Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2016 Jun 9;594(19):5711–5725. doi: 10.1113/JP272318

Influence of brain‐derived neurotrophic factor‐tyrosine receptor kinase B signalling in the nucleus tractus solitarius on baroreflex sensitivity in rats with chronic heart failure

Bryan K Becker 1,2, Changhai Tian 1, Irving H Zucker 1, Han‐Jun Wang 1,3,✉
PMCID: PMC5043030  PMID: 27151332

Abstract

Key points

  • Impairment of baroreflex function is associated with the progression of chronic heart failure (CHF) and a poor prognosis. The baroreflex desensitization in CHF is at least partly the result of central neuronal network dysfunction.

  • The dorsal medial nucleus tractus solitarius (dmNTS) has long been appreciated as a primary site of baroreceptor afferent termination in the central nervous system. However, the influence of neurotransmitters and neuromodulators in the dmNTS on baroreflex function both in normal and CHF states is not fully understood.

  • The present study provides the first evidence showing a tonic sympatho‐inhibitory role for brain‐derived neurotrophic factor (BDNF) neurotransmission in the dmNTS. Most importantly, BDNF‐ tyrosine receptor kinase B (TrkB) signalling in the dmNTS is integral for normal baroreflex function as indicated by the blunting of baroreflex sensitivity (BRS) following the antagonization of TrkB, which inhibited baroreflex gain and range.

  • Furthermore, we found that the tonic sympatho‐inhibition of BDNF was withdrawn in the CHF state, thus contributing to the increased sympathetic tone associated with CHF. Consistent with this finding, BDNF/TrkB antagonism had little effect on reducing BRS in CHF animals, which is corroborated by the observation of decreased TrkB expression in the dmNTS during CHF. Taken together, these results implicate a reduction in BDNF‐TrkB signalling in the dmNTS during CHF that contributes to sympatho‐excitation and baroreflex desensitization.

  • The observation that the BDNF/TrkB pathway is impaired in the dmNTS during CHF provides a novel mechanism for understanding the central alterations that contribute to baroreflex desensitization during CHF.

Abstract

Chronic heart failure (CHF) results in blunting of arterial baroreflex sensitivity (BRS), which arises from alterations to both peripheral baroreceptors and central autonomic nuclei such as the nucleus tractus solitarius (NTS). Although glutamate is known to be an important neurotransmitter released from baroreceptor afferent synapses in the NTS, the influence of other neurotransmitters and neuromodulators remains unclear. Alterations to NTS signalling in CHF remain particularly undefined. The present study aimed to evaluate the role of brain‐derived neurotrophic factor (BDNF) and tyrosine receptor kinase B (TrkB) receptor signalling in the NTS on baroreflex control both in healthy and CHF rats. To this end, we microinjected BDNF or the highly selective TrkB receptor antagonist [N2‐2‐2‐oxoazepan‐3‐yl amino] carbonyl phenyl benzo (b)thiophene‐2‐carboxamide (ANA‐12) into the dorsal medial NTS (dmNTS) of male Sprague–Dawley rats with coronary artery ligation‐induced CHF and sham operated controls and recorded blood pressure and renal sympathetic nerve activity responses. We subsequently measured BRS before and after bilateral dmNTS microinjections of ANA‐12. In sham rats, BDNF evoked a dose‐dependent depressor and sympatho‐inhibitory effect and ANA‐12 produced the opposite response. Both of these responses were significantly blunted in CHF rats. Furthermore, bilateral microinjection of ANA‐12 into the dmNTS greatly diminished baroreflex sensitivity in sham rats, whereas it had less of an effect in CHF rats. We observed decreased levels of TrkB protein and mRNA in the dmNTS of CHF rats. These data indicate that endogenous BDNF signalling in the NTS is integral for the maintenance of BRS and that BDNF/TrkB signalling is impaired in the NTS in the CHF state.

Key points

  • Impairment of baroreflex function is associated with the progression of chronic heart failure (CHF) and a poor prognosis. The baroreflex desensitization in CHF is at least partly the result of central neuronal network dysfunction.

  • The dorsal medial nucleus tractus solitarius (dmNTS) has long been appreciated as a primary site of baroreceptor afferent termination in the central nervous system. However, the influence of neurotransmitters and neuromodulators in the dmNTS on baroreflex function both in normal and CHF states is not fully understood.

  • The present study provides the first evidence showing a tonic sympatho‐inhibitory role for brain‐derived neurotrophic factor (BDNF) neurotransmission in the dmNTS. Most importantly, BDNF‐ tyrosine receptor kinase B (TrkB) signalling in the dmNTS is integral for normal baroreflex function as indicated by the blunting of baroreflex sensitivity (BRS) following the antagonization of TrkB, which inhibited baroreflex gain and range.

  • Furthermore, we found that the tonic sympatho‐inhibition of BDNF was withdrawn in the CHF state, thus contributing to the increased sympathetic tone associated with CHF. Consistent with this finding, BDNF/TrkB antagonism had little effect on reducing BRS in CHF animals, which is corroborated by the observation of decreased TrkB expression in the dmNTS during CHF. Taken together, these results implicate a reduction in BDNF‐TrkB signalling in the dmNTS during CHF that contributes to sympatho‐excitation and baroreflex desensitization.

  • The observation that the BDNF/TrkB pathway is impaired in the dmNTS during CHF provides a novel mechanism for understanding the central alterations that contribute to baroreflex desensitization during CHF.

Abbreviations

aCSF

artificial cerebrospinal fluid

ANA‐12

[N2‐2‐2‐oxoazepan‐3‐yl amino] carbonyl phenyl benzo (b)thiophene‐2‐carboxamide

BDNF

brain‐derived neurotrophic factor

BRS

baroreflex sensitivity

CHF

chronic heart failure

dmNTS

dorsal medial nucleus tractus solitarius

dp/dtmax

maximum first derivative of left ventricular

dp/dtmin

minimum first derivative of left ventricular

HR

heart rate

LVEDP

left ventricular end‐diastolic pressure

MAP

mean blood pressure

RSNA

renal sympathetic nerve activity

TrkB

tyrosine receptor kinase B

Introduction

Chronic heart failure (CHF) is a prevalent disease characterized by numerous humoral and autonomic alterations such as an increased sympathetic nervous system tone and a desensitization of baroreflex control (Zucker et al. 2012). Baroreflex control of heart rate (HR) and sympathetic nerve activity provides an important short‐term feedback loop that buffers changes to mean arterial pressure (MAP) and controls cardiac output. Alterations in baroreflex sensitivity (BRS) are indicative of dysautonomia and altered feedback control of the cardiovascular system in the CHF state (Goldstein et al. 1975; Zucker et al. 2009). Baroreflex desensitization is prognostic for negative outcomes in patients with CHF (Schwartz et al. 1988; La Rovere et al. 1998). A reduction in BRS may result from numerous peripheral and central alterations (Gnecchi Ruscone et al. 1987; Gao et al. 2005; Wang et al. 2008), many of which are still unknown. The dorsal medial nucleus of the tractus solitarius (dmNTS) comprises the primary central termination of baroreceptor afferents and serves as the initiating central site of the baroreflex arc (Seller & Illert, 1969; Jordan & Spyer, 1977; Tang & Dworkin, 2007, 2009). Although previous studies have reported a role for glutamatergic signalling in the dmNTS (Dietrich et al. 1982; Andresen & Yang, 1995), the involvement of other neurotransmitters and neuromodulators in baroreflex control at the level of dmNTS, especially in the CHF state, remains largely unknown. In addition, there is a lack of understanding of the role played by neurotrophic factors that may influence central desensitization of the baroreflex in CHF.

