13 Ab markedly enhanced the effect of ASIT on intestinal allergic inflammation. In addition, anti-IL-13 treatment increased the expression of p53 in CD4+ T cells and induced CD4+ T-cell apoptosis after activation, which removes the source of Th2 cytokines in the organs and tissue facing allergic inflammation and thus enhances the therapeutic effect of ASIT. IL-13 also contributes to the pathogenesis of allergies in several other respects, such as by facilitating IgE production26 and increasing the synthesis of eotaxin.27 Our data are in line with these previous studies by showing that down-regulation of the serum antigen-specific IgE, reduces tissue infiltration of mast cells and eosinophils after the administration of anti-IL-13 antibodies together with ASIT.

Previous data have also shown that IL-13 induces apoptosis in the intestinal epithelial cells, initiating inflammation in the intestine.28 The opposite effect has also been observed by others, including Singhera et al., who reported that IL-13 inhibited spontaneous and corticosteroid-induced apoptosis of normal epithelial cells in the airway.29 Our data are in line with the results reported by Singhera et al., because we show that IL-13 inhibits CD4+ T-cell apoptosis. Thus, it appears that the IL-13-mediated regulation of apoptosis depends on the conditions of the microenvironment.

To determine whether IL-13 regulates other apoptotic molecules in addition to p53, we tested the effect of IL-13 on the expression of caspase 3 and TNF-α in CD4+ T cells. It is known that caspase 3 is an important molecule in the signal transduction pathway of apoptosis.30 TNF-α is one of the inducers of apoptosis31 and functions by suppressing p53.32 The present data show that IL-13 also suppresses caspase 3 and TNF-α in the CD4+ T cells in the sensitized mouse intestine. Previous reports have also demonstrated that IL-13 inhibits TNF-α-induced caspase 3 expression and inhibits apoptosis in inflammatory environments.33

In summary, the present study reveals that IL-13 can prevent AICD of CD4+ T cells by inhibiting p53 expression. The results suggest that blocking IL-13 may enhance the therapeutic effect of ASIT.

Competing interests

None.

Authors' contributions

Li Yang, Ling-Zhi Xu, Zhi-Qiang Liu, Gui Yang, Xiao-Rui Geng, and Li-Hua Mo performed experiments, analyzed experimental data, and reviewed the manuscript. Ping-Chang Yang, Zhi-Gang Liu, andPeng-Yuan Zheng organized the study and supervised the experiments. PCY designed the project and wrote the paper

Acknowledgments

This study was supported by grants from the Natural Science Foundation of China (81370497, 81373176 and 31400856), the Research Project in the 12th five-year-plan of Ministry of Science and Technology (2011BAZ03384), the Innovation of Science and Technology Commission of Shenzhen Municipality (JCYJ20140418095735538 and JCYJ20140411150916749), and the Natural Science Foundation of SZU (No. 000004).

