Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2016 Sep 23;60(10):6060–6066. doi: 10.1128/AAC.00732-16

The RTA3 Gene, Encoding a Putative Lipid Translocase, Influences the Susceptibility of Candida albicans to Fluconazole

Sarah G Whaley a, Sarah Tsao b, Sandra Weber b, Qing Zhang a, Katherine S Barker a, Martine Raymond b,✉, P David Rogers a,✉
PMCID: PMC5038240  PMID: 27480868

Abstract

The RTA3 gene, coding for a member of the Rta1p-like lipid-translocating exporter family, is coordinately upregulated with the ATP-binding cassette transporter genes CDR1 and CDR2 in azole-resistant clinical isolates of Candida albicans that carry activating mutations in the transcription factor Tac1p. We show here that deleting RTA3 in an azole-resistant clinical isolate carrying a Tac1p-activating mutation lowered fluconazole resistance by 2-fold, while overexpressing RTA3 in an azole-susceptible clinical isolate resulted in enhanced fluconazole tolerance associated with trailing growth in a liquid microtiter plate assay. We also demonstrate that an Rta3p-green fluorescent protein (GFP) fusion protein localizes predominantly to the plasma membrane, consistent with a putative function for Rta3p as a lipid translocase.

INTRODUCTION

Invasive fungal infections are an increasing problem worldwide (1). Among fungal infections, those caused by Candida species are by far the most common (2). A recent study of health care-associated infections in the United States found Candida species to be the 7th most common pathogen overall and the most common pathogen isolated from bloodstream infections in the population studied (3). Among Candida infections, Candida albicans is the most prevalent species and was responsible for 44.4% of all Candida infections in the United States between 2006 and 2011 (4).

Along with the increasing rates of Candida infection, there has also been an increase in resistance to fluconazole, which is the most commonly prescribed antifungal agent (2, 5). The Centers for Disease Control and Prevention (CDC) report roughly 3,400 cases of fluconazole-resistant Candida infections, with 220 associated deaths annually (6). Candida has evolved multiple mechanisms of resistance to fluconazole. One common mechanism of resistance found in clinical isolates is overexpression of the CDR1 and CDR2 genes, encoding two homologous ATP-binding cassette (ABC) transporters functioning as multidrug efflux pumps and phospholipid translocases (7, 8). Overexpression of CDR1 and CDR2 has been shown to be the result of activating mutations in the gene encoding the zinc cluster transcription factor Tac1p (9, 10). Our previous characterization of the Tac1p regulon by microarray RNA profiling revealed that azole-resistant clinical isolates carrying an activated Tac1p protein overexpress many genes in addition to CDR1 and CDR2, including PDR16 (a phospholipid transferase), LCB4 (a sphingolipid long-chain-base kinase), and RTA3 (a putative lipid translocase), suggesting a function for Tac1p in regulating lipid/phospholipid homeostasis (11). Recently, the ABC transporter gene ROA1, a known Tac1p target (11), was also shown to influence azole tolerance (12). Genetic dissection of the roles of CDR1, CDR2, and PDR16 showed that they all participate in the azole-resistant phenotype in C. albicans, although to different extents (12–14). RTA2 has been shown to be involved in calcineurin-mediated azole resistance and sphingolipid long-chain-base (LCB) release in C. albicans (15). Given the overexpression of RTA3 in azole-resistant clinical isolates carrying Tac1p-activating mutations and its sequence homology to RTA2, we investigated its contribution to azole resistance.

MATERIALS AND METHODS

Strains and growth media.

The C. albicans strains used in this study are listed in Table 1. All strains were routinely maintained in YPD (1% yeast extract, 2% peptone, and 2% dextrose) broth at 30°C (unless otherwise stated) and stored as 40% glycerol stocks at −80°C. One Shot Escherichia coli TOP10 chemically competent cells (Invitrogen, Carlsbad, CA) were used as the host for plasmid construction and propagation. These strains were grown at 37°C in Luria-Bertani (LB) broth or on LB plates supplemented with 100 μg/ml ampicillin (Sigma, St. Louis, MO) or 50 μg/ml kanamycin (Fisher BioReagents, Fair Lawn, NJ).

TABLE 1.

