LETTER
The recent description of the plasmid-mediated colistin resistance gene, mcr-1, in strains isolated from food animals, food, and humans in China was the signal for an avalanche of retrospective and prospective studies investigating the occurrence of this specific gene (1). The mcr-1 gene has been identified almost all over the world now, and the earliest evidence for its presence dates back to the 1980s (2). The mcr-1 gene has so far been associated with nonrelated types of plasmid replicons such as IncI2, IncHI2, IncP, IncFIB, and IncX4 (1, 3–5) and was found only rarely to be carried on the chromosome (6). This gene is part of a 2,600-bp-long fragment designated as the mcr-1 cassette that encompasses the likely promoter sequences for mcr-1 expression (7). The mcr-1 gene is most often located at the right-hand end of the insertion element ISApl1, together with a 723-bp-long open reading frame (ORF) named orf723 encoding a hypothetical protein. According to BLAST analysis, it is a putative phosphoesterase and shares 45% and 44% identities with those of Corynebacterium durum (GenBank accession no. WP_060996190.1) and Psychrobacter arcticus (GenBank accession no. WP_011280438.1), respectively. However, the putative contribution of this ORF to expression of the mcr-1 gene and subsequently to colistin resistance remains unknown.
Our goal was to evaluate the role of orf723 with respect to colistin resistance. Therefore, three Escherichia coli recombinant strains were constructed, with the same plasmid harboring either the mcr-1 gene alone, orf723 alone, or the entire mcr-1 cassette, respectively. The primers used to amplify the mcr-1 gene, the 723-bp ORF, and the whole mcr-1 cassette are listed in Table 1, and the mcr-1-positive E. coli strain OW3E1 (GenBank accession no. KX129783) was used as the template. Amplicons were doubly digested with restriction enzymes BamHI and EcoRI and cloned into the low-copy vector pCCR9 (NCBI Taxonomy database, NCBI Nucleotide database accession no. 125570) digested with the respective enzymes, to create vectors pCCR9::mcr-1, pCCR9::orf723, and pCCR9::mcr-1::orf723. The constructs were transformed by electrotransformation into E. coli DH5α, giving rise to recombinant strains DH5α::pCCR9::mcr-1, DH5α::pCCR9::orf723, and DH5α::pCCR9::mcr-1::orf723, respectively. MICs of colistin were determined using broth dilution tests as recommended by EUCAST.
TABLE 1.
Primers used for cloning of mcr-1, the hypothetical protein product, and the whole mcr-1 cassette
| Primer name | Sequence (5′→3′)a | Tm (°C)b | Location |
|---|---|---|---|
| mcr_BamHI_up | TTTTTTGGATCCGCCGCAATTATCCCACCG | 53 | 22 bp upstream of mcr-1 start codonc |
| mcr_EcoRI_dn | TTTTTTGAATTCCCACCGCCCATAATACGAATGG | 56 | 36 bp downstream of mcr-1 stop codon |
| orf723_BamHI_up2 | TTTTTTGGATCCGCACACTCCATTCGTATTATGGGC | 57 | 18 bp upstream of 723-bp ORF start codon |
| orf723_EcoRI_dn | TTTTTTGAATTCCCGTTCCTATTGGTAGTTTCCAGG | 56 | 81 bp downstream of 723-bp ORF stop codon |
The restriction sites are underlined.
Tm, melting temperature.
Downstream of putative promoter region.
The MICs are summarized in Table 2. The MIC values of recombinant strains expressing MCR-1 with and without orf723 were increased and identical. These results further confirm that expression of the mcr-1 gene confers reduced susceptibility to colistin. However, they show that orf723, which encodes a hypothetical protein and which has likely been comobilized with the mcr-1 gene from its original genetic context, does not impact colistin susceptibility.
TABLE 2.
Colistin MICs for each E. coli DH5α conjugant as well as the negative controls E. coli DH5α::pCCR9 and DH5αa
| Conjugant or strain | Colistin MIC (mg/liter) |
|---|---|
| DH5α::pCCR9::mcr-1 | 4 |
| DH5α::pCCR9::orf723 | 1 |
| DH5α::pCCR9::mcr-1::orf723 | 4 |
| DH5α::pCCR9 | 0.5 |
| DH5α | 1 |
MICs were determined using broth dilution tests as recommended by EUCAST.
ACKNOWLEDGMENT
The authors have no conflicts of interest to declare.
REFERENCES
- 1.Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Liu JH, Shen J. 2016. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis 16:161–168. doi: 10.1016/S1473-3099(15)00424-7. [DOI] [PubMed] [Google Scholar]
- 2.Schwarz S, Johnson AP. 2016. Transferable resistance to colistin: a new but old threat. J Antimicrob Chemother 71:2066–2070. doi: 10.1093/jac/dkw274. [DOI] [PubMed] [Google Scholar]
- 3.Nordmann P, Lienhard R, Kieffer N, Clerc O, Poirel L. 2016. Plasmid-mediated colistin-resistant Escherichia coli in bacteremia in Switzerland. Clin Infect Dis 62:1322–1323. doi: 10.1093/cid/ciw124. [DOI] [PubMed] [Google Scholar]
- 4.Zhi C, Lv L, Yu LF, Doi Y, Liu JH. 2016. Dissemination of the mcr-1 colistin resistance gene. Lancet Infect Dis 16:292–293. doi: 10.1016/S1473-3099(16)00063-3. [DOI] [PubMed] [Google Scholar]
- 5.Zurfluh K, Klumpp J, Nüesch-Inderbinen M, Stephan R. 20 June 2016. Full-length nucleotide sequences of mcr-1 harboring plasmids isolated from extended-spectrum β-lactamase (ESBL)-producing Escherichia coli of different origins. Antimicrob Agents Chemother doi: 10.1128/AAC.00935-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zurfluh K, Tasara T, Poirel L, Nordmann P, Stephan R. 2016. Draft genome sequence of Escherichia coli S51, a chicken isolate harboring a chromosomally-encoded mcr-1 gene. Genome Announc 4:e00796-16. doi: 10.1128/genomeA.00796-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Poirel L, Kieffer N, Brink A, Coetze J, Jayol A, Nordmann P. 2016. Genetic features of MCR-1-producing colistin-resistant Escherichia coli isolates in South Africa. Antimicrob Agents Chemother 60:4394–4397. doi: 10.1128/AAC.00444-16. [DOI] [PMC free article] [PubMed] [Google Scholar]