References

  1. Lloyd CM, Saglani. T cells in asthma: influences of genetics, environment, and T-cell plasticity. J Allergy Clin Immunol 2013;131:1267–1274. [DOI] [PubMed] [Google Scholar]
  2. Niebuhr M, Werfel T, Innate immunity, allergy and atopic dermatitis. Curr Opin Allergy Clin Immunol 2010;10:463–468. [DOI] [PubMed] [Google Scholar]
  3. Neuman MG. Immune dysfunction in inflammatory bowel disease. Transl Res 2007; 149: 173–186. [DOI] [PubMed] [Google Scholar]
  4. Hirahara K, Poholek A, Vahedi G, Laurence A, Kanno Y, Milner JD et al. Mechanisms underlying helper T-cell plasticity: implications for immune-mediated disease. J Allergy Clin Immunol 2013; 131: 1276–1287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Krammer PH, Arnold R, Lavrik IN. Life and death in peripheral T cells. Nat Rev Immunol 2007; 7: 532–542. [DOI] [PubMed] [Google Scholar]
  6. Akdis M, Trautmann A, Klunker S, Blaser K, Akdis CA. Cytokine network and dysregulated apoptosis in atopic dermatitis. Acta Odontol Scand 2001; 59: 178–182. [DOI] [PubMed] [Google Scholar]
  7. Wade M, Li YC, Wahl GM. MDM2, MDMX and p53 in oncogenesis and cancer therapy. Nat Rev Cancer 2013; 13: 83–96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Shajib M, Wang H, Kim JJ, Sunjic I, Ghia JE, Denou E et al. Interleukin 13 and serotonin: linking the immune and endocrine systems in murine models of intestinal inflammation. PLoS One 2013; 8: e72774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Mannon P, Reinisch W. Interleukin 13 and its role in gut defence and inflammation. Gut 2012; 61: 1765–1773. [DOI] [PubMed] [Google Scholar]
  10. Leonard SA, Martos G, Wang W, Nowak-Wegrzyn A, Berin MC. Oral immunotherapy induces local protective mechanisms in the gastrointestinal mucosa. J Allergy Clin Immunol 2012; 129: 1579–1587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Rahman I, Kinnula VL, Gorbunova V, Yao H. SIRT1 as a therapeutic target in inflammaging of the pulmonary disease. Prev Med 2012; 54: S20–S28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Xiong Y, Yu Y, Montani J-P, Yang Z, Ming X-F. Arginase-II induces vascular smooth muscle cell senescence and apoptosis through p66Shc and p53 independently of its I-arginine ureahydrolase activity: implications for atherosclerotic plaque vulnerability. J Am Heart Assoc 2013; 2: e000096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Suzuki K, Murphy SH, Xia Y, Yokota M, Nakagomi D, Liu F et al. Tumor suppressor p53 functions as a negative regulator in IgE-mediated mast cell activation. PLoS One 2011; 6: e25412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Lettau M, Paulsen M, Schmidt H, Janssen O. Insights into the molecular regulation of FasL (CD178) biology. Eur J Cell Biol 2011; 90: 456–466. [DOI] [PubMed] [Google Scholar]
  15. Qiao L, Wong BCY. Targeting apoptosis as an approach for gastrointestinal cancer therapy. Drug Resist Updat 2009; 12: 55–64. [DOI] [PubMed] [Google Scholar]
  16. Chiang JH, Yang JS, Lu CC, Hour MJ, Chang SJ, Lee TH et al. Newly synthesized quinazolinone HMJ-38 suppresses angiogenetic responses and triggers human umbilical vein endothelial cell apoptosis through p53-modulated Fas/death receptor signaling. Toxicol Appl Pharmacol 2013; 269: 150–162. [DOI] [PubMed] [Google Scholar]
  17. Ooi AT, Ram S, Kuo A, Gilbert JL, Yan W, Pellegrini M et al. Identification of an interleukin 13-induced epigenetic signature in allergic airway inflammation. Am J Transl Res 2012; 4: 219–228. [PMC free article] [PubMed] [Google Scholar]
  18. Oh CK, Geba GP, Molfino N. Investigational therapeutics targeting the IL-4/IL-13/STAT-6 pathway for the treatment of asthma. Eur Respir Rev 2010; 19: 46–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hebenstreit D, Wirnsberger G, Horejs-Hoeck J, Duschl A. Signaling mechanisms, interaction partners, and target genes of STAT6. Cytokine Growth Factor Rev 2006; 17: 173–188. [DOI] [PubMed] [Google Scholar]
  20. Shimoda K, van Deursent J, Sangster MY, Sarawar SR, Carson RT, Tripp RA et al. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted State6 gene. Nature 1996; 380: 630–633. [DOI] [PubMed] [Google Scholar]
  21. Niranjan R, Rayapudi M, Mishra A, Dutt P, Dynda S, Mishra A. Pathogenesis of allergen-induced eosinophilic esophagitis is independent of interleukin (IL)-13. Immunol Cell Biol 2013; 91: 408–415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Wu Z, Pearson A, Oliveira D. Characterization of cis-regulatory elements conferring mercury-induced interleukin-4 gene expression in rat mast cells: a role for signal transducer and activator of transcription 6 and TATA box binding sites. Immunology 2009; 127: 530–538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Li BH, Xu SB, Li F, Zou XG, Saimaiti A, Simayi D et al. Stat6 activity-related Th2 cytokine profile and tumor growth advantage of human colorectal cancer cells in vitro and in vivo. Cell Signal 2012; 24: 718–725. [DOI] [PubMed] [Google Scholar]
  24. Li BH, Yang XZ, Li PD, Yuan Q, Liu XH, Yuan J et al. IL-4/Stat6 activities correlate with apoptosis and metastasis in colon cancer cells. Biochem Biophys Res Commun 2008; 369: 554–560. [DOI] [PubMed] [Google Scholar]
  25. Kasaian MT, Miller DK. IL-13 as a therapeutic target for respiratory disease. Biochem Pharmacol 2008; 76: 147–155. [DOI] [PubMed] [Google Scholar]
  26. Punnonen J, Aversa G, Cocks BG, McKenzie AN, Menon S, Zurawski G et al. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl Acad Sci U S A 1993; 90: 3730–3734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Horie S, Okubo Y, Hossain M, Sato E, Nomura H, Koyama S et al. Interleukin-13 but not interleukin-4 prolongs eosinophil survival and induces eosinophil chemotaxis. Intern Med 1997; 36: 179–185. [DOI] [PubMed] [Google Scholar]
  28. Heller F, Fromm A, Gitter AH, Mankertz J, Schulzke JD. Epithelial apoptosis is a prominent feature of the epithelial barrier disturbance in intestinal inflammation: effect of pro-inflammatory interleukin-13 on epithelial cell function. Mucosal Immunol 2008; 1: S58–S61. [DOI] [PubMed] [Google Scholar]
  29. Singhera GK, MacRedmond R, Dorscheid DR. Interleukin-9 and -13 inhibit spontaneous and corticosteroid induced apoptosis of normal airway epithelial cells. Exp Lung Res 2008; 34: 579–598. [DOI] [PubMed] [Google Scholar]
  30. Xiao Z, Shan J, Li C, Luo L, Lu J, Li S et al. Mechanisms of cyclosporine-induced renal cell apoptosis: a systematic review. Am J Nephrol 2013; 37: 30–40. [DOI] [PubMed] [Google Scholar]
  31. Urbano PC, Soccol VT, Azevedo VF. Apoptosis and the FLIP and NF-kappa B proteins as pharmacodynamic criteria for biosimilar TNF-alpha antagonists. Biologics 2014; 8: 211–220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Holla S, Ghorpade DS, Singh V, Bansal K, Balaji KN. Mycobacterium bovis BCG promotes tumor cell survival from tumor necrosis factor-alpha-induced apoptosis. Mol Cancer 2014; 13: 210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Manna SK, Aggarwal BB. IL-13 suppresses TNF-induced activation of nuclear factor-kappa B, activation protein-1, and apoptosis. J Immunol 1998; 161: 2863–2872. [PubMed] [Google Scholar]

Articles from Cellular and Molecular Immunology are provided here courtesy of Nature Publishing Group

RESOURCES