C. albicans strains used in this study

Strain Parent Genotype/description Reference or source
5457 Azole-susceptible clinical isolate 14
5674 5457 Azole-resistant clinical isolate; Tac1pN972D 14, 18
SZY31 5674 tac1Δ::FRT/tac1Δ::FRT 18
5674RTA3M4A 5674 rta3Δ::FRT/rta3Δ::FRT This study
5674RTA3M4B 5674 rta3Δ::FRT/rta3Δ::FRT This study
5674RTA3R2A 5674RTA3M4A rta3Δ::FRT/RTA3-FRT This study
5674RTA3R2B 5674RTA3M4A rta3Δ::FRT/RTA3-FRT This study
5674RTA3G2A 5674RTA3R2B rta3Δ::FRT/RTA3-GFP-caSAT1 This study
5674-GFP 5674 ADH1/adh1::Ptet-caGFP This study
SC5314 Azole-susceptible clinical isolate 32
SCRTA3M4A SC5314 rta3Δ::FRT/rta3Δ::FRT This study
SCRTA3OE1G SC5314 ADH1/adh1::PADH1-RTA3-caSAT1 This study

Strain construction. (i) RTA3 disruptants and revertant.

The SAT1-flipper cassette was used to construct mutants, as previously described (16). Fragments of the RTA3 sequence containing the 5′ region −453 to +96 relative to the start codon and the 3′ region +1260 to +1816 were amplified by PCR and cloned on each side of the SAT1-flipper cassette. Two rounds of transformation and induction of the flippase resulted in replacement of the region +96 to +1260 relative to the RTA3 start codon in both alleles with an FRT site. The primers used are listed in Table 2. For reintegration, the 5′ fragment in the disruption cassette was replaced with a fragment containing the RTA3 open reading frame (−453 to +2392). After one round of transformation and induction of the flippase, the resulting revertant strain has one allele of RTA3 reintroduced into the original locus with a downstream FRT site. The second allele remains disrupted for RTA3.

TABLE 2.

Primers used in this study

Primer Sequence (5′–3′)a
Northern blot
    RTA3 probe Forward ATGAATACTATGGATCTTGCGGTAATTAC
    RTA3 probe Reverse CGACCCAAATATCCGAGAAATTCTAATG
RTA3 disruption and reintegration
    RTA3A AATTGGATTTCCTGGTGGTGGGCCCAAGATTA
    RTA3B TGGGGCATAAGTTGCAGCAATCTCGAGTAGAG
    RTA3C AACAAAGACCAAGCGGCCGCGGACAAAAGT
    RTA3D CTTTTAAACTATAAAAGTTTATGCCGCGGGTC
    RTA3E AAGGGTGGGAATCTCGAGGTACACCAAG
GFP-tagged RTA3
    RTA3gfpA TTGTTAGGGGTGATCCTATTCAAGAGAATAAGGAAGGTGCTGGAGCTGGAGCTATGAGTAAGGGAGAAGAACTTTTCACT
    RTA3gfpB AAAAAACTAATAATGATATTGTTAGTGACAATGAAGAATCGACGTTGCAAGGTCAAAATATTGTTAGGGGTGATCCTATT
    RTA3gfpC TTTCACTTGCATTTAAGTTGCTAGGAATCATACCACCCCTTAGTTAACATTCAAATCTGCAGGACCACCTTTGATTGTAA
    RTA3gfpD ACAAAAGCAAGTACAATTAATAAGCAAACATCTATAAACATCTAATAACATAGCCACCTTTTTCACTTGCATTTAAGTTG
RTA3 overexpression
    ADH1 TGTCAAAGGATTGGTACCTTGAGATGGAG
    ADH2 TTTGTGGGCCCCATAATTGTTTTTGTATTTGTTG
    RTA3-5′ GAAAATCTAGAAGGCTCATGAATACTATGG
    RTA3-3′ CTTAGTTAAAGATCTAATTCATTCCTTATTC
    ACT16 TTCTAAGATCTAAATTCTGGAAATCTGG
    SAT2 CTAGTGATTTCTGCAGGACCACCTTTG
    ADH8 GGTGCTGAACCAAACTGCAGTGAAGCTGAC
    ADH11 GAACCTTTGATTTCCGCGGATTTGACAACAGC
a

Underlined bases indicate introduction of restriction site.

(ii) RTA3 overexpression.

The RTA3 open reading frame (primers RTA3-5′ and RTA3-3′), ADH1 promoter region (primers ADH1 and ADH2), and 3′ fragment of ADH1 (primers ADH8 and ADH11) were PCR amplified from strain SC5314. The ACT1 termination sequence and SAT1 selection marker were PCR amplified from vector pBSS2 (primers ACT16 and SAT2), which contains the SAT1-flipper construct in the pBluescript backbone. All primers used are listed in Table 2. The assembled cassette was designed to replace one allele of ADH1 with the RTA3 open reading frame, followed by the ACT1 termination sequence and the SAT1 selection marker, which allowed expression of RTA3 from the ADH1 promoter.