The family of neurotrophic factors comprises one such class of potential factors that may influence autonomic neuronal activity. Classically, the role of neurotrophic factors has been understood to be important during development and dendritic sprouting (Levi‐Montalcini et al. 1954; Cohen & Levi‐Montalcini, 1957; Levi‐Montalcini & Calissano, 1979). More recently, attention has focused on clarifying the role of neurotrophic factors in neuronal network patterning and neuronal sensitivity by facilitating actions such as long‐term potentiation (Minichiello, 2009; Park et al. 2014). For example, brain‐derived neurotrophic factor (BDNF) has been implicated in autonomic pathway dysfunction (Mattson & Wan, 2008; Martin et al. 2009). BDNF can function as both a neurotransmitter and neuromodulator and can thus act both acutely and chronically to alter neuronal firing and neuronal sensitivity to synaptic input (Rose et al. 2004). Signalling by BDNF and its receptor, tyrosine receptor kinase B (TrkB), has long been understood to potentiate synapses by modulating neurotransmitter release, increasing glutamatergic signalling and increasing excitatory ion channel activity in a large number of neuronal pathways, such as in the hippocampus (Minichiello, 2009). However, whether BDNF‐TrkB signalling in the NTS is involved in autonomic regulation both in normal and CHF states is unknown. Therefore, the present study aimed: (1) to identify a role for BDNF‐TrkB signalling at the level of dmNTS in modulating baroreflex function in the normal state and (2) to explore the potential contribution of abnormal BDNF‐TrkB signalling to the central desensitization of baroreflex function in animals with CHF.

Methods

Experiments were performed on male Sprague–Dawley rats weighing ∼400–520 g at the time of the acute experiment. These experiments were approved by the Institutional Animal Care and Use Committee of the University of Nebraska Medical Centre and were carried out under the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All steps were taken to minimize the animals’ pain and suffering.

Model of CHF

CHF was produced by left coronary artery ligation as described previously (Wang et al. 2010 b, 2010 a, 2014). Briefly, the rat was ventilated at a rate of 60 breaths min−1 with 3% isoflurane during the surgical procedure. A left thoracotomy was performed through the fifth intercostal space, the pericardium was opened, the heart was exteriorized, and the left anterior descending coronary artery was ligated. Sham‐operated rats were prepared in the same manner but did not undergo coronary artery ligation. All rats (n = 24) survived the sham surgery. However, ∼74% (26 out of 35) survived coronary artery ligation surgery. Three infarcted rats were excluded as a result of a small infarct size (<15%) measured at the time of the terminal acute experiment.

Cardiac function was measured by echocardiography (VEVO 770; Visual Sonics, Inc., Toronto, Canada) as described previously (Wang et al. 2014) in all animals 6 weeks post myocardial infarction or sham surgery. In addition, at the beginning of the acute experiments (∼14 weeks post myocardial infarction), a Millar catheter (SPR 524; size 3.5 Fr; Millar Instruments, Houston, TX, USA) was advanced through the right carotid artery into the left ventricle (LV) to determine LV end‐diastolic pressure (LVEDP), LV systolic pressure, the maximum first derivative of LV pressure (dp/dt max) and minimum first derivative of LV pressure (dp/dt min). The transducer was then pulled back into the aorta and left in place to record arterial pressure (AP). Following the acute terminal experiments, the rats were killed by rapid i.v. injection of saturated potassium chloride. The hearts and lungs were removed, and the ratio of the infarct area to whole LV minus septum was measured.

General surgery

During the acute terminal experiments, rats were anaesthetized with urethane (800 mg kg−1 i.p.) and α‐chloralose (40 mg kg−1 i.p.). The depth of anaesthesia was assessed by leg pinch and the absence of a reflexive withdraw. The trachea was cannulated, and the rat was ventilated artificially with room air supplemented 100% oxygen. A Millar catheter (SPR 524; size, 3.5‐Fr; Millar Instruments) was advanced through the right common carotid artery into the left ventricle to determine basal cardiac functional parameters, as described above, and then pulled back into the aorta and left in place to record AP and MAP. HR was derived from the AP pulse with a PowerLab model 16S (ADInstruments, Colorado Springs, CO, USA) using Chart 7 software (ADInstruments, Colorado Springs, CO, USA). The right jugular vein was cannulated for i.v. injections. The rats were then paralysed with pancuronium bromide (1 mg kg−1 i.v.). To maintain adequate anaesthesia after administration of the paralytic agent, supplemental doses of α‐chloralose (20 mg kg−1 i.v.) were given every 1.5 h, or if a strong nociceptive stimulus (toe pinch) produced a pressor response of more than 10 mmHg.

Rats were placed in a stereotaxic frame (Stoelting, Chicago, IL, USA) and the dorsal surface of the medulla was surgically exposed by incising the atlantooccipital membrane and removing part of the occipital bone and dura. Body temperature was maintained at ∼37°C with an animal temperature controller (ATC1000; World Precision Instruments, Sarasota, FL, USA).

Recording of renal sympathetic nerve activity

Renal sympathetic nerve activity (RSNA) was recorded as described previously (Wang et al. 2014). The left kidney, renal artery and nerves were exposed through a left retroperitoneal flank incision. Sympathetic nerves running on or beside the renal artery were identified. The renal nerve was cut distally to avoid recording afferent activity. The renal sympathetic nerves were placed on a pair of platinum‐iridium recording electrodes and then were covered with a fast‐setting silicone (Kwik‐Sil; World Precision Instruments). Nerve activity was amplified (×10,000) and filtered (bandwidth: 100–3000 Hz) using a P55C preamplifier (Grass Instrument Company, Quincy, MA, USA). The nerve signal was monitored on an oscilloscope (model 121 N; Tektronix, Beaverton, OR, USA). The signal from the oscilloscope was displayed on a computer where it was rectified, integrated, sampled (1 kHz) and converted to a digital signal using the PowerLab data acquisition system. The background noise for sympathetic nerve activity was recorded 15–20 min after the rat was killed. Respective noise levels were subtracted from the nerve recording data before percentage changes from baseline were calculated. Integrated RSNA was normalized as 100% baseline during the control period (Wang et al. 2007, 2014).

Construction of arterial baroreflex curves

Baroreflex curves were generated by measuring the HR and RSNA responses to decreases and increases in AP by i.v. administration of nitroglycerin (25 μg) followed by phenylephrine (10 μg) as described previously (Wang et al. 2014). The RSNA response was normalized as a percentage of baseline. A sigmoid logistic function was fit to the data using a non‐linear regression program (SigmaPlot, version 8.0; SPSS Inc., Chicago, IL, USA). Four parameters were derived from the equation: %RSNA or HR = A/1 + exp[B(MAP − C)] + D, where A is the RSNA or HR range, B is the slope coefficient, C is the pressure at the mid‐point of the range (BP50) and D is the minimum RSNA or HR. The peak slope (or maximum gain; Gainmax) was determined by taking the first derivative of the baroreflex curve described by the equation (Kent et al. 1972).

