Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Sep 1.
Published in final edited form as: Neurotoxicology. 2016 Aug 16;56:204–214. doi: 10.1016/j.neuro.2016.08.006

Microglia mediate diesel exhaust particle-induced cerebellar neuronal toxicity through neuroinflammatory mechanisms

Pamela J Roqué 1, Khoi Dao 1, Lucio G Costa 1,2
PMCID: PMC5048600  NIHMSID: NIHMS812680  PMID: 27543421

Abstract

In addition to the well-established effects of air pollution on the cardiovascular and respiratory systems, emerging evidence has implicated it in inducing negative effects on the central nervous system. Diesel exhaust particulate matter (DEP), a major component of air pollution, is a complex mixture of numerous toxicants. Limited studies have shown that DEP-induced dopaminergic neuron dysfunction is mediated by microglia, the resident immune cells of the brain. Here we show that mouse microglia similarly mediate primary cerebellar granule neuron (CGN) death in vitro. While DEP (0, 25, 50, 100 µg/2 cm2) had no effect on CGN viability after 24 h of treatment, in the presence of primary cortical microglia neuronal cell death increased by 2–3-fold after co-treatment with DEP, suggesting that microglia are important contributors to DEP-induced CGN neurotoxicity. DEP (50 µg/2 cm2) treatment of primary microglia for 24 h resulted in morphological changes indicative of microglia activation, suggesting that DEP may induce the release of cytotoxic factors. Microglia-conditioned medium after 24 h treatment with DEP, was also toxic to CGNs. DEP caused a significant increase in reactive oxygen species in microglia, however, antioxidants failed to protect neurons from DEP/microglia-induced toxicity. DEP increased mRNA levels of the pro-inflammatory cytokines IL-6 and IL1-β, and the release of IL-6. The antibiotic minocycline (50 µM) and the peroxisome proliferator-activated receptor-γ agonist pioglitazone (50 µM) attenuated DEP-induced CGN death in the co-culture system. Microglia and CGNs from male mice appeared to be somewhat more susceptible to DEP neurotoxicity than cells from female mice possibly because of lower paraoxonase-2 expression. Together, these results suggest that microglia-induced neuroinflammation may play a critical role in modulating the effect of DEP on neuronal viability.

Keywords: Diesel particles; Microglia, Neuroinflammation; Neuronal death; Oxidative stress

Introduction

Air pollution is a mixture comprised of several components, including ambient particulate matter (PM), gases, organic compounds, and metals. While the association between air pollution and morbidity and mortality caused by respiratory and cardiovascular diseases is well established (Brook and Rajagopalan, 2007; Gill et al., 2011), increasing evidence indicates that the central nervous system (CNS) is also a relevant target (Calderon-Garciduenas et al., 2002; Block and Calderon-Garciduenas, 2009; Genc et al., 2012). Epidemiological studies have shown that elevated air pollution is associated with decreased cognitive functions and several other behavioral effects (Chen and Schwartz, 2009; Calderon-Garciduenas et al., 2010; 2011; Ranft et al., 2009; Freire et al., 2010; Fonken et al., 2011; Power et al., 2011; Weuve et al., 2012; Guxens and Sunyer, 2012). Furthermore, a role of air pollution in the etiology of neurodegenerative and neurodevelopmental diseases has also been suggested (Calderon-Garciduenas et al., 2004; 2008; 2012; Levesque et al., 2011a; Raz et al., 2015; Harris et al., 2016).

Among air pollution components, PM is believed to be the most widespread threat, and has been heavily implicated in disease (Brook et al., 2010; Moller et al., 2010; Nelin et al., 2012). PM is broadly characterized by aerodynamic diameter (e.g. PM10 and PM2.5, equivalent to <10 µm and 2.5 µm in diameter, respectively; Brook et al., 2010). Ultrafine particulate matter (UFPM; <100 nm), which represents a large percentage of PM2.5, is of much concern, as these particles can more easily enter the circulation and distribute to various organs, including the brain (Oberdoerster et al., 2002; Genc et al., 2012). Of most relevance is also the fact that UFPM can access the brain through the nasal olfactory mucosa, reaching first the olfactory bulb (Oberdoester et al., 2004; Peters et al., 2006; Genc et al., 2012; Lucchini et al., 2012). Oxidative stress and inflammation are the two cardinal processes by which air pollution is believed to exert its peripheral toxicity (Brook et al., 2010; Lodovici and Bigagli, 2011; Anderson et al., 2012). The same seems to be true with regard to the CNS, as markers of oxidative stress and neuroinflammation are increased as a result of exposure to air pollution (Block and Calderon-Garcidienas, 2009; Genc et al., 2012). Some in vitro studies have shown that PM is cytotoxic, and that toxicity is size-dependent, with UFPM being able to better enter the cells and exert toxic effects (Block et al., 2004; Kreyling et al., 2004; Win-Shwe and Fujimaki, 2011; Gillespie et al., 2012).

Traffic-related air pollution is a major contributor to global air pollution, and diesel exhaust (DE) is its most important component (Ghio et al., 2012). DE contains more than 40 toxic air pollutants (e.g. organic carbon, metals, poly-aromatic hydrocarbons, aldehydes, etc.), and is a major constituent of ambient PM; indeed, DE exposure is often utilized as a measure of traffic-related air pollution. Exposure of mice to DE has been reported to alter locomotor activity and spatial learning and memory (Yokota et al., 2009; Hougaard et al., 2009; Suzuki et al., 2010; Win-Shwe et al., 2008; 2012). Neuroinflammation and oxidative stress also appear to be major mechanisms of DE neurotoxicity (Levesque et al., 2011a; 2011b; Gerlofs-Nijland et al., 2010; Costa et al. 2016; Cole et al. 2016).

A few in vitro studies have examined the effects of DE particles (DEP) on the CNS, particularly on dopaminergic neurons (Block et al., 2004; Gillespie et al., 2012; Levesque et al., 2011b). An earlier study by Block et al. (2004) is of great interest, as it showed that DEP could activate microglia, and that microglia-derived oxidant species caused the demise of dopaminergic neurons (Block et al., 2004). The aim of the present study was to confirm and extend these observations, utilizing a different primary cell system (mouse cerebellar granule cells) and particles prepared from DE utilized in our in vivo studies (Cole et al. 2016). We also sought to examine whether a sex-difference was present in the effects of DEP, thereby substantiating and expanding in vitro the observations of a gender difference in susceptibility to DE neurotoxicity observed in vivo (Cole et al. 2016). This hypothesis stems from our earlier observations that the intracellular antioxidant and anti-inflammatory enzyme paraoxonase-2 (PON2) is expressed at higher levels in females, thereby providing protection against oxidative stress and neuroinflammation (Giordano et al. 2011; 2013).

Materials and Methods

Materials

Neurobasal-A medium, Dulbecco’s Modified Eagle’s Medium, fetal bovine serum, B-27 supplement with and without antioxidant, fungizone, gentamicin, and goat anti-rabbit IgG Alexa 55 were purchased from Invitrogen (Thermo Fisher Scientific, Waltham, MA). Pioglitazone and minocycline hydrochloride were purchased from Cayman Chemical (Ann Arbor, MI). Melatonin, phenyl-α-tert-butyl nitrone (PBN) and 2',7'-dichlorodihydrofluorescein diacetate (DCF-DA) were purchased from Sigma-Aldrich (St. Louis, MO). Rabbit polyclonal antibodies to Iba1 and to paraoxonase-2 were purchased from Abcam (Cambridge, MA). Falcon 24-well cell culture inserts and PET membranes were purchased from Corning Life Sciences (Tewksbury, MA). For lactate dehydrogenase assays, Promega’s CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega Corporation, Madison, WI) was used. The Live/Dead Viability/Cytotoxicity Kit for mammalian cells was purchased from Molecular Probes (Thermo Fisher Scientific, Waltham, MA). All reagents for quantitative polymerase chain reaction (qPCR) were obtained from Biorad Laboratories (Hercules, CA). The Quantikine ELISA Mouse IL-6 Immunoassay kit was from R&D Systems, Inc. (Minneapolis, MN).

Neuronal cell culture

Primary cerebellar granule neurons (CGN) were isolated from 7-day-old (PND7) C57BL/6J mice as previously described (Giordano et al., 2006; Giordano and Costa, 2011), and plated at a density of 0.6 × 106 cells/2 cm2 in poly-d-lysine (0.2 mg/mL) pre-coated 24-well plates. Cells were incubated for 4 days in a humidified environment (37°C, 5% CO2) in antioxidant-containing medium (Neurobasal A medium supplemented with B-27 supplement (2%), glutamax (2 mM), potassium chloride (KCL, 25 mM), fungizone (1 µg/mL), and gentamycin (100 µg/mL). On the 4th day, medium was replaced with neuronal medium without antioxidant (B-27 supplement minus AO). After eight days in culture, half of the medium was replaced and CGNs were utilized for co-culture experiments two days after.

Culture of microglia

Primary mixed glia cultures were obtained from the cortices of PND3 mouse pups according to Witting and Möller (2011), with some modifications. Briefly, cortices were dissected and trypsinized (0.25% in PBS) for 30 minutes at 37°C, dissociated and centrifuged at 250 × g for 10 minutes at room temperature. Cortical cells were resuspended and seeded at a density of 3–6 cortices per flask, pre-coated with poly-d-lysine (40 µg/mL). Glial cultures were grown in DMEM supplemented with fetal bovine serum (FBS, 10%) and penicillin and streptomycin. Medium was changed one day after seeding to remove debris and one week later at confluence. Five to seven days after confluence, when microglia are apparent on the surface of the glial layer, they were isolated by dislodging using repetitive tapping of the flask, followed by removal and replacement of the medium. Medium containing microglia was centrifuged (250 × g, 7 minutes, at room temperature), resuspended, counted and sub-cultured for experimental use.

Co-culture and treatment of CGNs and microglia

CGN grown in culture for 10 days were combined with 3.0 µm mesh inserts, or inserts containing microglia sub-cultured for two days (6.0 × 104 cells/insert). Neurons and neurons plus microglia were treated for 24 h with increasing concentrations of DEP (0, 25, 50, 100 µg/2 cm2) for the initial lactate dehydrogenase (LDH) experiments. In subsequent experiments only 50 or 100 µg/2 cm2 concentrations were used. In additional experiments, cells were treated with DEP plus minocycline (50 µM), pioglitazone (50 µM), melatonin (200 µM) or phenyl-α-tert-butyl nitrone (PBN, 100 µM). Separate wells were treated with solvent control, when necessary. To control for the effect of inserts on the co-culture system and small particles of DEP moving through the insert to influence neurons directly, all wells containing neurons were co-cultured with inserts (with or without microglia), and each insert received the corresponding treatment.

Diesel exhaust particles source and preparation

Diesel exhaust particulate matter (DEP) was generated from a Cummins diesel engine under load, and was provided by the University of Washington’s Controlled Inhalation Diesel Exhaust Exposure Facility. DEP was collected from the outflow duct, as previously described (Gould et al., 2008; Weldy et al. 2011) and consisted of previously characterized PM2.5 particles (Gould et al., 2008; Fox et al., 2015). Stock solutions were prepared by suspending particles in PBS (2.5% DMSO) at a concentration of 10 mg/mL. Solutions were mixed by vortexing, and were sonicated for five minutes prior to dilution to treatment concentrations.

Lactate Dehydrogenase (LDH) Assay

Cell death was quantified using the LDH assay, or CytoTox 96 Non-Radioactive Cytotoxicity Assay following the instructions. Briefly, neurons or neurons plus microglia were treated with increasing concentrations of DEP (0–100 µg/2 cm2). After 24 h treatment, 1 mL medium was collected from treated, control, and blank wells corresponding to each treatment group, and centrifuged (12,000 × g at 4°C for 5 minutes) to remove DEP particles. Medium (75 µL) was added to a 96-well plate in triplicate, followed by 50 µL substrate medium, and incubated for 30 min. at room temperature in the dark. At incubation end, stop-buffer was added and the plate was read at 490 nm. Maximum LDH release or maximum cell death was obtained through the addition of lysis buffer (1:10) to triplicate wells 45 minutes prior to the end of the experiment. Lysis buffer was also added to the microglia-containing inserts. Percentage of cell death was calculated by subtracting background optical density (no cell medium control for each treatment group) from the optical density of the medium from cell treatment, and dividing by the maximum LDH release optical density. Separate maximum LDH values were obtained for neuron only and neurons plus microglia wells.

Live/Dead Assay

CGN cell death was measured using the fluorescent Live/Dead or Calcein-AM/Ethidium homodimer Assay kit (Molecular Probes) as per instructions. Briefly, CGNs seeded on poly-D-lysine (200 µg/mL) pre-coated glass coverslips, were grown and co-cultured with or without microglia as previously described. Co-cultures were treated with DEP (100 µg/2 cm2) for 24 hours. At treatment end, cells were incubated in the dark for 30 minutes with calcein-AM (2 µM) and ethidium homodimer-1 (4 µM) to label live and dead cells, respectively. Coverslips were mounted on slides, and imaged using epifluorescence microscopy (20 ×). Three images each from triplicate coverslips per treatment group were acquired and live (green) and dead cells (red) were manually counted using Image J software.

Microglia Morphology Immunocytochemistry

Microglia were plated on glass coverslips (1×105 cells/coverslip) and incubated overnight. Cells were treated with DEP (50 g/2 cm2) for 24 hours, then fixed with paraformaldehyde (4%), and immunolabeled overnight with rabbit polyclonal to Iba1 (1:75), fluorescently tagged with goat anti-rabbit Alexa 555 (1:200) for 1 hour at room temperature and counterstained with Hoechst staining (1 µg/mL) for 10 min. Cells were mounted and imaged using an epifluorescence microscope (40×), and morphological changes were qualitatively assessed.

Measurement of Reactive Oxygen Species (ROS)

Microglia were plated in 96-well plates (5.5–6.0 × 104 cells/well). After two days, cells were pretreated for 1 h with 20 µM 2',7'-dichlorodihydrofluorescein diacetate (DCFDA), a cell-permeant, reduced form of fluorescein, used as indicator of ROS. Cleavage of the DCFDA by intracellular esterases and oxidation, results in the conversion of non-fluorescent DCFDA to the highly fluorescent 2’7’-dichlorofluorescein (DCF). After pre-treatment, cells were washed and treated with DEP (0 or 50 µg/2 cm2) or co-treated with DEP and minocycline (50 µM). Relative fluorescence units (RFUs) were obtained at 1 and 2 hours post-treatment using a fluorescent spectrophotometer (485 excitation/530 emission). Readings were adjusted to treatment-matched, no-cell controls.

Measurement of cytokine mRNAs

Relative levels of interleukin-6 (IL-6), interleukin-1β (IL1-β), and tumor necrosis factor-α (TNF-α) mRNAs were determined using real-time, quantitative polymerase chain reaction (qPCR). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the house-keeping gene. Primary microglia were plated in 6-well plates at a density of 5.76 × 105 cells per well. After two days, cells were treated with DEP (50 µg/2 cm2) for 24 hours. The medium was collected, centrifuged, and snap frozen on dry ice and stored at −80°C for use in separate experiments with microglia-conditioned medium. RNA was isolated in Qiazol or Trizol, followed by column purification (Qiagen RNeasy Mini Kit). RNA concentration was quantified by Nanodrop and cDNA was synthesized using the Biorad iScript cDNA synthesis kit, as per instructions. RNA concentrations were held constant for each independent experiment. Biorad iTaq Universal SYBR Green was used for target amplification. Primer sequences were as follows: IL-6 Forward: GTGGAAATGAGAAAAGAGTTGTGC, IL-6 Reverse: CTGCAAGTGCATCATCGTTGT; IL1-β Forward: GCAGCTGGAGAGTGTGGAT, IL1-β Reverse: ACAAACCGTTTTTCCATCTTCTTCT; GAPDH Forward: CCTGGTATGACAATGAATACGGC, GAPDH Reverse: CTCCTTGGAGGCCATGTAGG; TNF-α Forward: GTCGTAGCAAACCACCAAGTG, TNF-α Reverse: CTTTGAGATCCATGCCGTTGG.

Measurement of IL-6 by enzyme-linked immunosorbent assay (ELISA)

Levels of IL-6 in the medium after microglia treatments were measured using an enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems, Inc.). Microglia were plated in 48 well plates at a density of 6.0 × 104 per well and treated with DEP (50 µg/2 cm2) for 24 hours. Medium was collected, centrifuged to remove DEP, and cellular protein levels were obtained using the bicinchoninic (BCA) assay. A dilution of 1:10 of medium was used to quantify IL-6 release, and values were normalized to the corresponding protein levels, as measured by the BCA assay.

Treatment of neurons with microglia-conditioned medium (MCM)

Primary microglia were plated in 6-wells plates at a density of 5.8 × 105 cells/well. After two days, cells were treated with DEP (50 mg/2 cm2) for 24 h. Medium was then collected and centrifuged (12,000 × g at 4°C for 5 min) to remove particles. The supernatant was snapped-frozen on dry ice and stored at −80°C until use. CGNs, grown for ten days as previously described, were washed with Hank’s buffered saline solution and the medium was replaced with unconditioned medium or unconditioned medium plus sterile-filtered MCM from control or DEP-treated microglia. After 24 h cell death was assessed using the LDH assay.

Measurement of paraoxonase-2 protein levels

Paraoxonase-2 (PON2) protein levels were determined by Western blot. Microglia from male and female mice were sub-cultured and plated in poly-d-lysine (40 µg/mL)-coated 6-well plates at a density of 5.76 × 105 cells per well. After two days in culture, cells were collected in lysis buffer, proteins were quantified using the bicinchoninic acid (BCA) assay, and equal amounts of protein were loaded into pre-cast gels (10% Tris-HCL gels). Protein was subjected to gel electrophoresis and transferred to polyvinylidene difluoride (PVDF) membranes and probed for PON2 (1:1000, at 4°C for two nights) and β-actin (1:1,000 for 1 hour at RT). These dilutions were optimized based on our prior work on PON2 protein expression in other cell types (Giordano et al. 2011; 2013). Membranes were incubated in secondary antibodies tagged with horseradish peroxidase (rabbit anti- HRP, 1:1000 for 1 hour, RT) and developed. PON2 levels were normalized to β-actin.

Statistical analysis of data

Results were analyzed for statistical significance by one-way ANOVA followed by the Dunnett’s or Bonferroni Multiple Comparison tests when comparing multiple treatments of the same group (e.g. Fig. 3A or 5), and with two-way ANOVA followed by the Bonferroni post-tests when determining the interactions between DEP treatment with or without microglia, or sex differences (e.g. Fig 1 or 6). Results are expressed as mean (± SE) of at least three separate experiments.

Figure 3.

Figure 3

Open in a new tab

A. Effect of DEP on ROS formation in microglia. ROS levels were measured after treatment with DEP (50 µg/2 cm2) for 1 or 2 h. Minocycline (50 µM) was added 60 min before DEP. Results represent the mean (± SE) of three separate experiments. Significantly different from control, ***p < 0.001. Significantly different from DEP, ##p<0.01, ###p<0.001. B. Effect of the antioxidant PBN on DEP- induced, microglia-mediated cytotoxicity. CGN, alone or co-cultured with microglia were treated with DEP in the presence of the antioxidant PBN (100 µM). Results show the mean (± SE) of three determinations. Significantly different from neurons only, #p<0.05.

Figure 5.

Figure 5

Open in a new tab

A. Effect of microglia-conditioned medium on neuronal cell death. CGNs were exposed for 24 h to medium obtained from primary microglia treated for 24 h with DEP (50 µg/2 cm2; MCM-DEP) or to medium from untreated microglia (MCM-cntrl), in the absence or presence of minocycline (50 µM). MCM-DEP caused a significant increase in neuronal cell death. Results represent the mean (± SE) of three separate experiments. Significantly different from control and MCM-cntrl, *p<0.05. B, C. Effect of blocking microglia activation on DEP-induced cell death. CGNs co-cultured with microglia were treated with DEP (50 µg/2 cm2) in the absence or presence of minocycline (MC; 50 µM) or pioglitazone (PIO; 50 µM). Cytotoxicity was determined by the LDH assay. Values represent mean (± SE) of 3–6 separate experiments. Significantly different from control, *p<0.05, ***p<0.001. Significantly different from DEP50, #p<0.05.

Figure 1.

Figure 1

Open in a new tab

Effect of microglia on DEP-induced neuronal cell death. A. CGNs alone, or co-cultured with microglia, were treated with increasing concentrations of DEP for 24 h. Cell death was determined by measuring LDH released to the medium compared to maximum LDH of each group, after normalization to no-cell treatment controls. Values represent mean (± SE) of five independent experiments. Significantly different from control neurons + microglia, **p < 0.01, *** p < 0.001. Significantly different from the respective neurons only, ###p<0.001. B. CGNs alone or co-cultured with microglia, were treated with DEP (100 µg/2 cm2) for 24 h. Neurons were incubated with calcein-AM to label live cells, and ethidium homodimer (EH) to label dead cells. Coverslips were mounted, and cells were imaged using an epifluorescence microscope. Percent neuronal death was determined by the ratio of the number of dead cells (red) to the number of total cells (live-green, and red). Values represent the mean (± SE) of 24–27 neuronal images from three independent experiments. Significantly different from control, **p < 0.01, and from neurons alone, ##p<0.01. C. Representative images of control and DEP treated neurons after co-culture with microglia.

Figure 6.

Figure 6

Open in a new tab

Effect of sex on DEP-induced, microglia-mediated neurotoxicity. A, B. Paraoxonase-2 (PON2) protein expression in male and female microglia. Cell lysate of microglia was collected and probed for levels of PON2 by Western blot. Results show the mean optical density of PON2 normalized to β-actin by sex (mean ± SE, n = 4; A), and a representative blot of PON2 and β-actin levels (B). There is a significant difference between sexes, *p<0.05. C. Co-cultures of CGNs and microglia of either sex were treated with DEP (50 µg/2 cm2) for 24 h and cytotoxicity was measured using the LDH assay. Results are the mean (± SE) of three separate experiments. Significantly different from same sex control, *p < 0.05.

Results

Neuronal toxicity of DEP is mediated by microglia

To determine the role of microglia in mediating DEP-induced neuronal death, CGNs were treated with increasing concentrations of DEP (0, 25, 50, 100 µg/2 cm2) for 24 hours in the absence or presence of primary cortical microglia (Fig. 1). Microglia were sub-cultured at a density of 10% of the neuronal population, to reflect the average in vivo microglia-to-neuron ratio (Block et al. 2007), and plated into porous inserts two days prior to co-culture. All neuronal wells were co-cultured with either empty inserts or inserts containing microglia, and both inserts and neuronal wells were co-treated with the corresponding treatment. At treatment end, cytotoxicity was measured using the lactate dehydrogenase (LDH) assay. Results show that DEP had no effect on the viability of CGNs when neurons were cultured alone; in contrast, in the presence of microglia, cell death (LDH release) increased by more than two-fold (Fig. 1A). Since the assay cannot discriminate between the LDH released from dying neurons from that of microglia, calcein and ethidium homodimer labeling of neurons was used, to assess neuron-specific cell death. As observed in the LDH assay, the highest concentration of DEP (100 µg/2 cm2 for 24 h) had no effect on neuronal death in the absence of microglia, but induced a greater than 2-fold increase in neuronal death when neurons shared their environment with DEP treated microglia (Fig. 1B, 1C). Together, these findings suggest that the presence of microglia is essential to promote neuronal cell death induced by DEP.

Activation of microglia by DEP

When activated, microglia change from a ramified state to an amoeboid shape, moving through a series of changes from increased proliferation, the retraction of extensions, increased mobility, and finally, the ability to phagocytose debris (Stence et al., 2001). To determine the effect of DEP on microglia, cells were immunocytochemically labeled for Iba1 and imaged using fluorescence microscopy. Compared to control microglia, those treated with DEP were qualitatively larger, more spherical, lacked extensions and contained DEP particles, suggestive of a phagocytotic state (Fig. 2). These results suggest that DEP induces morphological changes indicative of microglia activation.

Figure 2.

Figure 2

Open in a new tab

DEP induces morphological changes in microglia. Primary microglia were plated at a density of 1.2 × 105 on glass coverslips, and treated for 24 h with DEP (50 µg/2 cm2). Cells were the fixed, immunocytochemically labeled for Iba1, and imaged using fluorescent microscopy. Shown are representative greyscale images of control (left) and treated (right) microglia. Cell morphology is indicated by dotted white lines, and arrow indicate the presence of DEP that has been phagocytosed by microglia.

Potential role of ROS in DEP-induced, microglia-mediated neuronal death

Reactive microglia release both cytotoxic and protective factors, which may influence neuronal viability (Block et al. 2007; Ransohof and Perry, 2009; Luo and Chen, 2012). Microglia-released factors that contribute to oxidative stress have been shown to play a role in microglia-induced neurotoxicity (Block et al. 2004). To test whether DEP treatment of microglia results in the generation of reactive oxidative species we measured ROS upon DEP (50 µg/2 cm2) treatment. DEP induced a greater than 2-fold increase in ROS production after 1 h of treatment, which was sustained at 2 h (Fig. 3A). Inhibition of microglia activation with the antibiotic minocycline (50 µM) attenuated the increase in ROS (Fig. 3A). However, the antioxidant phenyl-α-tert-butyl nitrone (PBN; 100 µM) was unable to rescue neurons after co-culture treatment with DEP (Fig. 3B). Similar results were found with melatonin (200 µM; not shown). These findings suggest activation of microglia by DEP causes an increase in ROS, but that these do not appear play a significant role in microglia-mediated DEP neurotoxicity in the present experimental system.

Potential role of pro-inflammatory cytokines in DEP-induced, microglia-mediated neuronal death

Activated microglia have also been shown to release pro-inflammatory cytokines which may influence neuronal death. To test whether the pro-inflammatory cytokines IL-6, IL-1β, and TNF-α were differentially expressed in microglia treated with DEP, we measured relative levels of mRNA by qPCR. Lipopolysaccharide (LPS; 500 ng/mL) was used as a positive control in these experiments. As shown in Fig. 4, DEP (50 µg/2 cm2 for 24 h) induced 18- and 4-fold increases in IL-6 and IL-1β mRNA, respectively, with only a two-fold increase of TNF-α. LPS also caused large increases in IL-6 (100-fold) and IL-1β (45 fold), but not of TNF-α (Fig. 4). Using ELISA, we also measured levels of IL-6 protein released to the medium; after 24 h, DEP (50 µg/2 cm2) induced an approximate 12-fold increase in IL-6 release from microglia relative to untreated cells (Fig. 4G). These findings indicate that DEP induces the expression and release of pro-inflammatory cytokines from microglia, which may be involved in microglia-mediated DEP-induced neuronal death.

Figure 4.

Figure 4

Open in a new tab

Effect of DEP on levels of cytokine mRNA. Expression of IL-6, IL-1β and TNF-a mRNA in primary microglia was determined by qPCR analysis. Microglia were treated for 24 hours with 50 µg/2 cm2 DEP (A, C, E) or 500 ng/mL LPS (B, D, F). Relative levels of IL-6 (A, B), IL1-β (C, D), and TNF-α (E, F) mRNA were compared after normalization to GAPDH mRNA. Results are the mean (± SE) of 4–8 separate determinations. Significantly different from control, *p<0.05, **p<0.01; ***p<0.001. G. Effect of DEP on IL-6 release from microglia. Levels of IL-6 released from microglia after DEP treatment (50 µg/2 cm2, 24 h), were measured by ELISA. Values represent the means (± SE) of six separate experiments. Significantly different from control, ***p<0.001.

To test whether these microglia-released factors are sufficient to induce neuronal death on their own, microglia conditioned medium (MCM) was collected from control and DEP (50 µg/2 cm2)-treated microglia. The addition of MCM from DEP-treated microglia to CGNs, grown as in previous experiments, induced a greater than 3-fold increase in cell death, as measured by the LDH assay (Fig. 5A). Additionally, when neurons were co-treated with MCM in the presence of minocycline (50 µM), no protective effect was observed (Fig. 5A). However, when neurons were co-treated with DEP and minocycline in the presence of microglia, DEP-induced neuronal cell death was significantly decreased (Fig. 5B). These findings suggest that factors released from microglia after DEP treatment are capable of inducing neuronal death, and that the effect of minocycline is due to an action on microglia rather than on the neurons (Henry et al. 2008). To further confirm that microglia activation is necessary for the increase in cell death observed in the co-culture system, CGNs and microglia were co-cultured in the presence of an alternative pharmacological inhibitor of microglia activation, the PPAR-γ agonist pioglitazone (Ji et al. 2010; Drew et al. 2015). As shown in Fig. 5C, pioglitazone (50 µM) significantly attenuated DEP-induced neurotoxicity.

Sex differences in the effects of DEP

Previous work in our laboratory has shown that the intracellular antioxidant/anti-inflammatory enzyme paraoxonase-2 (PON2) is differentially expressed in the brains of male and female mice, with levels higher in females than males, and a 1.9-fold difference in CGNs (Giordano et al. 2011; 2013). Here we found that a sex difference in PON2 levels was also present in microglia, with female mice displaying 1.5-fold higher levels compared to males (Fig. 6A, 6B). To investigate whether microglia-mediated neurotoxicity after DEP treatment differs between males and females, we carried out parallel experiments with co-cultures of primary microglia and CGNs from mice of either sex. A comparison of male and female control co-cultures showed that there is no sex difference in baseline cell viability. A 24 h treatment with DEP (50 µg/2 cm2) increased cell death in cultures of both sexes (Fig. 6C). Cell death in male co-cultures increased 2.1-fold relative to controls, while in female co-cultures there was a 1.6-fold increase in cell death, though the difference between sexes was not statistically significant. Nevertheless, higher PON2 levels in cells from female mice may afford some protection from DEP neurotoxicity.

Discussion

The main finding of the present study is that microglia play an important role in mediating the neurotoxicity of DEP in vitro, confirming and expanding previous results (Block et al. 2004). When using mixed neuron-glia cultures, the microglial content is usually low because of the differential development of most neuronal populations (prenatally in mice) and microglia (early postnatally) (Ransohoff and Cardona, 2010). For this reason, a neuron-microglia co-culture system has been suggested as the best choice for investigating the role of microglia in neurotoxicity and for exploring neuroprotective strategies (Gresa-Arribas et al., 2012). In the present study we utilized a co-culture system consisting of mouse CGNs, a well-established neuronal model to investigate in vitro neurotoxicity, and microglia isolated from mouse cerebral cortex. Microglia are known to differ between brain regions, particularly with regard to their distribution, with cerebral cortex expressing higher microglial content than cerebellum, and the substantia nigra displaying the greatest number relative to neurons (Lawson et al., 1990; Block et al. 2007; Yang et al., 2013). The choice of cortical microglia was mainly dictated by convenience, specifically a higher yield compared to cerebellar microglia, as we did not aim to search for particular region-specific effects of DEP. Nevertheless, we chose to set the neuron:microglia ratio as 9:1, which is the approximate average ratio in brain (Block et al. 2007). In addition, we also carried out an experiment, similar to the one shown in Fig. 1A, comparing cortical and cerebellar microglia, and found no differences between the two systems in response to DEP (not shown).

Our findings indicate that DEP was not toxic to neurons when cultured alone, and that neuronal cell death was significant only in the presence of microglia (Fig. 1). We confirmed that the observed mortality was due to death of neurons rather than microglia, and that the latter is more resistant to DEP cytotoxicity (unpublished observation; Block et al. 2004). DEP was capable of activating microglia, as previously observed in vitro (Block et al. 2004; Levesque et al. 2011b; 2013) and in vivo (Levesque et al. 2011a; Durga et al. 2015; Cole et al. 2016). Activated microglia are known to release both cytotoxic and protective factors, which may influence neuronal viability (Block et al. 2007; Ransohoff and Perry, 2009; Luo and Chen, 2012). In particular, activated microglia contribute to oxidative stress and to neuroinflammation, which are believed to play primary roles in neurotoxicity and in neurodevelopmental and neurodegenerative disorders (Koutsilieri et al., 2002; Kraft and Harry, 2011; Graeber et al., 2011). We found that DEP caused an increase of microglial ROS, and that this was prevented by an inhibitor of microglia activation, minocycline (Fig. 3A). However, two antoxidants (PBN and melatonin) failed to protect neurons from DEP-induced, microglia-mediated, toxicity (Fig. 3B). In contrast, others have previously shown that PM increases oxidative stress in the brain (Mohan Kumar et al. 2008; Sagrillo Fagundes et al. 2015), and that oxidative stress plays a primary role in DEP neurotoxicity (Block et al. 2004). Thus, the possibility that some forms of oxidative stress may be involved in the microglia-mediated effects of DEP warrants further investigations.

DEP also caused a significant increase of IL-6 and IL-1β mRNA, but surprisingly, had a relatively small effect on TNF-α (Fig. 4). The positive control LPS had similar effects. Block et al. (2004) also found a lack of effect of DEP on TNF-α, and Levesque et al. (2011a; 2013) did not find any effect on TNF-α nor on IL-1β. In contrast, Gresa-Arribas et al. (2012) reported a significant increase of TNF-α (and of IL-6) release upon LPS treatment of microglia. It is likely that different experimental conditions and timing of testing may be at the basis of the observed differences (Manzano-Leon et al., 2016). For example, Nakamura et al. (1999) showed that over a 24 h period, a LPS-induce increase in TNF-α was first observed at 1 h, peaked at 6 h, and then declined, while IL-6 and IL-1β increased later in the 24 h time-frame, with Il-6 reaching its peak at 24 h.

In addition to increasing cytokine mRNA expression, DEP also caused increased release to the medium of IL-6 (Fig. 4G), which we chose to measure as it showed the largest mRNA increase upon DEP exposure (Fig. 4A). Interestingly, conditioned medium from DEP-treated microglia was highly toxic to CGNs, indicating that pro-inflammatory cytokines and other factors secreted by activated microglia play a central role in DEP neurotoxicity. Of interest is also that minocycline was ineffective in protecting neurons against this conditioned medium, but protected neurons against the toxicity of DEP in a co-culture system, indicating that the target for minocycline neuroprotection is microglia. Indeed, another reported inhibitor of microglia activation, the PPAR-γ agonist pioglitazone (Ji et al. 2010; Drew et al. 2015), also protected neurons from DEP-induced, microglia-mediated neurotoxicity.

Among the factors that can affect neurotoxic outcomes, gender is considered of much relevance (Weiss, 2011). We have recently shown that the enzyme paraoxonase-2 (PON2) displays a significantly different level of expression between genders in mice and in other species including human (Giordano et al., 2011; 2013; Costa et al. 2014), with females exhibiting a 2- to 4-fold higher expression. PON2 exerts potent antioxidant and anti-inflammatory effects (see Costa et al. 2014 for a review), and lack of PON2 (as in PON2−/− mice) or lower expression levels (as in males vs. females), increases susceptibility to neurotoxicity (Giordano et al. 2011; 2013). In a recent study (Costa et al. 2016; Cole et al. 2016) we found that in vivo exposure to DE caused oxidative stress (increased lipid peroxidation) and neuroinflammation (increased levels of IL-6, IL-1β and of other pro-inflammatory cytokines) which were more pronounced in male mice. In order to determine whether a similar sex-dependent difference may be observed in the present in vitro co-culture system, we compared male and female microglia and CGNs. In both cell types PON2 levels were <2-fold higher in females (Fig. 6A, B; Giordano et al. 2011; 2013). We found that DEP toxicity was more pronounced in co-cultures of male mice, as expected, though results did not reach statistical significance, suggesting that other factors may be also involved in the sex-dependent, differential effects seen in vivo (Costa et al. 2016; Cole et al. 2016).

In summary, we implemented an in vitro co-culture system to investigate the neurotoxicity of DEP, and found that DEP-induced microglia activation is an early event in DEP neurotoxicity. Increase synthesis and release of pro-inflammatory cytokines by microglia appear to be key mediators in modulating DEP neurotoxicity, which is somewhat more pronounced in males. This co-culture system will allow identification of additional mediators, testing of cells from transgenic animals, and identification of potential novel neuroprotective agents. Modification of the experimental conditions, for example using neurons and microglia from other brain regions, or using DEP restricted to UFPM, would allow extension of current findings and further our understanding of the effects of DE on the nervous system

HIGHLIGHTS.

  • Diesel particles are toxic to CGNs only in the presence of microglia

  • Microglia release pro-inflammatory cytokines in response to diesel particles

  • Blocking microglia activation protects neurons from diesel particle toxicity

Acknowledgments

Research by the authors is supported by grants from NIEHS (R01ES22949, P30ES07033, P42ES04696) and by funds by the Department of Environmental and Occupational Health Sciences, University of Washington. We thank Ms. Paige Bommarito and Belle Ngo for assistance in some of the experiments.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Block ML, Wu X, Pei Z, Li G, Wang T, Qin L, Wilson B, Yang J, Hong JS, Veronesi B. Nanometer size diesel exhaust particles are selectively toxic to dopaminergic neurons: the role of microglia, phagocytosis, and NADPH oxidase. FASEB J. 2004;18:1618–1620. doi: 10.1096/fj.04-1945fje. [DOI] [PubMed] [Google Scholar]
  2. Block ML, Zecca L, Hong JS. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nature Rev. Neurosci. 2007;8:57–69. doi: 10.1038/nrn2038. [DOI] [PubMed] [Google Scholar]
  3. Block ML, Calderon-Garciduenas L. Air pollution: mechanisms of neuroinflammation and CNS disease. Trends Neurosci. 2009;32:506–516. doi: 10.1016/j.tins.2009.05.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brook RD, Rajagopalan S. Air pollution and cardiovascular events. New Engl. J. Med. 2007;356:2104–2105. doi: 10.1056/NEJMc070556. [DOI] [PubMed] [Google Scholar]
  5. Brook RD, Rajagopalan S, Pope A, Brook JR, Bhatnagar A, Diez-Roux AV, Holguin F, Hong Y, Luepker RV, Mittleman MA, Peters A, Siscovick D, Smith SC, Whitesel L, Kaufman JD on behalf of the American Heart Association Council on Epidemiology and Prevention, Council on the Kidney in Cardiovascular disease, and Council on Nutrition, Physical Activity and Metabolism. Particulate matter air pollution and cardiovascular disease. An update to the scientific statement from the American Heart Association. Circulation. 2010;121:2331–2378. doi: 10.1161/CIR.0b013e3181dbece1. [DOI] [PubMed] [Google Scholar]
  6. Calderon-Garciduenas L, Azzarelli B, Acuna H, Garcia R, Gambling TM, Osnaya N, Monroy S, Del Rosario Tizapantzi M, Carson JL, Villareal-Calderon A, Rewcastle B. Air pollution and brain damage. Toxicol. Pathol. 2002;30:373–389. doi: 10.1080/01926230252929954. [DOI] [PubMed] [Google Scholar]
  7. Calderon-Garciduenas L, Reed W, Maronpot RR, Henriquez-Roldan C, Delgado-Chavez, Calderon-Garciduenas A, Dragustinovis I, Franco-Lira M, Aragon-Flores M, Solt AC, Altenburg M, Torres-Jardon R, Swenberg JA. Brain inflammation and Alzheimer’s-like pathology in individuals exposed to severe air pollution. Toxicol. Pathol. 2004;32:650–658. doi: 10.1080/01926230490520232. [DOI] [PubMed] [Google Scholar]
  8. Calderon-Garciduenas L, Solt AC, Henriquez-Roldan C, Torres-Jardon R, Nuse B, Herritt L, Villareal-Calderon R, Osnaya N, Stone I, Garcia R, Brooks DM, et al. Long-term air pollution exposure is associated with neuroinflammation, an altered innate immune response, disruption of the blood-brain barrier, ultrafine particulate deposition, and accumulation of amyloid β-42 and α-synuclein in children and young adults. Toxicol. Pathol. 2008;36:289–310. doi: 10.1177/0192623307313011. [DOI] [PubMed] [Google Scholar]
  9. Calderon-Garciduenas L, Franco-Lira M, Henriquez-Roldan C, Osnaya N, Gomzalez-Maciel A, Reynoso-Robles R, Villareal-Calderon R, Herritt L, Brooks D, Keefe S, Palacios-Moreno J, Villareal-Calderon R, Torres-Jardon R, Medina-Cortina H, Delgado-Chavez R, Aiello-Mora M, Maronpot RR, Doty RL. Urban air pollution: influences on olfactory function and pathology in exposed children and young adults. Exp. Toxicol. Pathol. 2010;62:91–102. doi: 10.1016/j.etp.2009.02.117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Calderon-Garciduenas L, Engle R, Mora-Tiscareno A, Styner M, Gomez-Garza G, Zhu H, Jewells V, Torres-Jardon R, Romero L, Monroy-Acosta ME, Bryant C, Gonzalez-Gonzalez LO, Median-Cortina H, D’Angiulli A. Exposure to severe urban air pollution influences cognitive outcomes, brain volume and systemic inflammation in clinically healthy children. Brain Cognition. 2011;77:345–355. doi: 10.1016/j.bandc.2011.09.006. [DOI] [PubMed] [Google Scholar]
  11. Calderon-Garciduenas L, Kavanaugh M, Block M, D’Angiulli A, Delgado-Chavez R, Torres-Jardon R, Gonzales-Maciel A, et al. Neuroinflammation, hyperphosphorylated tau, diffuse amyloid plaques, and down-regulation of the cellular prion protein in air pollution exposed children and young adults. J. Alzheim. Dis. 2012;28:93–107. doi: 10.3233/JAD-2011-110722. [DOI] [PubMed] [Google Scholar]
  12. Chen JC, Schwartz J. Neurobehavioral effects of ambient air pollution on cognitive performance in US adults. Neurotoxicology. 2009;30:231–239. doi: 10.1016/j.neuro.2008.12.011. [DOI] [PubMed] [Google Scholar]
  13. Cole TB, Coburn J, Dao K, Roqué PJ, Chang YC, Kalia V, Dziedzic J, Guilarte TR, Costa LG. Sex and genetic differences in the effects of acute diesel exhaust exposure on inflammation and oxidative stress in mouse brain. 2016 doi: 10.1016/j.tox.2016.11.010. (submitted) [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Costa LG, de Laat R, Dao K, Pellacani C, Cole TB, Furlong CE. Paraoxonase-2 (PON2) in brain and its potential role in neuroprotection. Neurotoxicology. 2014;43:3–9. doi: 10.1016/j.neuro.2013.08.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Costa LG, Cole TB, Coburn J, Chang YC, Dao K, Roque P. Neurotoxicity of traffic-related air pollution. Neurotoxicology. 2016 doi: 10.1016/j.neuro.2015.11.008. (in press) [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Drew PD, Johnson JW, Douglas JC, Phelan KD, Kane CJ. Pioglitazone blocks ethanol induction of microglial activation and immune responses in the hippocampus, cerebellum, and cerebral cortex in a mouse model of fetal alcohol spectrum disorders. Alcoh. Clin. Exp. Res. 2015;39:445–454. doi: 10.1111/acer.12639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Durga M, Devanesa T, Rajasekar A. Dtermination of LC50 and sub-chronic neurotoxicity of diesel exhsut nanoparticles. Environ. Pharmacol. Toxicol. 2015;40:615–625. doi: 10.1016/j.etap.2015.06.024. [DOI] [PubMed] [Google Scholar]
  18. Fonken LK, Xu X, Weil ZM, Chen G, Sun Q, Rajagopalan S, Nelson RJ. Air pollution impairs cognition, provokes depressive-like behaviors and alters hippocampal cytokine expression and morphology. Mol. Psych. 2011;16:987–995. doi: 10.1038/mp.2011.76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Fox JR, Cox DP, Drury BE, Gould TR, Kavanagh TJ, Paulsen MH, Sheppard L, Simson CD, Stewart JA, Larson TV, Kaufman JD. Chemical characterization and in vitro toxicity of diesel exhaust particulate matter generated under varying conditions. Air Qual. Atmos. Health. 2015;8:507–519. doi: 10.1007/s11869-014-0301-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Freire C, Ramos R, Puertas R, Lopez-Espinosa MJ, Julvez J, Aguilera I, Cruz F, Fernandez MF, Sunyer J, Olea N. Association of traffic-related air pollution with cognitive development in children. J. Epidemiol. Comm. Health. 2010;64:223–228. doi: 10.1136/jech.2008.084574. [DOI] [PubMed] [Google Scholar]
  21. Genc S, Zadeoglulari Z, Fuss SH, Genc K. The adverse effects of air pollution on the nervous system. J. Toxicol. 2012:23. doi: 10.1155/2012/782462. ID 782462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gerlofs-Nijland ME, van Berlo D, Cassee FR, Schins RPF, Wang K, Campbell A. Effect of prolonged exposure to diesel engine exhaust on proinflammatory markers in different regions of the rat brain. Particle Fibre Toxicol. 2010;7:12. doi: 10.1186/1743-8977-7-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ghio AJ, Smith CB, Madden MC. Diesel exhaust particles and airway inflammation. Curr. Op. Pulm. Med. 2012;18:144–150. doi: 10.1097/MCP.0b013e32834f0e2a. [DOI] [PubMed] [Google Scholar]
  24. Gill EA, Curl CL, Adar SD, Allen RW, Auchincloss AH, O’Neill MS, Park SK, Ven Hee VC, Diez Roux AV, Kaufman JD. Air pollution and cardiovascular disease in the Multi-Ethnic Study of Atherosclerosis. Progr. Cardiovasc. Res. 2011;53:353–360. doi: 10.1016/j.pcad.2011.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Gillespie P, Tajuba J, Lippman M, Chen LC, Veronesi B. Particulate matter neurotoxicity in culture is size-dependent. Neurotoxicology. 2013;36:112–117. doi: 10.1016/j.neuro.2011.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Giordano G, Costa LG. Primary neurons in culture and neuronal cell lines for in vitro neurotoxicological studies. In: Costa LG, Giordano G, Guizzetti M, editors. In Vitro Neurotoxicology: Methods and Protocols. New Yourk: Springer; 2011. pp. 13–27. [DOI] [PubMed] [Google Scholar]
  27. Giordano G, White CC, McConnachie LA, Fernandez C, Kavanagh TJ, Costa LG. Neurotoxicity of domoic acid in cerebellar granule neurons in a genetic model of glutathione deficiency. Mol. Pharmacol. 2006;70:2116–2126. doi: 10.1124/mol.106.027748. [DOI] [PubMed] [Google Scholar]
  28. Giordano G, Cole TB, Furlong CE, Costa LG. Paraoxonase 2 (PON2) in the mouse central nervous system: a neuroprotective role? Toxicol. Appl. Pharmacol. 2011;256:369–378. doi: 10.1016/j.taap.2011.02.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Giordano G, Tait L, Furlong CE, Cole TB, Kavanagh TJ, Costa LG. Gender differences in brain susceptibility to oxidative stress are mediated by levels of paraoxonase-2 (PON2) expression. Free Rad. Biol. Med. 2013;58:98–108. doi: 10.1016/j.freeradbiomed.2013.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Gould T, Larson T, Stewart J, Kaufman JD, Slater D, McEwen N. A controlled inhalation diesel exhaust exposure facility with dynamic feedback control of PM concentration. Inhal. Toxicol. 2008;20:49–52. doi: 10.1080/08958370701758478. [DOI] [PubMed] [Google Scholar]
  31. Graeber MB, Li W, Rodriguez ML. Role of microglia in CNS inflammation. FEBS Lett. 2011;585:3798–3805. doi: 10.1016/j.febslet.2011.08.033. [DOI] [PubMed] [Google Scholar]
  32. Gresa-Arribas N, Vieitez C, Dentesano G, Serratosa J, Sura J, Sola C. Modelling neuroinflammation in vitro: a tool to test the potential neuroprotective effect of anti-inflammatory agents. Plos ONE. 2012;7:e45277. doi: 10.1371/journal.pone.0045227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Guxens M, Sunyer J. A review of epidemiological studies on neuropsychological effects of air pollution. Swiss Med. Wkly. 2012;141:w13322. doi: 10.57187/smw.2012.13322. [DOI] [PubMed] [Google Scholar]
  34. Harris MH, Gold DR, Rifas-Shiman SL, Melly SJ, Zanobetti A, Coull BA, Schwartz JD, Gryparis A, Kloog I, Koutrakis P, Bellinger DC, Belfort MB, Webster TF, White RF, Sagiv SK, Oken E. Prenatal and childhood traffic-related air pollution exposure and childhood executive function and behavior. Neurotoxicol. Teratol. 2016 doi: 10.1016/j.ntt.2016.06.008. (in press) [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Henry CJ, Huang Y, Wynne A, Hanke M, Himler J, Bailey MT, Sheridan JF, Godbout JP. Minocycline attenuates lipopolysaccharide (LPS)-induced neuroinflammation, sickness behavior and anhedonia. J. Neuroinflam. 2008;5:15. doi: 10.1186/1742-2094-5-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Hougaard KS, Saber AT, Jensen KA, Vogel U, Wallin H. Diesel exhaust particles: effects on neurofunction in female mice. Basic Clin. Pharmacol. Toxicol. 2009;105:139–143. doi: 10.1111/j.1742-7843.2009.00407.x. [DOI] [PubMed] [Google Scholar]
  37. Ji H, Wang H, Zhang F, Li X, Xiang L, Aiguo S. PPAR-γ agonist pioglitazone inhibits microglia inflammation by blocking p38 mitogen-activated protein kinase signaling pathways. Inflam. Res. 2010;59:921–929. doi: 10.1007/s00011-010-0203-7. [DOI] [PubMed] [Google Scholar]
  38. Koutsilieri E, Scheller C, Tribl F, Riederer P. Degeneration of neuronal cells due to oxidative stress-microglial contribution. Parkinson. Rel. Dis. 2002;8:401–406. doi: 10.1016/s1353-8020(02)00021-4. [DOI] [PubMed] [Google Scholar]
  39. Kraft AD, Harry GJ. Features of microglia and neuroinflammation relevant to environmental exposure and neurotoxicity. Int. J. Environ. Res. Public Health. 2011;8:2980–3018. doi: 10.3390/ijerph8072980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Kreyling WG, Semmler M, Moller W. Dosimetry and toxicology of ultrafine particles. J. Aerosol Med. 2004;17:140–152. doi: 10.1089/0894268041457147. [DOI] [PubMed] [Google Scholar]
  41. Lawson LJ, Perry VH, Dri P, Gordon S. Heterogeneity in the distribution and morphology pof microglia in normal adult mouse brain. Neuroscience. 1990;39:151–170. doi: 10.1016/0306-4522(90)90229-w. [DOI] [PubMed] [Google Scholar]
  42. Levesque S, Surace MJ, McDonald J, Block ML. Air pollution and the brain: subchronic diesel exhaust exposure causes neuroinflammation and elevates early markers of neurodegenerative disease. J. Neuroinflammat. 2011a;8:105. doi: 10.1186/1742-2094-8-105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Levesque S, Taetzsch T, Lull ME, Kodavanti U, Stadler K, Wagner A, Johnson JA, Duke L, Kodavanti P, Surace MJ, Block ML. Diesel exhaust activates and primes microglia: air pollution, neuroinflammation, and regulation of dopaminergic neurotoxicity. Environ. Health Perspect. 2011b;119:1149–1155. doi: 10.1289/ehp.1002986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Levesque S, Taetzsch T, Lull ME, Johnson JA, McGraw C, Block ML. The role of MAC1 in diesel exhaust particle-induced microglial activation and loss of dopaminergic neuron function. J. Neurochem. 2013;125:756–765. doi: 10.1111/jnc.12231. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Lodovici M, Bigagli E. Oxidative stress and air pollution exposure. J. Toxicol. 2011;487074 doi: 10.1155/2011/487074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Lucchini RG, Dorman DC, Elder A, Veronesi B. Neurological impacts from inhalation of pollutants and the nose-brain connection. Neurotoxicology. 2012;33:838–841. doi: 10.1016/j.neuro.2011.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Luo XG, Chen SD. The changing phenotype of microglia from homeostasis to disease. Transl. Neurodegener. 2012;1:9. doi: 10.1186/2047-9158-1-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Manzano-Leon N, Serrano-Lomelin J, Sanchez BN, Quintana-Belmares R, Vega E, Vazquez-Lopez I, Rojas-Bracho L, Lopez-Villegas MT, Vadillo-Ortega F, De Vizcaya-Ruiz A, Perez IR, O’Neil MS, Osornio-Vargas AR. TNF-alpha and Il-6 responses to particulate matter in vitro: variation according to PM size, season, and polycyclic aromatic hydrocarbon and soil content. Environ. Health Perspect. 2016;124:406–412. doi: 10.1289/ehp.1409287. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. MohanKumar SMJ, Campbell A, Block ML, Veronesi B. Particulate matter, oxidative stress and neurotoxicity. Neurotoxicology. 2008;29:479–488. doi: 10.1016/j.neuro.2007.12.004. [DOI] [PubMed] [Google Scholar]
  50. Moller P, Jacobsen NR, Folkmann JK, Danielsen PH, Mikkelsen L, Hemmingsen JG, Vesterdal LK, Forchhammer L, Wallin H, Loft S. Role of oxidative damage in toxicity of particulates. Free Rad. Res. 2010;44:1–46. doi: 10.3109/10715760903300691. [DOI] [PubMed] [Google Scholar]
  51. Nakamura Y, Si QS, Kataoka K. Lipoplysaccharide-induced microglial activation in culture: temporal profiles of morphological change and release of cytokines and nitric oxide. Neurosci. Res. 1999;35:95–100. doi: 10.1016/s0168-0102(99)00071-1. [DOI] [PubMed] [Google Scholar]
  52. Nelin TD, Joseph AM, Gorr MW, Wold LE. Direct and indirect effects of particulate matter on the cardiovascular system. Toxicol. Lett. 2012;208:293–299. doi: 10.1016/j.toxlet.2011.11.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Oberdoerster G, Sharp Z, Atudorei V, Elder A, Gelein R, Lunts A, Kreyling W, Cox C. Extra-pulmonary translocation of ultrafine carbon particles following whole body inhalation exposure of rats. J. Toxicol. Environ. Health A. 2002;65:1531–1543. doi: 10.1080/00984100290071658. [DOI] [PubMed] [Google Scholar]
  54. Oberdoerster G, Sharp Z, Atudorei V, Elder A, Gelein R, Kreyling W, Cox C. Translocation of inhaled ultrafine particles to the brain. Inhal. Toxicol. 2004;16:437–445. doi: 10.1080/08958370490439597. [DOI] [PubMed] [Google Scholar]
  55. Peters A, Veronesi B, Calderon-Garciduenas L, Gehr P, Chen LC, Geiser M, Reed W, Rothen-Rutishauser B, Schurch S, Schulz H. Translocation and potential neurological effects of fine and ultrafine particles a critical update. Particle Fibre Toxicol. 2006;3:13. doi: 10.1186/1743-8977-3-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Power MC, Weisskopf MG, Alexeef SE, Coull BA, Spiro A, Schwartz J. Traffic-related air pollution and cognitive function in a cohort of older men. Environ. Health Perspect. 2011;119:682–687. doi: 10.1289/ehp.1002767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Ranft U, Schikowski T, Sugiri D, Krutmann J, Kramer U. Long-term exposure to traffic-related particulate matter impairs cognitive function in the elderly. Environ. Res. 2009;109:1004–1011. doi: 10.1016/j.envres.2009.08.003. [DOI] [PubMed] [Google Scholar]
  58. Ransohoff RM, Perry VH. Microglia physiology; unique stimuli, specialized responses. Annu. Rev. Immunol. 2009;27:119–145. doi: 10.1146/annurev.immunol.021908.132528. [DOI] [PubMed] [Google Scholar]
  59. Ransohoff RM, Cardona AE. The myeloid cells of the central nervous system parenchima. Nature. 2010;468:253–262. doi: 10.1038/nature09615. [DOI] [PubMed] [Google Scholar]
  60. Raz R, Roberts AL, Lyall K, Hart JE, Just AC, Laden F, Weisskopf MG. Autism spectrum disorder and particulate matter air pollution before, during and after pregnancy: a nested case-control analysis within the nurses’ health study II cohort. Environ. Health Perspect. 2015;123:264–270. doi: 10.1289/ehp.1408133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Sagrillo Facundes L, de Silveira Fleck, Zanchi AC, Nascimento Saldiva PH, Ramos Rhoden C. Direct contact with particulate matter increases oxidative stress in different brain structures. Inhal. Toxicol. 2015;27:462–467. doi: 10.3109/08958378.2015.1060278. [DOI] [PubMed] [Google Scholar]
  62. Stence N, Waite M, Dailey ME. Dynamics of microglial activation; a confocal time-lapse analysis of hippocampal slices. Glia. 2001;33:256–266. [PubMed] [Google Scholar]
  63. Suzuki T, Oshio S, Iwata M, Saburi H, Odagiri T, Udagawa T, Sugawara I, Umezawa M, Takeda K. In utero exposure to a low concentration of diesel exhaust affects spontaneous locomotor activity and monoaminergic system in male mice. Particle Fibre Toxicol. 2010;7:7. doi: 10.1186/1743-8977-7-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Weiss B. Same sex, no sex, unaware sex in neurotoxicology. Neurotoxicology. 2011;32:509–517. doi: 10.1016/j.neuro.2010.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Weldy CS, White CC, Wilkerson HW, Larson TV, Stewart JA, Gill SE, Parks WC, Kavanagh TJ. Heterozygosity in the glutathione synthesis gene Gclm increases sensitivity to diesel exhaust particulate induced lung inflammation in mice. Inhal. Toxicol. 2011;23:724–735. doi: 10.3109/08958378.2011.608095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Weuve J, Puett RC, Schwartz J, Yanosky JD, Laden F, Grodstein F. Exposure to particulate air pollution and cognitive decline in older women. Arch. Int. Med. 2012;172:219–227. doi: 10.1001/archinternmed.2011.683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Win-Shwe TT, Yamamoto S, Fujitani Y, Hirano S, Fujimaki H. Spatial learning and memory function-related gene expression in the hippocampus of mouse exposed to nanoparticles-rich diesel exhaust. Neurotoxicology. 2008;29:940–947. doi: 10.1016/j.neuro.2008.09.007. [DOI] [PubMed] [Google Scholar]
  68. Win-Shwe TT, Fujimaki H. Nanoparticles and neurotoxicity. Int. J. Mol. Sci. 2011;12:6267–6280. doi: 10.3390/ijms12096267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Win-Shwe TT, Fujimaki H, Fujitani Y, Hirano S. Novel object recognition ability in female mice following exposure to nanoparticle-rich diesel exhaust. Toxicol. Appl. Pharmacol. 2012;262:355–362. doi: 10.1016/j.taap.2012.05.015. [DOI] [PubMed] [Google Scholar]
  70. Witting A, Möller T. Microglia cell culture: a primer for the novice. Methods Mol. Biol. 2011;758:49–66. doi: 10.1007/978-1-61779-170-3_4. [DOI] [PubMed] [Google Scholar]
  71. Yang TT, Lin C, Hsu CT, Wang TF, Ke FY, kuo YM. Differential distribution and activation of microglia in the brain of male C57BL/6J mice. Brain Struct. Funct. 2013;218:1051–1060. doi: 10.1007/s00429-012-0446-x. [DOI] [PubMed] [Google Scholar]
  72. Yokota S, Mizuo K, Moriya N, Oshio S, Sugawara I, Takeda K. Effect of prenatal exposure to diesel exhaust on dopaminergic system in mice. Neurosci. Lett. 2009;449:38–41. doi: 10.1016/j.neulet.2008.09.085. [DOI] [PubMed] [Google Scholar]

RESOURCES