(iii) GFP-tagged RTA3.

A 3-kb fragment was amplified by PCR from the pNIM vector (17) using the primers listed in Table 2. The final DNA product contained 95 bp of homology to the 3′ end of RTA3 (just before the stop codon), followed by a fragment of the pNIM cassette (GFP, ACT1 termination sequence, ACT1 promoter, SAT1, URA3 termination sequence) and a 116-bp region homologous to the 3′ untranslated region (UTR) immediately following the RTA3 open reading frame (ORF). This construct was transformed into the 5674 RTA3 revertant strain to allow expression of the Rta3p-GFP (green fluorescent protein) fusion protein from the endogenous RTA3 promoter.

(iv) GFP expression in strain 5674.

The empty pNIM plasmid was digested with KpnI and SacII to release the GFP cassette and used to transform 5674, generating a strain in which GFP expression can be induced in the presence of doxycycline following integration at the ADH1 locus (17).

C. albicans transformation.

C. albicans transformations were performed either using a standard lithium acetate protocol (18) or as described previously (19), with minor modifications. Overnight cultures were diluted to an optical density at 600 nm (OD600) of 0.1 in 50 ml of fresh YPD and allowed to grow to an OD600 of approximately 2. The cells were harvested, resuspended in a 10-ml solution containing 100 mM lithium acetate (LiAc), 10 mM Tris-HCl, and 1 mM EDTA, and then incubated with shaking for 1 h at 30°C. Next, 250 μl of 1 M dithiothreitol was added, and the cells were incubated for an additional 30 min with shaking. Cells were diluted with 40 ml of H2O, centrifuged, washed with 25 ml of H2O and then with 5 ml of 1 M sorbitol, and resuspended in 50 μl of 1 M sorbitol. Plasmids were digested, separated by gel electrophoresis, and purified using the Geneclean II kit (MP Biomedicals, Solon, OH). Then, 5 μl of purified DNA or H2O control was added to 40 μl of electrocompetent cells. Electroporation was performed in a CelljecT Pro (Thermo Fisher, Waltham, MA) at 1.5 kV in a 2-mm cuvette. Cells were immediately resuspended in 1 ml of 1 M sorbitol and transferred to a microcentrifuge tube. Transformed cells were allowed to recover in YPD at 30°C with shaking for 4 to 6 h and then plated on YPD agar plates containing 200 μg/ml nourseothricin (Jena Biochemical, Germany). Transformants were selected after 24 to 48 h of growth and confirmed by Southern blotting.

Genomic DNA preparation and Southern blot analysis.

Genomic DNA was isolated as described previously (20). For confirmation by Southern hybridization, approximately 10 μg of genomic DNA was digested with the appropriate restriction enzymes, separated on a 1% agarose gel containing ethidium bromide, transferred by vacuum blotting onto a nylon membrane, and fixed by UV cross-linking. Hybridization was performed with the Amersham ECL Direct nucleic acid labeling and detection system (GE Healthcare, Pittsburgh, PA), as per the manufacturer's instructions.

RNA preparation and Northern blot analysis.

C. albicans strains (50-ml cultures) were grown in YPD medium at 30°C to an OD600 of 1.0. Total RNA was extracted using a hot phenol method (21). Northern blotting was performed as previously described (14). The RTA3 probe used for membrane hybridization was obtained by PCR amplification from SC5314 genomic DNA using primers corresponding to a region from +1 to +500 with respect to the RTA3 start codon (Table 2). After washing, the membrane was exposed to a Fujifilm imaging plate, and the results were visualized using the Multi Gauge software version 3.0 (Fujifilm).

Fluconazole susceptibility assays.

Liquid microtiter plate assays were performed as described previously (13). The fluconazole (FLC; Sigma, St. Louis, MO) concentrations tested in Fig. 1A were 1.5, 3, 9, 25, 37.5, 50, 62.5, 75, 87.5, 100, and 200 μg/ml; each strain was tested as four biological replicates, each with technical duplicates. The FLC concentrations tested in Fig. 2A were 0.2, 0.4, 0.8, 1.6, 3.1, 6.3, 12.5, 25, 50, 100, and 200 μg/ml; each strain was tested in triplicate. Cell growth was measured spectrophotometrically at OD620 after 48 h of incubation at 30°C in YPD. Data were plotted using GraphPad Prism (GraphPad Software, Inc., La Jolla, CA) as a dose-response curve, where the x values are the logarithms of FLC concentrations, and y values are percent cell growth in the presence of FLC relative to cell growth in the absence of FLC. The data were fitted using nonlinear regression, allowing the determination of the 50% inhibitory concentration (IC50) for each strain in response to FLC treatment.