Microinjections into the NTS

NTS microinjection was performed as described previously (Wang et al. 2007). Generally, microinjections were made from four‐ or five‐barrel micropipettes with total tip diameters of 20–30 μm and performed using a four‐channel pressure injector (PM2000B; World Precision Instruments). The injections were made over a 10 s period and a 50 nl injection volume was measured by observing the movement of the fluid meniscus along a reticule in a microscope. The dmNTS (co‐ordinates in mm with respect to calamus scriptorius: 0.5 rostral, 0.5–0.6 lateral and 0.4–0.5 deep) (Paxinos & Watson, 1998) was identified by injecting l‐glutamate (10 mm, 50 nl) and observing a depressor response of at least 15 mmHg. To examine the potential effects of microinjection of exogenous BDNF into dmNTS on MAP, HR and RSNA in normal and CHF states, unilateral microinjection of different doses of BDNF (10 and 100 pg, Santa Cruz Biotechnology, Santa Cruz, CA, USA) or artificial cerebrospinal fluid (aCSF, vehicle) into dmNTS was performed in sham and CHF rats. The time interval for each dose of BDNF or vehicle injection was at least 15 min. At the end of the experiments, 50 nl of 2% Pontamine sky blue was injected to mark the injection sites.

In separate groups of rats, with the aim of evaluating the role of endogenous BDNF‐TrkB signalling in modulating baroreflex function in normal and CHF states, the baroreflex function was examined before and 10 min after bilateral microinjection of the TrkB antagonist [N2‐2‐2‐oxoazepan‐3‐yl amino] carbonyl phenyl benzo (b)thiophene‐2‐carboxamide (ANA‐12) (Sigma‐Aldrich, St Louis, MO, USA) or DMSO (vehicle) into the dmNTS in sham and CHF rats. The effects of bilateral microinjection of different doses of ANA‐12 (62.5 and 125 μm) into the dmNTS on basal MAP, HR and RSNA were also observed. The time interval between bilateral ANA‐12 microinjections was within a 2 min period. At the end of the experiments, 50 nl of 2% Pontamine sky blue was injected to mark the injection sites.

Western blotting

Five sham‐operated and five CHF rats were anaesthetized and cardiac function measured within 30 min. Rats were killed with an overdose of pentobarbital sodium (150 mg kg−1, i.v.), brains were quickly extracted, frozen on dry ice and stored at −80°C. At the same time, the hearts and lungs were rapidly removed, placed on dry ice and the infarct size was quickly measured. Brainstems were sliced using a cryostat and the dmNTS was punched bilaterally from CHF and sham rats using a tissue biopsy needle of 1.0 mm inner diameter, 0.4–1.0 mm posterior to obex, 0.5–0.6 mm lateral to the midline and 0.4–0.5 mm from the dorsal surface of the brainstem. Tissue punches were homogenized in RIPA buffer (Sigma Aldrich) containing protease and phosphatase inhibitors (Sigma Aldrich) via sonication. Homogenates were centrifuged and the supernatant was collected. Total protein was estimated via a Pierce BSA assay (Thermo Scientific, Rockford, IL, USA) and boiled in equal volume of 4% SDS sample buffer. Protein was loaded in equal amounts of 15 μg of total protein into each well of 7% (for TrkB analysis) or 12% (for BDNF analysis) SDS‐PAGE gels. Gels were electrophoresed and transferred onto nitrocellulose membranes (Millipore, Billerica, MA, USA) at 50 V for 90 min. Membranes were blocked in Li‐Cor blocking solution (Li‐Cor, Lincoln, NE, USA) for 1 h and incubated overnight at 4ºC with primary antibodies to TrkB (dilution 1:2,000; ab33655; Abcam, Cambridge, MA, USA) or BDNF (dilution 1:2,000; ab46176; Abcam) with α‐Tubulin (dilution 1:5000; sc‐53646; Santa Cruz Biotechnology) as a loading control. Blots were washed and incubated with Li‐Cor secondary infrared‐labelled antibodies (IRDye 680LT 926‐68022 at a dilution of 1:5000 and IRDye 800CW 926‐32214 at a dilution of 1:2000) for 1 h at room temperature in phosphate‐buffered saline with 1% SDS. Blots were washed and visualized using Li‐Cor Odyssey system and bands were quantified using Li‐Cor Image Studio software.

Quantitative real‐time RT‐PCR

Brainstem were sliced and the dmNTS was punched bilaterally from five sham and five CHF rats. Total mRNA was isolated from each tissue punch with TRIzol Reagent (Invitrogen) and RNeasy Mini Kit (Qiagen Inc., Valencia, CA) in accordance with the manufacturer's instructions. The reverse transcription was performed using a Transcription 1st Strand cDNA Synthesis Kit (Life Technologies, Los Angeles, CA, USA). The Real‐Time RT‐PCR analyses for the detection of BDNF and TrkB mRNAs were performed using SYBR® Select Master Mix (Life Technologies) with specific BDNF and TrkB oligonucleotide primer pairs (synthesized at IDT, Coralville, IA, ISA) (BDNF: forward, 5′‐TCATACTTCGGTTGCATGAAGG‐3′, reverse, 5′‐AGACCTCTCGAACCTGCCC‐3′; TrkB: forward, 5′‐CTGGGGCTTATGCCTGCTG‐3′, reverse, 5′‐AGGCTCAGTACACCAAATCCTA‐3′; GAPDH: forward, 5′‐TGGATTTGGACGCATTGGTC‐3′, reverse, 5′‐TTTGCACTGGTACGTGTTGAT‐3′). The PCR program comprised: (1) 50°C for 2 min; (2) 95°C for 2 min; (3) 95°C for 15 s; (4) specific annealing temperature for 15 s; and (5) 72°C for 1 min. Steps 2–4 were repeated 40 times. Each sample was amplified in triplicate technical replicates and the mean was used for further analysis.

Statistical analysis

All data are expressed as the mean ± SEM. Differences between groups were determined by a two‐way ANOVA followed by Tukey's post hoc test. Changes in baroreflex function before and after NTS microinjection of ANA‐12 were determined by paired t test. P < 0.05 was considered statistically significant.

Results

Evaluation of body weight, organ weight, and baseline haemodynamics

The echocardiographic and haemodynamic measurements of sham‐operated and CHF rats are summarized in Table 1. Myocardial infarction‐induced cardiac dilatation in CHF rats was indicated by increased LV systolic and diastolic diameters and volumes as measured by echocardiography at week 6 post myocardial infarction. Furthermore, these 6‐week myocardial infarction rats exhibited a reduced ejection fraction and fractional shortening compared to sham rats, indicating decreased cardiac systolic function. Haemodynamic data collected at the time of the terminal experiments (∼14 weeks) further demonstrated that there was a significant increase in LVEDP in CHF rats compared to sham rats. Left ventricular dp/dt max and dp/dt min were also significantly lower in CHF rats. The heart weight and lung weight to‐body weight ratios were significantly higher in CHF rats than in sham‐operated rats, suggesting cardiac hypertrophy and substantial pulmonary congestion in the CHF state. Moreover, in rats with CHF, a gross examination revealed a dense scar in the anterior ventricular wall. The mean infarct area was 43.3 ± 1.1% of the LV area. No infarcts were identified in sham‐operated rats. Pleural fluid and ascites were also found in some of CHF rats, whereas there were none in the sham‐operated rats. Compared to sham rats, there was a slight but significant decrease in baseline MAP in CHF rats.

Table 1.

Haemodynamic and morphological data in sham and CHF rats

Sham (n = 24) CHF (n = 23)
Body weight (g) 426 ± 7 450 ± 7
Heart weight (mg) 1271 ± 26 2170 ± 67*
HW/BW (mg g–1) 2.99± 0.06 4.83 ± 0.13*
WLW/BW (mg g–1) 4.33± 0.08 8.97 ± 0.25*
MAP (mmHg) 105.5± 2.4 90.2± 1.9*
LVEDP (mmHg) 4.1± 0.4 21.0± 1.0*
HR (beats min–1) 368.9 ± 6.0 355.4 ± 6.0
LVEDD 6.91 ± 0.1 10.77± 0.1*
LVESD 3.99 ± 0.1 8.92 ± 0.1*
LVEDV 69 ± 8 427 ± 26*
LVESV 255 ± 11 649 ± 30*
EF (%) 72.9 ± 0.7 34.2 ± 1.3*
FS (%) 42.0 ± 0.6 17.2 ± 0.7*
dp/dt max 8765 ± 410 4634 ± 204*
dp/dt min −8145 ± 291 −3272 ± 123*
Infarct size (%) 0 43.3± 1.1*
Open in a new tab

Values are the mean ± SE. BW, body weight; HW, heart weight; WLW, wet lung weight; LVEDD, left ventricle end‐diastolic diameter; LVESD, left ventricle end‐systolic diameter; LVESV, left ventricle end‐systolic volume; LVEDV, left ventricle end‐diastolic volume; EF, ejection fraction; FS, fractional shortening. * P < 0.05 vs. CHF.

Functional and histological identification of the dmNTS

To define the role of BDNF‐TrkB signalling in modulating baroreflex function in sham and CHF rats, we focused on the dmNTS, a region that primarily receives and integrates sensory input from peripheral baroreceptors and is critical for baroreflex control of the sympathetic nervous system. In all microinjection experiments, the location of the pipette in the dmNTS was confirmed functionally by bradycardia, depressor and sympatho‐inhibitory responses to microinjection of glutamate (10 mm; 50 nl). Figure 1 illustrates the reduction in MAP, HR and RSNA in response to microinjection of glutamate in the dmNTS from one representative sham rat. Histological analysis of the injection sites stained with 2% Pontamine sky blue is also shown in Fig. 1.

Figure 1. Histological analysis and functional identification of microinjection sites in the dmNTS .

Figure 1

Open in a new tab

A, original digital image of the microinjection site filled with 2% Pontamine sky blue. AP, area postrema; Gr, gracile nucleus. B, representative recording from one animal demonstrating the arterial blood pressure (ABP), MAP, HR and RSNA responses to unilateral microinjection of glutamate (50 nl; 10 mm). The dmNTS region was identified by the presence of a depressor (>20 mmHg) and a sympatho‐inhibitory response to glutamate. C, distributions of the microinjection sites plotted on standard coronal sections according to Paxinos & Watson (1998). All microinjection sites in the present study were ∼0.5 mm rostral to obex (± 0.04 mm SD).

Haemodynamic and RSNA responses to unilateral microinjection of BDNF into the dmNTS in sham and CHF rats

After the stereotactic location of the dmNTS was confirmed by injection of glutamate with one barrel of a four‐barrel micropipette, we randomly injected 50 nL of either 10 or 100 pg of BDNF or aCSF (vehicle) using one of the other barrels. The time interval between injections was 15 min, which allowed the cardiovascular parameters to recover to baseline. As shown in Figs 2 and 3, unilateral microinjection of BDNF into the dmNTS produced dose‐dependent bradycardia, depressor and sympatho‐inhibitory responses similar to that of glutamate in sham rats, indicating a robust activation of the barosensitive neurons in dmNTS in the normal state. Injections of 50 nL of 10 or 100 pg BDNF into the dmNTS of rats with CHF also produced the bradycardia, depressor and sympatho‐inhibitory responses. However, these effects were significantly blunted compared to those of sham rats (Figs 2 and 3). Microinjection of aCSF (vehicle) into the dmNTS failed to change basal MAP, HR and RSNA in sham and CHF rats.

Figure 2. Representative images showing the effects of microinjection of BDNF (A, 100 pg, 50 nl) and ANA‐12 (B, 125 μM, 50 nl) into the dmNTS on AP, MAP, HR and RSNA in sham and CHF rats .

Figure 2

Open in a new tab

Arrows indicate the start and end of the injection.

Figure 3. Summary data showing the dose‐dependent effects of microinjection of BDNF and ANA‐12 into the dmNTS on AP, MAP, HR and RSNA in sham and CHF rats .

Figure 3

Open in a new tab

Microinjection of BDNF (10 and 100 pg, 50 nl, A–C) and ANA‐12 (62.5 and 125 μm, 50 nl, D–F). DMSO and aCSF serve as the control for ANA‐12 and BDNF, respectively. Data are expressed as the mean ± SE. * P < 0.05 vs. control. # P < 0.05 vs. sham. $ P < 0.05 vs. 10 pg of BDNF or 62.5 μm ANA‐12.

Haemodynamic and RSNA responses to bilateral microinjection of ANA‐12 into the dmNTS in sham and CHF rats

In separate groups of rats, we also investigated the effects of bilateral microinjection of the TrkB antagonist ANA‐12 (65.2 and 125 μm) into the dmNTS on baseline MAP, HR and RSNA in sham and CHF rats. By contrast to the effects observed after BDNF, microinjection of ANA‐12 into dmNTS resulted in tachycardia, an increase in MAP and sympatho‐excitatory responses in a dose‐dependent manner in sham rats (Figs 2 and 3), indicating that the endogenous BDNF‐TrkB signalling in the dmNTS plays a tonic role in exciting barosensitive neurons in the NTS, therefore suppressing blood pressure and sympathetic outflow in the normal state. The sympatho‐excitatory effects of bilateral microinjection of ANA‐12 into dmNTS on MAP, HR and RSNA were reduced in CHF rats compared to the sham rats. Microinjection of DMSO (vehicle) into the dmNTS failed to change basal MAP, HR and RSNA both in sham and CHF rats.

Effect of ANA‐12 in the dmNTS on baroreflex sensitivity in sham and CHF rats

To characterize the role of endogenous BDNF‐TrkB signalling in the dmNTS in modulating BRS in the normal and CHF states, we performed baroreflex experiments before and after bilateral microinjections of 125 μm ANA‐12 into the dmNTS in sham and CHF rats. Following TrkB inhibition by ANA‐12, the HR response to increases in MAP was blunted for both range and maximal gain (Figs 4, 5, 6 and Table 2) in sham rats. Similarly both the range and maximal gain of the RSNA response to increases in MAP were decreased following ANA‐12 injections (Figs 4, 5, 6 and Table 2). These data suggest that endogenous BDNF‐TrkB signalling in the dmNTS plays an important role in modulating baroreflex function in the normal state.

Figure 4. Representative images showing the effects of bilateral microinjection of ANA‐12 (125 μm, 50 nl) into the dmNTS on baroreflex‐mediated MAP, HR and RSNA responses to i.v. administration of nitroglycerin (25 μg) followed by phenylephrine (10 μg) in sham (A) and CHF (B) rats .

Figure 4

Open in a new tab

Arrows indicate artefacts of HR traces.

Figure 5. Mean data showing the effects of bilateral microinjection of ANA‐12 (125 μm, 50 nl) into the dmNTS on the baroreflex control of HR in sham and CHF rats .

Figure 5

Open in a new tab

Data are expressed as the mean ± SE (n = 8 per group). * P < 0.05 vs. before.

Figure 6. Mean data showing effects of bilateral microinjection of ANA‐12 (125 μm, 50 nl) into the dmNTS on the baroreflex control of RSNA in sham and CHF rats .

Figure 6

Open in a new tab

Data are expressed as the mean ± SE (n = 8 per group). * P < 0.05 vs. before.

Table 2.

Summary data for baroreflex function before and after microinjection of chemicals into the dmNTS in sham and CHF rats

n a (range) x 0 (BP50) y 0 (min) G max
MAP‐RSNA
Sham before DMSO 6 130.1 ± 5.0 93.2 ± 1.2 17.8 ± 2.3 3.73 ± 0.14
Sham after DMSO 6 126.1 ± 4.3 95.5 ± 1.0 17.3 ± 1.7 3.63 ± 0.10
CHF before DMSO 5 80.8 ± 3.5 98.3 ± 1.3 37.7 ± 3.5 1.88 ± 0.20
CHF after DMSO 5 77.6 ± 3.8 101.7 ± 0.8 37.0 ± 4.1 1.79 ± 0.21
Sham before ANA‐12 8 132.6 ± 8.4 91.7 ± 3.7 22.9 ± 3.7 3.64 ± 0.18
Sham after ANA‐12 8 67.5 ± 3.6* 111.7 ± 4.8* 57.3 ± 3.3* 0.91 ± 0.10*
CHF before ANA‐12 8 89.8 ± 5.3 96.5 ± 2.6 39.7 ± 4.5 2.05 ± 0.10
CHF after ANA‐12 8 65.9 ± 3.5* 102.0 ± 2.7 49.8 ± 3.1 1.15 ± 0.08*
MAP‐HR
Sham before DMSO 6 153.8 ± 4.9 98.7 ± 2.0 203.0 ± 8.0 4.08 ± 0.12
Sham after DMSO 6 144.9 ± 4.7 102.3 ± 2.9 204.6 ± 5.2 3.83 ± 0.08
CHF before DMSO 5 82.2 ± 4.3 101.8 ± 1.8 280.7 ± 7.8 1.77 ± 0.19
CHF after DMSO 5 77.3 ± 5.5 105.0 ± 2.3 282.1 ± 6.7 1.66 ± 0.20
Sham before ANA‐12 8 147.1 ± 4.3 98.1 ± 4.4 191.7 ± 5.4 3.90 ± 0.11
Sham after ANA‐12 8 80.1 ± 5.3* 103.0 ± 4.1* 270.0 ± 6.9* 1.88 ± 0.10*
CHF before ANA‐12 8 83.0 ± 3.4 103.0 ± 5.2 291.9 ± 9.4 1.90 ± 0.11
CHF after ANA‐12 8 74.0 ± 3.8 101.2 ± 5.1 305.8 ± 10.1 1.70 ± 0.12
Open in a new tab

Values are the mean ± SE. a is the RSNA or HR range, x 0 is the pressure at the mid‐point of the range (BP50), y 0 is minimum RSNA or HR and G max is the maximum gain of the baroreflex curve.

Compared to sham rats, CHF rats exhibited significantly lower HR and RSNA responses to increases in MAP (Figs 4, 5, 6 and Table 2). Bilateral injections of ANA‐12 into the dmNTS did not result in any further decrease in range or maximal gain of the HR response to increased MAP (Figs 4, 5, 6 and Table 2). Interestingly, although the RSNA response to increased MAP was already blunted in CHF rats, TrkB receptor inhibition by ANA‐12 in the dmNTS further reduced both range and maximal gain of the RSNA response to increased MAP in CHF rats (Figs 4, 5, 6 and Table 2).

Expression of BDNF and TrkB in the dmNTS in sham and CHF rats

To further explore potential mechanisms for the impaired response to ANA‐12 in the dmNTS of sham and CHF animals, we performed western blot experiments to compare protein expression of BDNF and TrkB receptors in the dmNTS of sham and CHF rats. The expression of TrkB protein in the dmNTS was significantly reduced in CHF rats compared to sham rats (Fig. 7 A). We failed to observe a significant difference in BDNF protein expression in the dmNTS between sham and CHF rats (Fig. 7 B). Quantitative RT‐PCR also demonstrated a reduction in TrkB by reduced mRNA levels in CHF rats vs. sham rats (Fig. 7 C). Conversely, BDNF mRNA was significantly increased in the dmNTS of CHF rats vs. sham rats (Fig. 7 D).

Figure 7. Representative images and summary data showing the protein and mRNA expressions of BDNF and TrKB in the dmNTS of sham and CHF rats .

Figure 7

Open in a new tab

Protein expression of TrkB (A) and BDNF (B) receptor in the dmNTS of sham and CHF rats. Data are expressed as the mean ± SE (n = 5 per group). Quantitative RT‐PCR of mRNA expression of TrkB (C) and BDNF (D) in the dmNTS of sham and CHF rats. * P < 0.05 vs. sham. **P < 0.01 vs. sham.

Discussion

The primary objectives of the present study were to investigate the role of BDNF‐TrkB signalling in the dmNTS with respect to regulating baroreflex control and evaluating impaired BDNF‐TrkB signalling as a potential mechanism for central desensitization of baroreflex control during CHF. Our results demonstrate a number of novel and important findings. First, our study provides evidence for tonic signalling of BDNF in the dmNTS in the normal state. Inhibition of endogenous BDNF signalling by selectively antagonizing the TrkB receptor with ANA‐12 resulted in a sympatho‐excitatory response in sham rats, suggesting a tonic sympatho‐inhibitory role for BDNF neurotransmission in the dmNTS. Most importantly, BDNF‐TrkB signalling in the dmNTS is integral for normal baroreflex function, as indictaed by the blunting of BRS following antagonizing TrkB by ANA‐12, which inhibited baroreflex gain and range. These observations taken together suggest a previously unknown role for BDNF neurotransmission in tonic sympatho‐inhibition and baroreflex control. Second, the observation that this signalling pathway is impaired in the dmNTS during CHF provides a novel mechanism for understanding the central alterations that contribute to baroreflex desensitization during CHF. Because both BDNF and ANA‐12 had little effect on haemodynamic and RSNA parameters, the tonic sympatho‐inhibition of BDNF may be withdrawn, thus contributing to the increased sympathetic tone associated with CHF. Consistent with this finding, TrkB antagonism had little effect on the reduced BRS in CHF animals, which is probably partly a result of decreased TrkB expression in the dmNTS during CHF. These results, taken together, implicate a reduction in BDNF‐TrkB signalling in the dmNTS during CHF that contributes to sympatho‐excitation and baroreflex desensitization.

The dmNTS has long been appreciated to be a primary site of baroreceptor afferent termination in the central nervous system (Seller & Illert, 1969; Jordan & Spyer, 1977) and early studies identified the role of dmNTS neurons in mediating the baroreflex (Crill & Reis, 1968; Palkovits et al. 1977). Seminal work provided an indication for the role of glutamate as the predominant neurotransmitter responsible for conducting the blood pressure information through the dmNTS (Talman et al. 1980). In addition, inhibitory potentials as a result of GABAergic signalling have been observed in rat dmNTS preparations (Glaum & Brooks, 1996) and GABAergic signalling contributes to baroreflex function (Moreira et al. 2011). Furthermore, angiotensin II has also been demonstrated to elicit cardiovascular baroreflex responses in the dmNTS (Barnes et al. 1993, 2003; Fow et al. 1994).

Along with the well‐known effects of neurotrophic factors on the developing nervous system, a large body of work has demonstrated the influence of neurotrophic factors on network patterning and long‐term potentiation of synapses. The neurotrophins consist of a small family with varied tissue distribution and signalling mechanisms (Lewin & Barde, 1996; Minichiello, 2009). BDNF is highly expressed in the NTS (Conner et al. 1997) and in baroreceptor afferents that project to the NTS (Martin et al. 2009). BDNF signals primarily through TrkB and elicits several long‐term neuromodulatory actions, as well as immediate, rapid signalling affecting neuronal activity. BDNF rapidly enhances vesicular neurotransmitter release from excitatory neurons (Shinoda et al. 2014) in the hippocampus. TrkB phosphorylation of NMDA receptors increases their open probability (Levine et al. 1998) and BDNF‐TrkB signalling results in rapid opening of TrpC channels (Li et al. 1999), Nav1.9 channels (Blum et al. 2002) and Ca2+ influx (Rose et al. 2003).

Based on our observations showing that BDNF induces responses similar to that of glutamate in the dmNTS, we conclude that BDNF induces an excitatory response in the dmNTS. This conclusion is further strengthened by the action of inhibiting TrkB, thereby preventing endogenous BDNF signalling, which produced a neural inhibitory effect. Interestingly, a previous study (Clark et al. 2011) demonstrated that microinjection of exogenous BDNF into the dmNTS evoked a sympatho‐excitatory pressor response, whereas the administration of a non‐specific TrkB antagonist K252a induced a depressor response in anaesthetized rats, indicating that BDNF/TrkB signalling is inhibitory to NTS baroreceptor neurons in the normal state, particularly via BDNF/TrkB‐mediated inhibition of AMPA currents (Balkowiec et al. 2000). The cause of the conflicting results reported by Clark et al. (2011) and our current findings is unclear. A probable potential difference between these two studies is the choice of anaesthetic. In the present study, we used urethane/α‐chloralose along with pancuronium bromide, whereas Clark et al. (2011) used inactin. The influence of anaesthetic on the observed cardiovascular parameters is unclear and may warrant further study. One other possible explanation is that, in the present study, we used a more specific TrkB receptor antagonist (ANA‐12) (Cazorla et al. 2011) instead of the non‐specific, tyrosine kinase inhibitor, K252a, which is often used as a TrkB antagonist, as in the previous study by Clark et al. (2011). However, this fails to explain the difference related to BDNF NTS microinjection experiments between these two studies (excitatory vs. inhibitory). Another potential explanation for the apparent contradiction is in the time points used for analysis. Clark et al. (2011) reported haemodynamic changes 10 min post microinjection into the dmNTS, whereas we report the immediate (within 1 min) and transient peak response to microinjection. Unfortunately, the study by Clark et al. (2011) does not provide continuous traces to allow for adequate comparison of the same time point post injection that we report. Importantly, our observation showing that BDNF is excitatory to NTS baroreceptor neurons has been supported by several other studies conducted in neuronal networks such as the hippocampus (Minichiello, 2009), amygdala (Scharfman, 1997) and cortical neurons (Kim et al. 2012). Autonomic centres in the brainstem, such as the rostroventrolateral medulla, have also been shown to display neuronal excitation following the injection of BDNF resulting in a pressor response (Wang & Zhou, 2002). Therefore, to our knowledge, the present study is the first to demonstrate that endogenous BDNF signalling in the dmNTS maintains tonic inhibition of sympathetic drive.

Furthermore, not only do our results suggest a tonic, background inhibition of sympathetic outflow by BDNF‐TrkB in the dmNTS, but also they suggest the necessity of BDNF‐TrkB signalling in mediating baroreflex function. Although previous studies have identified the presence of BDNF‐TrkB signalling in the NTS, to our knowledge, no study has investigated the implications of BDNF‐TrkB signalling in the NTS on baroreflex function both in normal and disease states. We found that inhibiting endogenous BDNF signalling in the dmNTS through bilateral injections of ANA‐12 blunted both the HR and RSNA responses to changes in MAP. This suggests that TrkB signalling is an integral and critical signalling component in the dmNTS for communicating baroreflex signals. A recent study investigating the actions of BDNF on synaptic vesicle release from cultured rat hippocampal neurons indicated that BDNF enhances transmitter release from excitatory synapses but not inhibitory synapses (Shinoda et al. 2014). Furthermore, BDNF has been shown to decrease inhibitory GABA synaptic transmission and resultant IPSPs through its actions on the neuronal potassium chloride cotransporter 2 in Purkinje fibres (Huang et al. 2012). Our results suggest that a similar, excitation‐predominant, response also occurs in the dmNTS of rats. Endogenous BDNF probably modulates the NTS barosensitive neurons via interaction with glutamatergic or GABAergic systems or a combination thereof. This hypothesis needs to be confirmed in future studies. Although a full discussion related to the breadth of literature investigating the effects of BDNF on glutamatergic and GABAergic systems is beyond the scope of the present study, there are reviews available that are of relevance to this topic (Gottmann et al. 2009; Minichiello, 2009).

Of particular interest in these observations is the potential that alterations in the BDNF‐TrkB signalling in the dmNTS may play a role in the dysautonomia present during CHF. The diminished MAP and RSNA responses to either microinjection of BDNF or ANA‐12 into the dmNTS of CHF rats suggest a pre‐existing suppression of this pathway in the CHF state. We also observed a decrease in baroreflex sensitivity in CHF rats, and manipulation of dmNTS signalling by antagonism of endogenous BDNF‐TrkB signalling evokes smaller changes in baroreflex sensitivity. The observation that there is a lack of further inhibition following ANA‐12 in CHF rats provides a rationale for the decreased central control of baroreflex function in CHF. In addition, this observation, coupled with the decreased expression of TrkB in the dmNTS of CHF rats, provides evidence suggesting that impaired BDNF‐TrkB signalling in the dmNTS is a mechanism by which central alterations in BRS occur in CHF. This decrease in TrkB expression is consistent with the lack of response to both exogenous BDNF and ANA‐12 because a decrease in receptor expression would limit the response of the system to both exogenous application of ligand and antagonism on the endogenous signalling pathway. Interestingly, we also noted a significant increase in BDNF mRNA expression associated with normal protein expression in the dmNTS of CHF rats. This observation may suggest a deceased post‐translational efficiency in BDNF protein synthesis in the dmNTS of CHF rats. In summary, we consider that a decrease in BDNF‐TrkB signalling is one factor contributing to the central mechanism by which baroreflex sensitivity is reduced in CHF. These findings of altered BDNF/TrkB signalling in the NTS during cardiovascular disease states are supported by observations showing that chronic intermittent hypoxia alters BDNF and TrkB expression in the NTS (Ciriello et al. 2015; Moreau & Ciriello, 2015) and also increased the expression of BDNF in nodose ganglia of spontaneously hypertensive and DOCA‐salt rats (Vermehren‐Schmaedick et al. 2013). Future work will be instrumental in determining the time‐specific progression of BDNF/TrkB dysfunction in the dmNTS during CHF, as well as the particular mechanisms responsible for driving these alterations.

Limitations

Although the present study demonstrates impaired BDNF‐TrkB signalling mechanisms in the dmNTS as a potential explanation for blunted baroreflex sensitivity during CHF, there are some limitations to consider. First, all of the experiments were conducted under anaesthesia. Although the baseline haemodynamic parameters and baroreflex sensitivity for our experiments were similar to those observed in the conscious state, we acknowledge that the impact of anaesthetics could potentially play a role in confounding the results. However, given the inherent difficulty in conducting a selective administration of reagents to the dmNTS in conscious animals, anaesthetized preparations allow for the most selective and robust investigation into the signalling processes of the dmNTS. Furthermore, the initiating cause of altered BDNF‐TrkB signalling is unclear from the present study. This issue should be addressed in future studies. Finally, although we failed to observe any change in total BDNF protein expression in the dmNTS during CHF, this does not definitively preclude the possibility that the amount of presynaptic BDNF release from the baroreceptor afferent terminals to dmNTS postsynaptic neurons may be altered as a result of peripheral baroreflex afferent dysfunction in the CHF state. This hypothesis can be further explored in the future using the microdialysis technique.

Perspective

Impairment of baroreflex function has been shown to be associated with progression of heart failure and a poor prognosis (Schwartz et al. 1988; Mortara et al. 1997; La Rovere et al. 1998). The progression of baroreflex desensitization in CHF is at least partly a result of central neuronal network dysregulation (Gnecchi Ruscone et al. 1987; Gao et al. 2005; Wang et al. 2008); however, the central mechanisms for baroreceptor desensitization remain largely unknown. Our data suggest a role for BDNF‐TrkB signalling in the dmNTS in maintaining baroreflex control, and also that BDNF‐TrkB signalling is impaired during CHF. The specific mechanisms responsible for BDNF‐TrkB impairment during CHF remain to be investigated and represent a potential area with respect to therapeutic intervention in sympatho‐excitatory states such as CHF.

Additional information

Competing interests

The authors declare that they have no competing interests.

Author contributions

All experiments were conducted in the laboratories of HW and IZ. BB, IZ and HW contributed to the conception and design of the study and the experiments. BB, CT and HW conducted the experiments and collected and analysed the data. BB drafted the initial copy of the manuscript. CT, IZ and HW provided feedback and revisions on the manuscript. All authors agree to be accountable for all aspects of the work, ensuring that questions related to the accuracy or integrity of any part are appropriately investigated and resolved. All persons designated as authors qualify for authorship, and all those who qualify for authorship are listed.

Funding

This work was supported by The American Heart Association (#12SDG12040062 to HJW) and, in part, by grants from the National Heart, Lung and Blood Institute (1R01HL121012‐01A1 to HJW; R01HL126796‐A1 to HJW and IHZ; R01 HL116608‐01A1 and PO1 HL62222 to IHZ; and 1F31HL126286‐01 to BB).

References

  1. Andresen MC & Yang M (1995). Dynamics of sensory afferent synaptic transmission in aortic baroreceptor regions on nucleus tractus solitarius. J Neurophysiol 74, 1518–1528. [DOI] [PubMed] [Google Scholar]
  2. Balkowiec A, Kunze DL & Katz DM (2000). Brain‐derived neurotrophic factor acutely inhibits AMPA‐mediated currents in developing sensory relay neurons. J Neurosci 20, 1904–1911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Barnes K, McQueeney A & Ferrario C (1993). Receptor subtype that mediates the neuronal effects of angiotensin II in the rat dorsal medulla. Brain Res Bull 31, 195–200. [DOI] [PubMed] [Google Scholar]
  4. Barnes KL, DeWeese DM & Andresen MC (2003). Angiotensin potentiates excitatory sensory synaptic transmission to medial solitary tract nucleus neurons. Am J Physiol Regul Integr Comp Physiol 284, R1340–R1353. [DOI] [PubMed] [Google Scholar]
  5. Blum R, Kafitz KW & Konnerth A (2002). Neurotrophin‐evoked depolarization requires the sodium channel Na(V)1.9. Nature 419, 687–693. [DOI] [PubMed] [Google Scholar]
  6. Cazorla M, Prémont J, Mann A, Girard N, Kellendonk C & Rognan D (2011). Identification of a low‐molecular weight TrkB antagonist with anxiolytic and antidepressant activity in mice. J Clin Invest 121, 1846–1857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ciriello J, Moreau JM, McCoy AM & Jones DL (2015). Leptin dependent changes in the expression of tropomyosin receptor kinase B protein in nucleus of the solitary tract to acute intermittent hypoxia. Neurosci Lett 602, 115–119. [DOI] [PubMed] [Google Scholar]
  8. Clark CG, Hasser EM, Kunze DL, Katz DM & Kline DD (2011). Endogenous brain‐derived neurotrophic factor in the nucleus tractus solitarius tonically regulates synaptic and autonomic function. J Neurosci 31, 12318–12329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Cohen S & Levi‐Montalcini R (1957). Purification and properties of a nerve growth‐promoting factor isolated from mouse sarcoma 180. Cancer Res 17, 15–20. [PubMed] [Google Scholar]
  10. Conner JM, Lauterborn JC, Yan Q, Gall CM & Varon S (1997). Distribution of brain‐derived neurotrophic factor (BDNF) protein and mRNA in the normal adult rat CNS: evidence for anterograde axonal transport. J Neurosci 17, 2295–2313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Crill WE & Reis DJ (1968). Distribution of carotid sinus and depressor nerves in cat brain stem. Am J Physiol 214, 269–276. [DOI] [PubMed] [Google Scholar]
  12. Dietrich WD, Lowry OH & Loewy AD (1982). The distribution of glutamate, GABA and aspartate in the nucleus tractus solitarius of the cat. Brain Res 237, 254–260. [DOI] [PubMed] [Google Scholar]
  13. Fow JE, Averill DB & Barnes KL (1994). Mechanisms of angiotensin‐induced hypotension and bradycardia in the medial solitary tract nucleus. Am J Physiol Heart Circ Physiol 267, H259–H266. [DOI] [PubMed] [Google Scholar]
  14. Gao L, Schultz HD, Patel KP, Zucker IH & Wang W (2005). Augmented input from cardiac sympathetic afferents inhibits baroreflex in rats with heart failure. Hypertension 45, 1173–1181. [DOI] [PubMed] [Google Scholar]
  15. Glaum SR & Brooks PA (1996). Tetanus‐induced sustained potentiation of monosynaptic inhibitory transmission in the rat medulla: evidence for a presynaptic locus. J Neurophysiol 76, 30–38. [DOI] [PubMed] [Google Scholar]
  16. Gnecchi Ruscone T, Lombardi F, Malfatto G & Malliani A (1987). Attenuation of baroreceptive mechanisms by cardiovascular sympathetic afferent fibers. Am J Physiol Heart Circ Physiol 253, H787–H791. [DOI] [PubMed] [Google Scholar]
  17. Goldstein RE, Beiser GD, Stampfer M & Epstein SE (1975). Impairment of autonomically mediated heart rate control in patients with cardiac dysfunction. Circ Res 36, 571–578. [DOI] [PubMed] [Google Scholar]
  18. Gottmann K, Mittmann T & Lessmann V (2009). BDNF signaling in the formation, maturation and plasticity of glutamatergic and GABAergic synapses. Exp Brain Res 199, 203–234. [DOI] [PubMed] [Google Scholar]
  19. Huang Y, Ko H, Cheung ZH, Yung KKL, Yao T, Wang J‐J, Morozov A, Ke Y, Ip NY & Yung W‐H (2012). Dual actions of brain‐derived neurotrophic factor on GABAergic transmission in cerebellar Purkinje neurons. Exp Neurol 233, 791–798. [DOI] [PubMed] [Google Scholar]
  20. Jordan D & Spyer KM (1977). Studies on the termination of sinus nerve afferents. Pflügers Arch 369, 65–73. [DOI] [PubMed] [Google Scholar]
  21. Kent BB, Drane JW, Blumenstein B & Manning JW (1972). A mathematical model to assess changes in the baroreceptor reflex. Cardiology 57, 295–310. [DOI] [PubMed] [Google Scholar]
  22. Kim JH, Roberts DS, Hu Y, Lau GC, Brooks‐Kayal AR, Farb DH & Russek SJ (2012). Brain‐derived neurotrophic factor uses CREB and Egr3 to regulate NMDA receptor levels in cortical neurons. J Neurochem 120, 210–219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Levi‐Montalcini R & Calissano P (1979). The nerve‐growth factor. Sci Am 240, 68–77. [DOI] [PubMed] [Google Scholar]
  24. Levi‐Montalcini R, Meyer H & Hamburger V (1954). In vitro experiments on the effects of mouse sarcomas 180 and 37 on the spinal and sympathetic ganglia of the chick embryo. Cancer Res 14, 49–57. [PubMed] [Google Scholar]
  25. Levine ES, a Crozier R, Black IB & Plummer MR (1998). Brain‐derived neurotrophic factor modulates hippocampal synaptic transmission by increasing N‐methyl‐D‐aspartic acid receptor activity. Proc Natl Acad Sci USA 95, 10235–10239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Lewin GR & Barde YA (1996). Physiology of the neurotrophins. Annu Rev Neurosci 19, 289–317. [DOI] [PubMed] [Google Scholar]
  27. Li HS, Xu XZS & Montell C (1999). Activation of a trpc3‐dependent cation current through the neurotrophin bdnf. Neuron 24, 261–273. [DOI] [PubMed] [Google Scholar]
  28. Martin JL, Jenkins VK, Hsieh H & Balkowiec A (2009). Brain‐derived neurotrophic factor in arterial baroreceptor pathways: implications for activity‐dependent plasticity at baroafferent synapses. J Neurochem 108, 450–464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Mattson MP & Wan R (2008). Neurotrophic factors in autonomic nervous system plasticity and dysfunction. Neuromolecular Med 10, 157–168. [DOI] [PubMed] [Google Scholar]
  30. Minichiello L (2009). TrkB signalling pathways in LTP and learning. Nat Rev Neurosci 10, 850–860. [DOI] [PubMed] [Google Scholar]
  31. Moreau JM & Ciriello J (2015). Chronic intermittent hypoxia induces changes in expression of synaptic proteins in the nucleus of the solitary tract. Brain Res 1622, 300–307. [DOI] [PubMed] [Google Scholar]
  32. Moreira TS, Takakura AC & Colombari E (2011). Important GABAergic mechanism within the NTS and the control of sympathetic baroreflex in SHR. Auton Neurosci 159, 62–70. [DOI] [PubMed] [Google Scholar]
  33. Mortara A, La Rovere MT, Pinna GD, Prpa A, Maestri R, Febo O, Pozzoli M, Opasich C & Tavazzi L (1997). Arterial baroreflex modulation of heart rate in chronic heart failure: clinical and hemodynamic correlates and prognostic implications. Circulation 96, 3450–3458. [DOI] [PubMed] [Google Scholar]
  34. Palkovits M, Dejong W, Zandberg P, Versteeg DH, Vandergugten J & Léránth C (1977). Central hypertension and nucleus tractus solitarii catecholamines after surgical lesions in the medulla oblongata of the rat. Brain Res 127, 307–312. [DOI] [PubMed] [Google Scholar]
  35. Park H, Popescu A & Poo M (2014). Article essential role of presynaptic NMDA receptors in activity‐dependent BDNF secretion and corticostriatal LTP. Neuron 84, 1009–1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Paxinos G & Watson C (1998). The Rat Brain in Stereotaxic Coordinates, 3rd edn. Academic Press, New York, NY. [Google Scholar]
  37. Rose CR, Blum R, Kafitz KW, Kovalchuk Y & Konnerth A (2004). From modulator to mediator: rapid effects of BDNF on ion channels. Bioessays 26, 1185–1194. [DOI] [PubMed] [Google Scholar]
  38. Rose CR, Blum R, Pichler B, Lepier A, Kafitz KW & Konnerth A (2003). Truncated TrkB‐T1 mediates neurotrophin‐evoked calcium signalling in glia cells. Nature 426, 74–78. [DOI] [PubMed] [Google Scholar]
  39. La Rovere MT, Bigger JT, Marcus FI, Mortara A & Schwartz PJ (1998). Baroreflex sensitivity and heart‐rate variability in prediction of total cardiac mortality after myocardial infarction. ATRAMI. Lancet 351, 478–484. [DOI] [PubMed] [Google Scholar]
  40. Scharfman HE (1997). Hyperexcitability in combined entorhinal/hippocampal slices of adult rat after exposure to brain‐derived neurotrophic factor. J Neurophysiol 78, 1082–1095. [DOI] [PubMed] [Google Scholar]
  41. Schwartz PJ, Vanoli E, Stramba‐Badiale M, De Ferrari GM, Billman GE & Foreman RD (1988). Autonomic mechanisms and sudden death. New insights from analysis of baroreceptor reflexes in conscious dogs with and without a myocardial infarction. Circulation 78, 969–979. [DOI] [PubMed] [Google Scholar]
  42. Seller H & Illert M (1969). The localization of the first synapse in the carotid sinus baroreceptor reflex pathway and its alteration of the afferent input. Pflügers Arch 306, 1–19. [DOI] [PubMed] [Google Scholar]
  43. Shinoda Y, Ahmed S, Ramachandran B, Bharat V, Brockelt D, Altas B & Dean C (2014). BDNF enhances spontaneous and activity‐dependent neurotransmitter release at excitatory terminals but not at inhibitory terminals in hippocampal neurons. Front Synaptic Neurosci 6, 27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Talman WT, Perrone MH & Reis DJ (1980). Evidence for L‐glutamate as the neurotransmitter of baroreceptor afferent nerve fibers. Science 209, 813–815. [DOI] [PubMed] [Google Scholar]
  45. Tang X & Dworkin BR (2007). Baroreflexes of the rat. IV. ADN‐evoked responses at the NTS. Am J Physiol Regul Integr Comp Physiol 293, R2243–R2253. [DOI] [PubMed] [Google Scholar]
  46. Tang X & Dworkin BR (2009). The dmNTS is not the source of increased blood pressure variability in baroreflex denervated rats. Auton Neurosci 148, 21–27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Vermehren‐Schmaedick A, Jenkins VK, Hsieh H, Brown AL, Page MP, Brooks VL & Balkowiec A (2013). Upregulation of brain‐derived neurotrophic factor expression in nodose ganglia and the lower brainstem of hypertensive rats. J Neurosci Res 91, 220–229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Wang H & Zhou X‐F (2002). Injection of brain‐derived neurotrophic factor in the rostral ventrolateral medulla increases arterial blood pressure in anaesthetized rats. Neuroscience 112, 967–975. [DOI] [PubMed] [Google Scholar]
  49. Wang H‐J, Li Y‐L, Gao L, Zucker IH & Wang W (2010. a). Alteration in skeletal muscle afferents in rats with chronic heart failure. J Physiol 588, 5033–5047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Wang H‐J, Pan Y‐X, Wang W‐Z, Gao L, Zimmerman MC, Zucker IH & Wang W (2010. b). Exercise training prevents the exaggerated exercise pressor reflex in rats with chronic heart failure. J Appl Physiol 108, 1365–1375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wang H‐J, Wang W, Cornish KG, Rozanski GJ & Zucker IH (2014). Cardiac sympathetic afferent denervation attenuates cardiac remodeling and improves cardiovascular dysfunction in rats with heart failure. Hypertension 64, 745–755. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wang W‐Z, Gao L, Pan Y‐X, Zucker IH & Wang W (2007). AT1 receptors in the nucleus tractus solitarii mediate the interaction between the baroreflex and the cardiac sympathetic afferent reflex in anesthetized rats. Am J Physiol Regul Integr Comp Physiol 292, R1137–R1145. [DOI] [PubMed] [Google Scholar]
  53. Wang W‐Z, Gao L, Wang H‐J, Zucker IH & Wang W (2008). Interaction between cardiac sympathetic afferent reflex and chemoreflex is mediated by the NTS AT1 receptors in heart failure. Am J Physiol Heart Circ Physiol 295, H1216–H1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Zucker IH, Patel KP & Schultz HD (2012). Neurohumoral stimulation. Heart Fail Clin 8, 87–99. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Zucker IH, Schultz HD, Patel KP, Wang W & Gao L (2009). Regulation of central angiotensin type 1 receptors and sympathetic outflow in heart failure. Am J Physiol Heart Circ Physiol 297, H1557–H1566. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES