Abstract
Pituitary adenoma (PA) is one of the most common abnormalities in the sellar region. Despite the fact that PA is a benign monoclonal neoplasm, it can cause serious complications, including ophthalmological, neurological and endocrinological abnormalities. Currently, the causes that increase the progression of tumors are unknown. Epigenetic silencing of the matrix metalloproteinase-14 (MMP-14) and transforming growth factor beta-1 (TGFβ-1) genes may be associated with the development of PA, since these genes are important in the processes of tumor metastasis and angiogenesis. The purpose of the present study was to determine if the methylation status of the MMP-14 and TGFβ-1 promoters is associated with PA development. In the present study, 120 tissue samples of PA were used. The methylation status of the MMP-14 and TGFβ-1 promoters was investigated by methylation specific-polymerase chain reaction. Statistical analysis was conducted to investigate the associations between the methylation status, age and gender of PA patients, PA tumoral activity, recurrence and invasiveness. The MMP-14 gene was methylated in 30.00% (17/56 functioning and 19/64 non-functioning) of patients with PA, while the TGFβ-1 gene was methylated in 13.33% (9/56 functioning and 7/64 non-functioning) of patients with PA. It was also observed that promoter methylation of MMP-14 correlated with the male gender (58.8 vs. 35.7%, P=0.022), while unmethylated (non-silenced) MMP-14 correlated with the female gender (64.3 vs. 41.7%, P=0.027). Associations between the promoter methylation status of the MMP-14 and TGFβ-1 genes and PA functioning or recurrence were not identified. The present study reveals that silencing of the MMP-14 gene correlates with patients' gender. However, MMP-14 and TGFβ-1 promoter methylation cannot be considered as a prognostic marker in PAs.
Keywords: pituitary adenoma, matrix metalloproteinase-14, transforming growth factor beta-1, promoter, methylation, epigenetic deregulation
Introduction
Pituitary adenoma (PA) is a benign tumor originating in adenohypophyseal cells of the anterior lobe of the pituitary gland (1). The classification of PAs is based on the secretion of hormones; thus, PA can be a secreting (functioning) or a non-secreting (non-functioning) tumor (2). According to their size, adenomas are classified into microadenomas (≤10 mm) and macroadenomas (>10 mm) (2). Women have a 2-fold increased risk of developing PA in comparison with men (1). Most commonly, PA is a non-malignant tumor; however, it tends to recur (3). Usually, this tumor is soft and has no capsule that could isolate it from the surrounding mass of microglia (1). That is the reason why it can grow and infiltrate the surrounding structures. Adenomas may cause symptoms in two ways: i) Due to tumor-related hypersecretion or hyposecretion of hormones, in which case, the tumor causes compression to a normally functioning hypophysis; or ii) due to the compression exerted by the PA on the surrounding structures (2). Functionally active PAs cause less damage to the visual function than non-functioning PAs, since functioning PAs become symptomatic due to hormone secretion, whereas non-functioning PAs can grow slowly, compress the optic chiasm (which is located directly above the pituitary gland) and cause progressive visual loss (4).
The pathogenesis of PA is complex and poorly understood. It is considered that PA has a multifactorial etiology that includes genetic factors that have an impact on PA development (4,5).
Matrix metalloproteinases (MMPs) are a broad family of zinc-binding endopeptidases that aid to degrade the extracellular matrix, which is associated with cancer cell invasion, metastasis and angiogenesis (5). Human MMP-14, a membrane-bound zinc endopeptidase, is one of the most important cancer targets, since it plays central roles in tumor growth and invasion (6). MMP-14 is a membrane-type metalloproteinase with collagenase activity and potential roles in numerous biological processes in both normal and cancerous tissues (7). The majority of studies on MMP-14 primarily focus on angiogenesis and invasion (8,9). In addition to invasiveness, oncogenes and tumor suppressor genes associated with malignant transformation have received attention in the past years.
Transforming growth factor beta (TGF-β) signaling functions as a suppressor or a promoter in tumor development, depending on the tumor stage and type (10,11). TGFβ signaling is initiated by the binding of ligands (TGFβ1, TGFβ2 and TGFβ3) to type II TGFβ receptors (TGFβ RII), followed by the recruitment of type I TGFβ receptor (TGFβ RI) to form the complex (12–14). Next, TGFβ RII phosphorylates TGFβ RI to activate it (12–14). The clinical significance of TGFβ ligands and downstream signaling mediators has been studied in multiple types of tumors, and the results are discordant (12–14). It is known that MMP-14 works in the activation of TGF-β1 cytokine, but the MMP-14 molecule does not directly activate the TGFβ-1 cytokine by causing collagen degradation prior to the involvement of thrombospondin 1 (15).
To the best of our knowledge, there are no studies on the role of TGFβ-1 and MMP-14 in patients with PA. Therefore, the aim of the present study is to investigate the role of the TGF-β1 and MMP-14 signaling pathways in PA tumor development.
Materials and methods
Subjects and ethical statement
The promoter methylation status of TGFβ-1 and MMP-14 was analyzed in 120 PA tumor tissues. All PA tumor samples were surgically resected in the Department of Neurosurgery, Hospital of Lithuanian University of Health Sciences Kaunas Clinics (Kaunas, Lithuania), and were histologically diagnosed in the Department of Anatomical Pathology, Hospital of Lithuanian University of Health Sciences Kaunas Clinics. PA samples were snap-frozen in liquid nitrogen prior to DNA extraction. Approval (no. P2-9/2003) to undertake the study was obtained from the Kaunas Regional Biomedical Research Ethics Committee (Kaunas, Lithuania). The study was conducted in the Departments of Ophthalmology and Neurosurgery, Hospital of Lithuanian University of Health Sciences Kaunas Clinics between February 2010 and May 2015. Written patient consent under the approval of the Ethics Committee of Lithuanian University of Health Sciences was obtained for every patient.
The inclusion criteria were as follows: i) Determined and confirmed PA via magnetic resonance imaging (MRI); ii) patient's general good condition; iii) patient's consent to participate in the study; iv) patient's age ≥18 years; and v) no other tumors localized in the brain or other organs. The following data were determined for each patient: Age at the time of operation, gender, promoter methylation status of the genes TGFβ-1 and MMP-14, hormones activity and recurrence of PA.
Invasiveness evaluation
All PAs were anatomically analyzed based on MRI findings. PA invasiveness was confirmed by a surgeon. The suprasellar extension and sphenoid sinus invasion by PAs were classified according to the Wilson-Hardy classification (Hardy classification modified by Wilson) (16). The degree of suprasellar and parasellar extension was graded as stages A-E. The degree of sellar floor erosion was graded as grades I–IV. Grade III, localized sellar destruction, and grade IV, diffuse destruction, were considered as invasive PA. The Knosp classification system was used to quantify invasion of the cavernous sinus, in which only grades 3 and 4 define true invasion of the tumor into the cavernous sinus: Grade 0, no cavernous sinus involvement; grades 1 and 2, the tumor pushes into the medial wall of the cavernous sinus, but does not go beyond a hypothetical line extending between the centres of the two segments of the internal carotid artery (grade 1) or it goes beyond such a line, but without passing a line tangent to the lateral margins of the artery itself (grade 2); grade 3, the tumor extends laterally to the internal carotid artery within the cavernous sinus; and grade 4, total encasement of the intracavernous carotid artery (17). Therefore, only grade III and IV tumors were considered to be invasive.
DNA extraction and modification
Tumor DNA was extracted from 50–100 mg of frozen PA tissue using the salting-out method (12–14). The methylation status of the MMP-14 and TGFβ-1 genes promoter was determined by bisulfite treatment of DNA. A total of 400 ng DNA was used for bisulfite modification, which was performed using an EZ DNA Methylation kit (Zymo Research Corporation, Irvine, CA, USA), according to the manufacturer's protocol. Bisulfite-treated DNA was eluted in 40 µl distilled nuclease-free water, and stored at −80°C until subjected to methylation specific-polymerase chain reaction (MS-PCR).
MS-PCR
The methylation status of the TGFβ-1 and MMP-14 promoters region was determined by MS-PCR. Primers distinguishing unmethylated and methylated alleles were designed using ‘MethPrimer’ (18), and their sequences are presented in Table I.
Table I.
Methylation specific-polymerase chain reaction primers.
| Gene | Forward primer 5′-3′ | Reverse primer 5′-3′ |
|---|---|---|
| MMP-14 (U) | TTTATTGAAGATAAACGTGTTTTGA | CATAAACAAAAAAAACAAAAAACAACA |
| MMP-14 (M) | TTTATCGAAGATAAAGGCGTTTC | GTAAACAAAAAAAACAAAAAACAACG |
| TGFβ-1 (U) | GTGGGTTTTTATTATTAGTATGTGG | AAATCCTATCCAAACTACAACTCAC |
| TGFβ-1 (M) | TTGTGGGTTTTTATTATTAGTACGC | AAATCCTATCCAAACTACGACTCG |
U, unmethylated; M, methylated; MMP, matrix metalloproteinase; TGF, transforming growth factor.
MS-PCR was performed in a total volume of 15 µl, using Maxima Hot Start Green PCR Master Mix (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with Hot Start Taq DNA polymerase and 10 pmol of each primer (Invitrogen; Thermo Fisher Scientific, Inc.). Each MS-PCR incorporated ~20 ng of bisulfite-treated DNA as a template. Human blood lymphocyte DNA treated with bisulfite served as an unmethylated DNA control, while CpG Methylated Human Genomic DNA (Thermo Fisher Scientific, Inc.) was used as a positive methylation control. A blank water control was also included. The conditions for MMP-14 MS-PCR were as follows: 95°C for 5 min, followed by 39 cycles of 95°C for 15 sec, 57°C for 30 sec and 72°C for 30 sec, and a final step at 72°C for 5 min. The conditions for TGFβ-1 gene amplification were almost identical to those for MMP-14, with the exception of the number of cycles (38) and the temperature used in the second step of each cycle (60°C). The amplified products were analyzed on 2% agarose gels with 0.5 µg/ml (final concentration) of ethidium bromide and visualized under ultraviolet light. The presence of PCR products of the correct molecular weight indicated the presence of either methylated or unmethylated alleles.
Statistical analysis
For statistical analyses, SPSS version 20 (IBM SPSS, Armonk, NY, USA) was used. Statistical analyses were conducted to investigate the association between methylation status, age, gender, PA tumoral activity and recurrence. Associations between gene methylation data and clinical features of PA patients were evaluated using the χ2 test. P<0.05 was considered to indicate a statistically significant difference.
Results
Characteristics of PA patients
The median age at PA diagnosis was 56.0 years, with an age range from 18 to 84 years. The male to female ratio was 1:1.35. The median age of males (n=51) was 57.0 years and of females (n=69) 56.0 years. The samples were divided into two groups: Functioning (n=56) and non-functioning (n=64) PAs. Recurrence was observed only in 12 cases out of 120 (3/56 functioning and 9/64 non-functioning) PAs. Invasiveness was evaluated in 104 (35 non-invasive and 69 invasive) cases of PA.
MMP-14 and TGFβ-1 gene promoter methylation frequency in PA
The methylation status of the MMP-14 and TGFβ-1 promoters in PA tumor samples was detected by MS-PCR. The methylation status of the MMP-14 and TGFβ-1 promoters was evaluated in 120 PA tumors. Representative samples are shown in Fig. 1. The detection of bands with both primer sets was observed in a number of samples but not in all PA tumor samples, probably due to the existence of non-malignant cells in a fraction of the samples or to the methylation of only one allele of the gene. MMP-14 promoter hypermethylation was detected in 30.00% (36/120) of PAs, while the TGFβ-1 gene promoter was methylated in 13.33% (16/120) of patients with PA. Both genes were methylated in only 5 samples.
Figure 1.
Genes promoter methylation status in PA by the methylation-specific polymerase chain reaction assay. MC, methylated control; UC, unmethylated control; BC, blank control; M, methylated; U, unmethylated; PA, pituitary adenoma sample; MMP, matrix metalloproteinase; TGF, transforming growth factor.
Statistical analysis of age and genes methylation revealed no correlation between them (χ2 test; age and MMP-14 methylation, P=0.952; and age and TGFβ-1, P=0.971).
MMP-14 methylation was significantly associated with male gender (58.8 vs. 35.7%, P=0.022), while unmethylated MMP-14 was associated with female gender (64.3 vs. 41.7%, P=0.027). It was also observed that 45/51 males had non-silenced TGFβ-1 gene. However, this was not significant (χ2 test, P=0.664). Associations between methylation status and PA functioning or recurrence were not identified (P>0.05) (Table II).
Table II.
Associations between clinical data of patients and genes methylation.
| MMP-14 | TGFβ-1 | ||||
|---|---|---|---|---|---|
| Factor | N (%) | U, N (%) | M, N (%) | U, N (%) | M, N (%) |
| Age, years | |||||
| ≤56 | 60 (50.0) | 42 (70.0) | 18 (30.0) | 52 (86.7) | 8 (13.3) |
| >56 | 59 (49.2) | 41 (69.5) | 18 (30.5) | 51 (86.4) | 8 (13.6) |
| P=0.952 | P=0.971 | ||||
| Gender | |||||
| Females | 69 (57.5) | 44 (78.3) | 15 (21.7) | 59 (85.5) | 10 (14.5) |
| Males | 51 (42.5) | 30 (58.8) | 21 (41.2) | 45 (88.2) | 6 (11.8) |
| P=0.027 | P=0.022 | P=0.664 | |||
| Hormones activity | |||||
| None | 64 (53.3) | 45 (70.3) | 19 (29.7) | 57 (89.1) | 7 (10.9) |
| Appear | 56 (46.7) | 39 (69.6) | 17 (30.4) | 47 (83.9) | 9 (16.1) |
| P=0.936 | P=0.409 | ||||
| Recurrence | |||||
| None | 108 (90.0) | 76 (70.4) | 32 (29.6) | 94 (87.0) | 14 (13.0) |
| Appear | 12 (10.0) | 8 (66.7) | 4 (33.3) | 10 (83.3) | 2 (16.7) |
| P=0.751 | P=0.662 | ||||
| N (%) | 120 (100.0) | 84 (70.0) | 36 (30.0) | 104 (86.7) | 16 (13.3) |
| Invasiveness | |||||
| None | 35 (33.7) | 27 (77.1) | 8 (22.9) | 29 (82.9) | 6 (17.1) |
| Appear | 69 (66.3) | 44 (63.8) | 25 (36.2) | 62 (89.9) | 7 (10.1) |
| P=0.166 | P=0.308 | ||||
| N (%) | 104 (100.0) | 71 (68.3) | 33 (31.7) | 91 (87.5) | 13 (12.5) |
U, unmethylated; M, methylated gene; MMP, matrix metalloproteinase; TGF, transforming growth factor.
Invasiveness and methylation of both genes had no correlation (χ2 test, P=0.166 and P=0.308). However, >50% (62/104) of PAs were invasive and had an unmethylated TGFβ-1 gene. A correlation between invasiveness and age groups was also observed, since 40/69 PAs corresponded to patients who were ≤56 years old (χ2 test, P=0.037).
Discussion
PA is a common benign monoclonal neoplasm accounting for 15–20% of all primary intracranial tumors (19). Pituitary tumors are benign, but not uncommonly, they invade locally into adjacent tissues such as the cavernous sinus and dura (20). Early prediction of which pituitary tumors will recur and/or exhibit an invasive phenotype remains difficult despite the introduction of several tissue-based molecular markers (20).
It is known that promoter hypermethylation silences gene transcription, resulting in a shortage of expression of one or another protein (21). Membrane type-1 (MT1)-MMP is an activator of soluble MMP-2 (22). The activity of both MMPs is regulated by their physiological inhibitor, tissue inhibitor of metalloproteinase (TIMP)-2 (22). An MT1-MMP/MMP-2/TIMP-2 axis plays a key role in the invasive behavior of numerous cell types (22). It was observed that hypermethylation of the MMP-14 and MMP-2 genes correlates with non-invasive tumor behavior (22). To the best of our knowledge, there are no studies that have explored the association between MMP-14 methylation status and the development of PA. Previously, Altaş et al (23) investigated single nucleotide polymorphism (SNP) in the promoter of another gene of same MMP family, and analyzed how that polymorphism is linked to PA development. It is known that MMP-14 and MMP-1 function similarly in the degradation of collagen fibers (22). In agreement with this, Altaş et al observed that SNP of the MMP-1 gene promoter in both alleles caused a higher risk of PA development and invasiveness than SNP of the MMP-1 gene promoter in only one allele (23). In addition, high expression of the MMP-14 gene was detected in invasive PA and was associated with invasiveness (24).
The present study examined whether alterations in a gene promoter are associated with PA occurrences. The current study analyzed 120 PA patients for MMP-14 promoter methylation. The results demonstrated that promoter methylation of MMP-14 correlated with male gender (58.8 vs. 35.7%, P=0.022), while unmethylated (non-silenced) MMP-14 correlated with female gender (64.3 vs. 41.7%, P=0.027). It is known that the incidence of PA is double in females compared with males (1). That is why it can be assumed that the non-silenced MMP-14 gene may be associated with PA cases in females.
The present study also investigated the methylation status of the promoter of the TGFβ-1 gene. However, no associations between the promoter methylation status of the TGFβ-1 gene and the age and gender of PA patients, PA hormone activity or recurrence were identified. By contrast, it was observed that the majority of the males' PA samples were in the TGFβ-1 unmethylated group. In other studies on PA using animal models it was noticed that there was a higher expression of the TGF-β1 cytokine in male than in female individuals (15). Therefore, the expression of this gene may be associated with male gender, although further research is required. There are no studies on potential associations between methylation of the TGFβ-1 gene and the secreting function of PA. However, TGF-β1 activity was observed in hormonally active PA (15,25). In other studies, which compared healthy and unhealthy pituitary tissue, low TGFβ-1 gene expression was detected in both non-invasive and invasive hormonally inactive PA (26). This demonstrates that TGFβ-1 gene transcription happens depending on the type of cancer and the stage of the cancer process; therefore, further research is required to identify how this gene is effected by regulating its expression in the cell.
In another study, Elenkova et al (27) reported that TGF-β1 could be a predictive blood serum marker for the invasiveness of PA. The TGFβ-1 gene has been widely studied in other tumors. Chen et al studied the expression of this gene in patients with breast cancer and established links with poorer patient clinic outcome (28). Studies involving lung tumor cell lines have demonstrated that this gene is important in cell proliferation (29). TGF-β1 is also commonly used in cancer studies. There are in vitro studies on TGF-β1 function in cancer cell lines other than lung cancer and pituitary adenoma cells (30). Xiao et al analyzed the risks of radiation-induced pneumonia manifestation in patients with thoracic tumors, and TGF-β1 SNP was considered as a possible risk factor (31).
The role of the aforementioned genes has been studied in cancer and various other disorders. Previous studies have reported that MMP-14 is associated with tuberculosis by regulating monocyte migration and collagen destruction (32), and with macrophage activation in atherosclerosis (33). TGF-β1 function has been observed in brain and nerve damage (34). Thus, these genes appear to be responsible for a number of molecular mechanisms that are important in the etiology of various pathological processes.
In conclusion, to the best of our knowledge, the present study is the first to examine in a large population with PA (n=120) the association between the MMP-14 and TGFβ-1 promoters methylation status and the development of PA. The present study has demonstrated for the first time that promoter methylation of MMP-14 correlates with male gender and unmethylated (non-silenced) MMP-14 correlates with female gender. Further investigation is required to evaluate the effect of promoter methylation of MMP-14 on the development of PA.
References
- 1.Nistor R. Pituitary tumors. Neuro Rew. 1996;57:264–272. [Google Scholar]
- 2.Kovacs K, Scheithauer BW, Horvath E, Lloyd RV. The world health organization classification of adenohypophysial neoplasms: A proposed five-tier scheme. Cancer. 1996;78:502–510. doi: 10.1002/(SICI)1097-0142(19960801)78:3<502::AID-CNCR18>3.0.CO;2-2. [DOI] [PubMed] [Google Scholar]
- 3.Monteiro ML, Moura FC, Cunha LP. Frequency doubling perimetry in patients with mild and moderate pituitary tumor-associated visual field defects detected by conventional perimetry. Arq Bras Oftalmol. 2007;70:323–329. doi: 10.1590/S0004-27492007000200024. [DOI] [PubMed] [Google Scholar]
- 4.Jagannathan J, Dumont AS, Prevedello DM, Lopes B, Oskouian RJ, Jane JA, Jr, Laws ER., Jr Genetics of pituitary adenomas: Current theories and future implications. Neurosurg Focus. 2005;19:E4. [PubMed] [Google Scholar]
- 5.Yadav L, Puri N, Rastogi V, Satpute P, Ahmad R, Kaur G. Matrix metalloproteinases and cancer-roles in threat and therapy. Asian Pac J Cancer Prev. 2014;15:1085–1091. doi: 10.7314/APJCP.2014.15.3.1085. [DOI] [PubMed] [Google Scholar]
- 6.Nam DH, Ge X. Direct production of functional matrix metalloproteinase-14 without refolding or activation and its application for in vitro inhibition assays. Biotechnol Bioeng. 2016;113:717–723. doi: 10.1002/bit.25840. [DOI] [PubMed] [Google Scholar]
- 7.Lehti K, Allen E, Birkedal-Hansen H, Holmbeck K, Miyake Y, Chun TH, Weiss SJ. An MT1-MMP-PDGF receptor-beta axis regulates mural cell investment of the microvasculature. Genes Dev. 2005;19:979–991. doi: 10.1101/gad.1294605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Sabeh F, Ota I, Holmbeck K, Birkedal-Hansen H, Soloway P, Balbin M, Lopez-Otin C, Shapiro S, Inada M, Krane S, et al. Tumor cell traffic through the extracellular matrix is controlled by the membrane-anchored collagenase MT1-MMP. J Cell Biol. 2004;167:769–781. doi: 10.1083/jcb.200408028. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Jiang WG, Davies G, Martin TA, Parr C, Watkins G, Mason MD, Mansel RE. Expression of membrane type-1 matrix metalloproteinase, MT1-MMP in human breast cancer and its impact on invasiveness of breast cancer cells. Int J Mol Med. 2006;17:583–590. [PubMed] [Google Scholar]
- 10.Massagué J. TGFbeta in Cancer. Cell. 2008;134:215–230. doi: 10.1016/j.cell.2008.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wakefield LM, Roberts AB. TGF-beta signaling: Positive and negative effects on tumorigenesis. Curr Opin Genet Dev. 2002;12:22–29. doi: 10.1016/S0959-437X(01)00259-3. [DOI] [PubMed] [Google Scholar]
- 12.Johnson MD, Shaw AK, O'Connell MJ, Sim FJ, Moses HL. Analysis of transforming growth factor beta receptor expression and signaling in higher grade meningiomas. J Neurooncol. 2011;103:277–285. doi: 10.1007/s11060-010-0399-y. [DOI] [PubMed] [Google Scholar]
- 13.Bruna A, Darken RS, Rojo F, Ocaña A, Peñuelas S, Arias A, Paris R, Tortosa A, Mora J, Baselga J, Seoane J. High TGFbeta-Smad activity confers poor prognosis in glioma patients and promotes cell proliferation depending on the methylation of the PDGF-B gene. Cancer Cell. 2007;11:147–160. doi: 10.1016/j.ccr.2006.11.023. [DOI] [PubMed] [Google Scholar]
- 14.Wu Y, Li Q, Zhou X, Yu J, Mu Y, Munker S, Xu C, Shen Z, Müllenbach R, Liu Y, et al. Decreased levels of active SMAD2 correlate with poor prognosis in gastric cancer. PLoS One. 2012;7:e35684. doi: 10.1371/journal.pone.0035684. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Recouvreux MV, Lapyckyj L, Camilletti MA, Guida MC, Ornstein A, Rifkin DB, Becu-Villalobos D, Díaz-Torga G. Sex differences in the pituitary transforming growth factor-β1 system: Studies in a model of resistant prolactinomas. Endocrinology. 2013;154:4192–4205. doi: 10.1210/en.2013-1433. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wilson CB. Neurosurgical management of large and invasive pituitary tumors. In: Tindall GT, Collins WF, editors. Clinical Management of Pituitary Disorders. New York Raven Press; New York: 1979. pp. 335–342. [Google Scholar]
- 17.Knosp E, Steiner E, Kitz K, Matula C. Pituitary adenomas with invasion of the cavernous sinus space: A magnetic resonance imaging classification compared with surgical findings. Neurosurgery. 1993;33:610–617. doi: 10.1097/00006123-199310000-00008. discussion 617–618. [DOI] [PubMed] [Google Scholar]
- 18.Li LC, Dahiya R. MethPrimer: Designing primers for methylation PCRs. Bioinformatics. 2002;18:1427–1431. doi: 10.1093/bioinformatics/18.11.1427. [DOI] [PubMed] [Google Scholar]
- 19.Page RB. Sellar and parasellar tumors. In: Wilkins RH, Rengachary SS, editors. Neurosurgery. McGraw-Hill; 1996. pp. 791–804. [Google Scholar]
- 20.Heaney A. Management of aggressive pituitary adenomas and pituitary carcinomas. J Neurooncol. 2014;117:459–468. doi: 10.1007/s11060-014-1413-6. [DOI] [PubMed] [Google Scholar]
- 21.Kulis M, Esteller M. DNA methylation and cancer. Adv Genet. 2010;70:27–56. doi: 10.1016/B978-0-12-380866-0.60002-2. [DOI] [PubMed] [Google Scholar]
- 22.Chernov AV, Sounni NE, Remacle AG, Strongin AY. Epigenetic control of the invasion-promoting MT1-MMP/MMP-2/TIMP-2 axis in cancer cells. J Biol Chem. 2009;284:12727–12734. doi: 10.1074/jbc.M900273200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Altaş M, Bayrak OF, Ayan E, Bolukbasi F, Silav G, Coskun KK, Culha M, Sahin F, Sevli S, Elmaci I. The effect of polymorphisms in the promoter region of the MMP-1 gene on the occurrence and invasiveness of hypophyseal adenoma. Acta Neurochir (Wien) 2010;152:1611–1617. doi: 10.1007/s00701-010-0671-0. discussion 1617. [DOI] [PubMed] [Google Scholar]
- 24.Hui P, Xu X, Xu L, Hui G, Wu S, Lan Q. Expression of MMP14 in invasive pituitary adenomas: Relationship to invasion and angiogenesis. Int J Clin Exp Pathol. 2015;8:3556–3567. [PMC free article] [PubMed] [Google Scholar]
- 25.Recouvreux MV, Camilletti MA, Rifkin DB, Becu-Villalobos D, Díaz-Torga G. Thrombospondin-1 (TSP-1) analogs ABT-510 and ABT-898 inhibit prolactinoma growth and recover active pituitary transforming growth factor-β1 (TGF-β1) Endocrinology. 2012;153:3861–3871. doi: 10.1210/en.2012-1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Zhenye L, Chuzhong L, Youtu W, Xiaolei L, Lei C, Lichuan H, Hongyun W, Yonggang W, Fei W, Yazhuo Z. The expression of TGF-β1, Smad3, phospho-Smad3 and Smad7 is correlated with the development and invasion of nonfunctioning pituitary adenomas. J Transl Med. 2014;12:71. doi: 10.1186/1479-5876-12-71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Elenkova A, Atanassova I, Kirilov G, Vasilev V, Kalinov K, Zacharieva S. Transforming growth factor β1 is not a reliable biomarker for valvular fibrosis but could be a potential serum marker for invasiveness of prolactinomas (pilot study) Eur J Endocrinol. 2013;169:299–306. doi: 10.1530/EJE-13-0081. [DOI] [PubMed] [Google Scholar]
- 28.Chen C, Zhao KN, Masci PP, Lakhani SR, Antonsson A, Simpson PT, Vitetta L. TGFβ isoforms and receptors mRNA expression in breast tumors: Prognostic value and clinical implications. BMC Cancer. 2015;15:1010. doi: 10.1186/s12885-015-1993-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Liu ZY, Zhang GL, Wang MM, Xiong YN, Cui HQ. MicroRNA-663 targets TGFB1 and regulates lung cancer proliferation. Asian Pac J Cancer Prev. 2011;12:2819–2823. [PubMed] [Google Scholar]
- 30.Wang Y, Jiang M, Li Z, Wang J, Du C, Yanyang L, Yu Y, Wang X, Zhang N, Zhao M, et al. Hypoxia and TGF-β1 lead to endostatin resistance by cooperatively increasing cancer stem cells in A549 transplantation tumors. Cell Biosci. 2015;5:72. doi: 10.1186/s13578-015-0064-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Xiao Y, Yuan X, Qiu H, Li Q. Single-nucleotide polymorphisms of TGFβ1 and ATM associated with radiation-induced pneumonitis: A prospective cohort study of thoracic cancer patients in China. Int J Clin Exp Med. 2015;8:16403–16413. [PMC free article] [PubMed] [Google Scholar]
- 32.Sathyamoorthy T, Tezera LB, Walker NF, Brilha S, Saraiva L, Mauri FA, Wilkinson RJ, Friedland JS, Elkington PT. Membrane type 1 matrix metalloproteinase regulates monocyte migration and collagen destruction in tuberculosis. J Immunol. 2015;195:882–891. doi: 10.4049/jimmunol.1403110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Johnson JL, Jenkins NP, Huang WC, Di Gregoli K, Sala-Newby GB, Scholtes VP, Moll FL, Pasterkamp G, Newby AC. Relationship of MMP-14 and TIMP-3 expression with macrophage activation and human atherosclerotic plaque vulnerability. Mediators Inflamm. 2014;2014:276457. doi: 10.1155/2014/276457. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Vincze C, Pál G, Wappler EA, Szabó ER, Nagy ZG, Lovas G, Dobolyi A. Distribution of mRNAs encoding transforming growth factors-beta1, −2 and −3 in the intact rat brain and after experimentally induced focal ischemia. J Comp Neurol. 2010;518:3752–3770. doi: 10.1002/cne.22422. [DOI] [PubMed] [Google Scholar]