FIG 1.

FIG 1

Deletion of RTA3 in the azole-resistant clinical isolate 5674 results in decreased fluconazole resistance. (A) Strains were grown for 48 h in YPD at the fluconazole concentrations tested, and OD620 readings were measured and normalized to the no-drug control wells (n = 4). Error bars indicate standard deviations. (B) Serial dilutions of the strains were incubated for 24, 48, or 72 h on YPD solid medium containing 0, 25, or 50 μg/ml fluconazole (FLC).

FIG 2.

FIG 2

Overexpression of RTA3 in the azole-susceptible clinical isolate SC5314 results in enhanced fluconazole tolerance. (A) Strains were incubated for 48 h in YPD at the concentrations tested, and OD620 readings were measured and normalized to the no-drug control wells. n = 3, in duplicate. Error bars indicate standard deviations. OE, overexpression. (B) Serial dilutions of the strains were incubated for 24, 48, or 72 h on YPD solid medium containing 0, 5, 25, or 50 μg/ml fluconazole.

Spot assay.

Colonies from cultures grown on YPD solid medium for 24 h were diluted in YPD to an OD600 of 1.0. Cultures were serially diluted 1:5 in YPD. Approximately 2 μl of each dilution was applied to solid YPD containing the indicated concentrations of fluconazole using a handheld pin transfer tool. The serial dilutions were incubated at 30°C for 24, 48, and 72 h. Plates were imaged using an Epson Perfection V700 photo scanner at each time point, and growth inhibition was compared.

Fluorescence microscopy.

Cells were grown in synthetic complete medium (2% glucose, 0.67% yeast nitrogen base without amino acids [Difco, Sparks, MD], 0.2% amino acids). The 5674/pNIM strain (5674-GFP) was treated with 50 μg/ml doxycycline (Sigma, St. Louis, MO) to induce the expression of GFP, as described previously (17). Cells were harvested at an OD600 of 0.4, washed with 0.1 M potassium phosphate buffer (pH 6.4), and resuspended in 0.1 M potassium phosphate buffer (pH 7.4). The cells were then placed on a 15-well microscope slide pretreated with poly-l-lysine (Sigma). Nonadhering cells were aspirated, and 0.05 μg/ml 4′,6-diamidino-2-phenylindole (DAPI; Sigma) was added to each well. Images were acquired using a Zeiss LSM 700 inverted confocal laser scanning microscope equipped with a 63× oil immersion objective (1.4 numerical aperture [NA], differential inference contrast [DIC]) at a 2× zoom. GFP images were captured using a 488-nm diode laser for excitation and a beam splitter set to capture emission above 505 nm. All images were acquired using the same laser strength, detector gain value, and pixel dwell time to enable subsequent comparative analyses using the ImageJ software (version 2.0.0-rc-29/1.49s [http://imagej.net]) (22). Quantification of the autofluorescence intensity was achieved by analyzing 15 individual cells (one transverse line per cell), which determined the threshold value of 25 arbitrary units for background subtraction.

RESULTS

Increased RTA3 expression in an azole-resistant clinical isolate of C. albicans is Tac1p dependent.

The SAT1-flipper method was used to delete both copies of RTA3 in a well-characterized fluconazole-resistant clinical isolate, C. albicans 5674. This strain and its azole-susceptible parental strain 5457 were isolated from the same patient 58 days apart (14). Compared to strain 5457, strain 5674 is resistant to several azole derivatives and overexpresses CDR1, CDR2, and many other genes, including RTA3, due to a strong gain-of-function mutation (N972D) in Tac1p (11, 18).

Northern blot analysis was performed on all strains, using an RTA3-derived probe. The RNA detected was approximately 1.7 kb, consistent with the size of the RTA3 transcript (Fig. 3) (23). As predicted from the microarray studies, RTA3 transcripts were strongly induced in strain 5674 compared to strain 5457, in a Tac1p-dependent manner (11). RTA3 transcripts were undetectable in the 5674 rta3Δ/Δ strain, confirming the RTA3 deletion in this strain. Reintegration of one copy of RTA3 into its original locus in the 5674 rta3Δ/Δ strain gave rise to intermediate levels of RTA3 RNA (Fig. 3).

FIG 3.

FIG 3

Northern blot analysis of RTA3 expression. Total RNA was prepared from the indicated strains and analyzed by Northern blotting with an RTA3-specific probe. rRNAs are shown as loading controls (bottom), and the positions of the 26S and 18S rRNAs are indicated on the left.

Deletion of RTA3 in an azole-resistant clinical isolate of C. albicans results in increased susceptibility to fluconazole.

The fluconazole sensitivity of clinical isolates 5457 and 5674 and the mutant strains was determined by microtiter plate assay. Cell growth was assessed by measuring the optical density at 620 nm and normalized to the no-fluconazole controls. This experiment showed that the deletion of RTA3 in isolate 5674 decreased the fluconazole resistance of the cells by 2-fold, an effect that was partially suppressed in the RTA3 revertant (Fig. 1A and Table 3). A fluconazole resistance assay was also carried out on solid medium, yielding similar results (Fig. 1B). These results demonstrate that RTA3 contributes to the overall azole resistance of the 5674 clinical isolate. This contribution, although minor compared to that of CDR1 in strain 5674 (6-fold), is similar in extent to that of CDR2 (1.5-fold) (13) and PDR16 (2-fold) (14). Taken together, these data demonstrate that the high level of azole resistance in clinical isolate 5674 is achieved through the combined action of multiple Tac1p targets.

TABLE 3.

Fluconazole susceptibility of strains tested in this study

Strain IC50 to FLC (μg/ml)a Fold change relative to 5674
5457 2.79 (±0.08) 0.03
5674 83.68 (±1.05) 1.00
5674 rta3Δ/Δ 41.79 (±0.30) 0.50
5674 rta3Δ/Δ+RTA3 53.70 (±1.05) 0.64
a

Values in parentheses indicate standard deviations.

The same strategy was used to delete RTA3 in the azole-susceptible clinical isolate C. albicans SC5314. Assessment of the fluconazole sensitivity of the resulting strain by microtiter plate and spot assays revealed that it was identical to that of SC5314 (data not shown). This was consistent with the finding that RTA3 is not expressed in the azole-susceptible strains SC5314 and 5457 (Fig. 3).

Overexpression of RTA3 in an azole-susceptible C. albicans strain results in increased tolerance to fluconazole.

We used an overexpression strategy to further test the role for RTA3 in azole resistance. One allele of the highly expressed ADH1 gene was replaced with RTA3 in the SC5314 background, such that RTA3 expression was under the control of the strong ADH1 promoter. This resulted in high levels of RTA3 expression, as determined by Northern blotting (Fig. 3). A liquid microtiter plate assay with the resulting strains showed that in the presence of fluconazole, the strain overexpressing RTA3 exhibited enhanced growth compared to the parental strain, accompanied by growth trailing (Fig. 2A) (24); this trailing effect was also seen after 24 h of growth and with another independently constructed RTA3-overexpressing strain (data not shown). Interestingly, the RTA3-overexpressing strain clearly demonstrated enhanced growth compared to SC5314 on solid YPD medium containing 5, 25, or 50 μg/ml fluconazole incubated for 24, 48, and 72 h (Fig. 2B). These results indicate that an increased dosage of RTA3 expression can confer fluconazole tolerance in the absence of additional molecular alterations, i.e., activation of additional Tac1p targets.

Rta3p localizes to the plasma membrane.

Subcellular localization of Rta3p was assessed by tagging the protein with the green fluorescent protein (GFP) and analyzing the fluorescence of the resulting cells by confocal microscopy. Rta3p-GFP-expressing cells exhibited a faint rim-like staining pattern consistent with plasma membrane localization, although intracellular staining was found to be strong, as shown in the GFP intensity plot (Fig. 4A). Interestingly, Rta3p-GFP also displayed a punctate distribution pattern, suggesting an association with lipid rafts, as previously shown for Cdr1p (25). Parental 5674 cells analyzed similarly to determine their level and pattern of autofluorescence exhibited a faint diffuse signal that appeared to be mostly intracellular (Fig. 4B). Quantification of the autofluorescence intensity across individual cells allowed the autofluorescence threshold value to be set at 25 arbitrary units (Fig. 4B, right). Subtracting autofluorescence from the Rta3p-GFP signal decreased the intracellular staining and enhanced punctate staining at the cell periphery (Fig. 4A). The results obtained with the Rta3p-GFP cells were different from those obtained with cells expressing untagged GFP, which displayed primarily intracellular staining. Upon induction with doxycycline, cells expressing GFP were found to be very bright (Fig. 4C). The GFP intensity plot for these cells before and after autofluorescence correction showed similar bell-shaped distribution curves corresponding to an intracellular localization of GFP, confirming that the rim-like staining pattern observed with Rta3p-GFP is not due to the GFP moiety of the fusion protein. Taken together, these results demonstrate that Rta3p-GFP localizes predominantly to the plasma membrane, similar to Saccharomyces cerevisiae Rsb1p and Rta1p (26, 27).

FIG 4.

FIG 4

Analysis of Rta3p-GFP subcellular localization. (A) Confocal microscope image of strain 5674 expressing Rta3p-GFP grown to log phase in synthetic complete medium. The DIC and corresponding fluorescence (GFP) images are shown. The fluorescence intensity of the selected transversal section of the cell (arrow line) was quantified using ImageJ software (GFP intensity plot, where the length and direction are expressed as increased distance on the x axis). The threshold for autofluorescence signal (25 arbitrary units [AU]) determined from 5674 cells is indicated as a dashed line in the intensity plots. An autofluorescence subtraction image and its corresponding intensity plot are also shown. Two peaks in the intensity plot corresponding to plasma membrane (PM) fluorescence are indicated. (B) 5674 cells were analyzed as described in panel A. (C) 5674-GFP cells were analyzed as described in panel A.

DISCUSSION

Here, we show that RTA3 participates along with CDR1, CDR2, and PDR16 in Tac1p-mediated azole resistance in C. albicans. Disruption of RTA3 in a resistant clinical isolate carrying a TAC1-activating mutation resulted in a modest increase in susceptibility. Such an effect is not surprising, as this isolate still overexpresses CDR1, CDR2, and PDR16. Overexpression of RTA3 alone in the susceptible isolate SC5314 resulted in an increase in fluconazole tolerance and in its ability to grow on solid medium in the presence of fluconazole. While this Tac1p target gene clearly contributes to this phenotype, the mechanism by which it does so remains unclear.

The function of C. albicans RTA3 remains uncharacterized. The closest homologs to this gene in the yeast Saccharomyces cerevisiae are RSB1 and RTA1, both of which are members of the lipid-translocating exporter family (28). RSB1 encodes a translocase that moves sphingolipid long-chain bases (LCB) from the cytoplasmic side of the plasma membrane to the external side and glycerophospholipids inward toward the cytoplasm, thus conferring plasma membrane lipid asymmetry (29, 30). RTA1 encodes a similar protein that is involved in 7-aminocholesterol resistance by a yet-unknown mechanism (31). The C. albicans genome contains four genes encoding proteins belonging to this family: RTA2, RTA3, RTA4, and orf19.6224. While the other members of the C. albicans family are not yet functionally characterized, RTA2 has been shown to be involved in calcineurin-mediated azole resistance and sphingolipid LCB release in C. albicans (15).

In addition to CDR1 and CDR2, other target genes of Tac1p have been implicated in the azole resistance mediated by activating mutations in this transcription factor. Disruption of the phospholipid transferase gene PDR16 in an azole-resistant clinical isolate resulted in increased susceptibility to fluconazole, whereas overexpression of PDR16 increased resistance (14). Interestingly, the Tac1p target gene ROA1, which encodes a putative ABC transporter, was recently shown to influence azole sensitivity in C. albicans (12). Disruption of ROA1 increased tolerance to a panel of azoles. It is therefore tempting to speculate that other Tac1p target genes, in addition to PDR16, RTA3, and ROA1, may play a supporting role in this process.

Based on the plasma membrane localization of Rta3p and its homology to proteins involved in maintaining optimal membrane lipid asymmetry, its overexpression (ectopic or Tac1p mediated) could attenuate plasma membrane alterations caused by azoles, as shown for Rta2p (15). Alternatively, it could also alter plasma membrane permeability and/or the activity of plasma membrane-associated azole transporters, like Cdr1p. The determination of Rta3p molecular and cellular function(s) should help answer these questions.

ACKNOWLEDGMENTS

We thank Joachim Morschhäuser for generously sharing the pNIM1 and pSFS2 plasmids. We also thank Christian Charbonneau of IRIC's bioimaging core facility for assistance with the confocal microscopy.

This work was supported by grants from the Canadian Institutes of Health Research (MOP 97734) to M.R. and NIH NIAID grant R01 AI058145 to P.D.R.

REFERENCES

  • 1.Brown GD, Denning DW, Gow NA, Levitz SM, Netea MG, White TC. 2012. Hidden killers: human fungal infections. Sci Transl Med 4:165rv113. [DOI] [PubMed] [Google Scholar]
  • 2.Azie N, Neofytos D, Pfaller M, Meier-Kriesche HU, Quan SP, Horn D. 2012. The PATH (Prospective Antifungal Therapy) Alliance registry and invasive fungal infections: update 2012. Diagn Microbiol Infect Dis 73:293–300. doi: 10.1016/j.diagmicrobio.2012.06.012. [DOI] [PubMed] [Google Scholar]
  • 3.Magill SS, Edwards JR, Bamberg W, Beldavs ZG, Dumyati G, Kainer MA, Lynfield R, Maloney M, McAllister-Hollod L, Nadle J, Ray SM, Thompson DL, Wilson LE, Fridkin SK, Emerging Infections Program Healthcare-Associated Infections and Antimicrobial Use Prevalence Survey Team. 2014. Multistate point-prevalence survey of health care-associated infections. N Engl J Med 370:1198–1208. doi: 10.1056/NEJMoa1306801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Pfaller MA, Jones RN, Castanheira M. 2014. Regional data analysis of Candida non-albicans strains collected in United States medical sites over a 6-year period, 2006–2011. Mycoses 57:602–611. doi: 10.1111/myc.12206. [DOI] [PubMed] [Google Scholar]
  • 5.Pfaller MA, Moet GJ, Messer SA, Jones RN, Castanheira M. 2011. Geographic variations in species distribution and echinocandin and azole antifungal resistance rates among Candida bloodstream infection isolates: report from the SENTRY Antimicrobial Surveillance Program (2008 to 2009). J Clin Microbiol 49:396–399. doi: 10.1128/JCM.01398-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.CDC. 2013. Antibiotic resistance threats in the United States, 2013. Centers for Disease Control and Prevention, Atlanta, GA: http://www.cdc.gov/drugresistance/pdf/ar-threats-2013-508.pdf. [Google Scholar]
  • 7.White TC, Holleman S, Dy F, Mirels LF, Stevens DA. 2002. Resistance mechanisms in clinical isolates of Candida albicans. Antimicrob Agents Chemother 46:1704–1713. doi: 10.1128/AAC.46.6.1704-1713.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Smriti, Krishnamurthy S, Dixit BL, Gupta CM, Milewski S, Prasad R. 2002. ABC transporters Cdr1p, Cdr2p and Cdr3p of a human pathogen Candida albicans are general phospholipid translocators. Yeast 19:303–318. doi: 10.1002/yea.818. [DOI] [PubMed] [Google Scholar]
  • 9.Coste AT, Karababa M, Ischer F, Bille J, Sanglard D. 2004. TAC1, transcriptional activator of CDR genes, is a new transcription factor involved in the regulation of Candida albicans ABC transporters CDR1 and CDR2. Eukaryot Cell 3:1639–1652. doi: 10.1128/EC.3.6.1639-1652.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Coste A, Turner V, Ischer F, Morschhauser J, Forche A, Selmecki A, Berman J, Bille J, Sanglard D. 2006. A mutation in Tac1p, a transcription factor regulating CDR1 and CDR2, is coupled with loss of heterozygosity at chromosome 5 to mediate antifungal resistance in Candida albicans. Genetics 172:2139–2156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Liu TT, Znaidi S, Barker KS, Xu L, Homayouni R, Saidane S, Morschhauser J, Nantel A, Raymond M, Rogers PD. 2007. Genome-wide expression and location analyses of the Candida albicans Tac1p regulon. Eukaryot Cell 6:2122–2138. doi: 10.1128/EC.00327-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jiang L, Xu D, Chen Z, Cao Y, Gao H, Jiang Y. 2016. The putative ABC transporter encoded by the orf19.4531 plays a role in the sensitivity of Candida albicans cells to azole antifungal drugs. FEMS Yeast Res 16:pii=fow024. doi: 10.1093/femsyr/fow024. [DOI] [PubMed] [Google Scholar]
  • 13.Tsao S, Rahkhoodaee F, Raymond M. 2009. Relative contributions of the Candida albicans ABC transporters Cdr1p and Cdr2p to clinical azole resistance. Antimicrob Agents Chemother 53:1344–1352. doi: 10.1128/AAC.00926-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Saidane S, Weber S, De Deken X, St-Germain G, Raymond M. 2006. PDR16-mediated azole resistance in Candida albicans. Mol Microbiol 60:1546–1562. doi: 10.1111/j.1365-2958.2006.05196.x. [DOI] [PubMed] [Google Scholar]
  • 15.Jia XM, Wang Y, Jia Y, Gao PH, Xu YG, Wang L, Cao YY, Cao YB, Zhang LX, Jiang YY. 2009. RTA2 is involved in calcineurin-mediated azole resistance and sphingoid long-chain base release in Candida albicans. Cell Mol Life Sci 66:122–134. doi: 10.1007/s00018-008-8409-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Reuss O, Vik A, Kolter R, Morschhauser J. 2004. The SAT1 flipper, an optimized tool for gene disruption in Candida albicans. Gene 341:119–127. doi: 10.1016/j.gene.2004.06.021. [DOI] [PubMed] [Google Scholar]
  • 17.Park YN, Morschhauser J. 2005. Tetracycline-inducible gene expression and gene deletion in Candida albicans. Eukaryot Cell 4:1328–1342. doi: 10.1128/EC.4.8.1328-1342.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Znaidi S, De Deken X, Weber S, Rigby T, Nantel A, Raymond M. 2007. The zinc cluster transcription factor Tac1p regulates PDR16 expression in Candida albicans. Mol Microbiol 66:440–452. doi: 10.1111/j.1365-2958.2007.05931.x. [DOI] [PubMed] [Google Scholar]
  • 19.Köhler GA, White TC, Agabian N. 1997. Overexpression of a cloned IMP dehydrogenase gene of Candida albicans confers resistance to the specific inhibitor mycophenolic acid. J Bacteriol 179:2331–2338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Amberg DC, Burke DJ, Strathern JN. 2006. Isolation of yeast genomic DNA for Southern blot analysis. CSH Protoc 2006:pii=pdb.prot4149. [DOI] [PubMed] [Google Scholar]
  • 21.Holstege FC, Jennings EG, Wyrick JJ, Lee TI, Hengartner CJ, Green MR, Golub TR, Lander ES, Young RA. 1998. Dissecting the regulatory circuitry of a eukaryotic genome. Cell 95:717–728. doi: 10.1016/S0092-8674(00)81641-4. [DOI] [PubMed] [Google Scholar]
  • 22.Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671–675. doi: 10.1038/nmeth.2089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bruno VM, Wang Z, Marjani SL, Euskirchen GM, Martin J, Sherlock G, Snyder M. 2010. Comprehensive annotation of the transcriptome of the human fungal pathogen Candida albicans using RNA-seq. Genome Res 20:1451–1458. doi: 10.1101/gr.109553.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Marr KA, Rustad TR, Rex JH, White TC. 1999. The trailing end point phenotype in antifungal susceptibility testing is pH dependent. Antimicrob Agents Chemother 43:1383–1386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pasrija R, Panwar SL, Prasad R. 2008. Multidrug transporters CaCdr1p and CaMdr1p of Candida albicans display different lipid specificities: both ergosterol and sphingolipids are essential for targeting of CaCdr1p to membrane rafts. Antimicrob Agents Chemother 52:694–704. doi: 10.1128/AAC.00861-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Panwar SL, Moye-Rowley WS. 2006. Long chain base tolerance in Saccharomyces cerevisiae is induced by retrograde signals from the mitochondria. J Biol Chem 281:6376–6384. doi: 10.1074/jbc.M512115200. [DOI] [PubMed] [Google Scholar]
  • 27.Kolaczkowska A, Manente M, Kolaczkowski M, Laba J, Ghislain M, Wawrzycka D. 2012. The regulatory inputs controlling pleiotropic drug resistance and hypoxic response in yeast converge at the promoter of the aminocholesterol resistance gene RTA1. FEMS Yeast Res 12:279–292. doi: 10.1111/j.1567-1364.2011.00768.x. [DOI] [PubMed] [Google Scholar]
  • 28.Manente M, Ghislain M. 2009. The lipid-translocating exporter family and membrane phospholipid homeostasis in yeast. FEMS Yeast Res 9:673–687. doi: 10.1111/j.1567-1364.2009.00513.x. [DOI] [PubMed] [Google Scholar]
  • 29.Kihara A, Igarashi Y. 2002. Identification and characterization of a Saccharomyces cerevisiae gene, RSB1, involved in sphingoid long-chain base release. J Biol Chem 277:30048–30054. doi: 10.1074/jbc.M203385200. [DOI] [PubMed] [Google Scholar]
  • 30.Kihara A, Igarashi Y. 2004. Cross talk between sphingolipids and glycerophospholipids in the establishment of plasma membrane asymmetry. Mol Biol Cell 15:4949–4959. doi: 10.1091/mbc.E04-06-0458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Soustre I, Letourneux Y, Karst F. 1996. Characterization of the Saccharomyces cerevisiae RTA1 gene involved in 7-aminocholesterol resistance. Curr Genet 30:121–125. doi: 10.1007/s002940050110. [DOI] [PubMed] [Google Scholar]
  • 32.Gillum AM, Tsay EY, Kirsch DR. 1984. Isolation of the Candida albicans gene for orotidine-5′-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet 198:179–182. doi: 10.1007/BF00328721. [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES