Abstract
Background
The association of gene variants with atrial fibrillation (AF) type and the recurrence of AF after catheter ablation in Taiwan is still unclear. In this study, we aimed to investigate the relationships between gene variants, AF type, and the recurrence of AF.
Methods
In our investigation, we examined 383 consecutive patients with AF (61.9 ± 14.0 years; 63% men); of these 383 patients, 189 underwent catheter ablation for drug-refractory AF. Thereafter, the single nucleotide polymorphisms rs2200733, and rs7193343 were genotyped using real-time polymerase chain reaction.
Results
The rs7193343 variant was independently associated with non-paroxysmal AF (non-PAF). In the PAF group, the rs7193343 variant was independently associated with AF recurrence after catheter ablation. However, the rs2200733 variant was not associated with AF recurrence in this group. The combination of the rs7193343 and rs2200733 risk alleles was associated with a better predictive power in the PAF patients. In contrast, in the non-PAF group, the SNPs were not associated with recurrence. The rs7193343 and rs2200733 variants were not associated with different atrial voltage and activation times.
Conclusions
The rs7193343 variants were associated with AF recurrence after catheter ablation in PAF patients but not in non-PAF patients. The rs7193343 CC variant was independently associated with non-PAF.
Keywords: Atrial fibrillation, Catheter ablation, Single nucleotide polymorphism
INTRODUCTION
Genome-wide association studies (GWAS) have identified distinct loci associated with atrial fibrillation (AF) on chromosomes 4q25 (rs2200733), and 16q22 (rs 7193343).1,2 Several possible mechanisms for this association have been proposed, but the actual pathways have not been elucidated.3-5 Husser et al. observed an association between the risk variants on chromosome 4q25 and AF recurrence after catheter ablation.6 However, the predictive ability of the loci on chromosomes 16q22 (rs7193343) remains unclear. Lubitz et al. reported that a combination of risk alleles increased the risk of AF in a stepwise manner. However, none of the previous studies has determined whether the prediction of AF recurrence after catheter ablation could be improved by considering the findings for multiple loci.7
AF, which ranges from paroxysmal AF (PAF) to persistent/chronic arrhythmia (non-PAF), has a heterogeneous pathogenesis at both the clinical and molecular levels.8 If patients at high risk of non-PAF can be identified by their genotype, then they may benefit from early treatment before cardiac remodeling is irreversible.9 However, it is not clear whether patients with different types of AF, such as PAF and non-PAF, have different genetic profiles.
The aims of the present study were as follows: (1) to determine whether AF recurrence after catheter ablation could be predicted by rs7193343 and rs2200733 single nucleotide polymorphisms (SNPs); and (2) to determine whether the prediction of AF recurrence could be improved by considering the findings for multiple loci.
METHODS
Participants
In this study, 383 consecutive patients with AF (mean age 61.9 ± 14.0 years; 63% men) were enrolled from the Taipei Veterans General Hospital, Taipei, Taiwan and Kaohsiung Medical University Hospital, Kaohsiung, Taiwan. Of the 383 patients, 189 patients had drug-refractory AF and underwent catheter ablation. The left atrial diameter (LAD) and the left ventricular ejection fraction of the patients were determined before catheter ablation was performed. Administration of all class I or III antiarrhythmic medications was discontinued at least 5 half-lives before the procedure. Ethical approval was obtained from the Institutional Review Board of the Veterans General Hospital, Taipei, Taiwan. All subjects gave written informed consent.
Catheter ablation for treating AF
The electrophysiological study, contact electroanatomical mapping, signal analysis, identification of pulmonary vein and non-pulmonary vein ectopic beats, catheter ablation of AF, and follow-up visits for AF recurrences were performed as described in our previous studies.10,11 These techniques have been described in detail in the Supplemental Materials.
According to the 2006 American College of Cardiology/American Heart Association (ACC/AHA) guidelines, recurrent AF is defined as paroxysmal if the arrhythmia terminates spontaneously.8 When sustained beyond 7 days, AF is defined as persistent. The category of persistent AF also includes cases of long-standing AF (i.e., greater than 1 year), usually leading to permanent AF, in which cardioversion has failed or has not been attempted. In the present study, both persistent and permanent AF were classified as non-PAF.
Contact electroanatomical mapping and signal analysis
The techniques used have been described in our previous work.12,13 In brief, after written informed consent was obtained, each patient underwent an electrophysiological examination and catheter ablation in the fasting, non-sedated state. A sequential contact voltage map was constructed in all patients during sinus rhythm before radiofrequency ablation. The bipolar electrograms were filtered between 32 and 300 Hz and recorded digitally. The absolute peak was selected as the detection setting to determine the point of activation in the waveform. The electrodes of a coronary sinus catheter were used to provide the timing reference signal during the mapping procedure. A 4-mm tipped ablation catheter (EP Technologies Boston Scientific Inc., Marlborough, MA, USA) was selected as the roving catheter. The signal from the roving catheter was used to build a sequential map. The average bipolar mapping sites either in the right or in the left atria were more than 200 points for each patient. After completion of the sequential map, the bipolar mapping points were collected and analyzed by use of off-line software. The mean peak-to-peak voltage through both the atria was calculated, and voltage mapping was performed only during sinus rhythm.
The Fast-Fourier transform method has been described previously. A 6.82-second data segment was exported to an external software mechanism. Frequency analysis (sampling rate = 1200 Hz, resolution = 0.14 Hz, with a Hanning window function) was performed from all recording sites. For fractionation mapping, the NavX system (Therapy Cool Path, St Jude Medical, Inc., Minnetonka, MN, USA) mapping parameters were set to the CFE-mean (fractionation interval, FI), an interval-analysis algorithm that measures the average index of the fractionation at each site and produces a color CFE distribution map. Sites of continuous CFE indicated the most fractionated sites, with a local mean FI < 50 ms and a recording duration > 5 s; sites with a shorter mean FI indicated high temporal stability of the fractionated electrograms. Non-CFEs were defined as FI > 120 ms. The consistency of fractionated electrograms over time has been validated previously.
Catheter ablation for treating AF
Administration of all class I or III antiarrhythmic medications was discontinued at least 5 half-lives before the procedure. In brief, each patient underwent an elec-trophysiological study and catheter ablation in the fasting, non-sedated state, after providing written informed consent.
In the PAF patients, we first tried to identify the spontaneous onset of the ectopy that triggered AF. The short-duration (8 beats) burst pacing from the right atrium, coronary sinus (CS), and pulmonary veins (PVs), with or without an isoproterenol infusion (up to 4 μg/ min), was used to facilitate spontaneous AF. The PV ostia were identified by fluoroscopy and marked on a 3-dimension (3D) map of the left atrium (LA). Continuous circumferential lesions encircling the right and left PV ostia were created by using 4-mm irrigated tip-ablation catheters guided by the NavX system. Radiofrequency ablation in the LA was performed at a power of 30 W on the anterior wall and 25 W on the posterior wall. The tip of the catheter was irrigated with heparinized saline at a rate of 17 mL/min. After completion of the circumferential lesion set, the ipsilateral superior and inferior PVs were mapped carefully by using a circular recording catheter (Spiral, AF Division, St. Jude Medical, Inc., Minnetonka, MN) during sinus rhythm or CS pacing. After successful isolation of all 4 PVs, which was confirmed by PV circumferential mapping, high current (3-5 times the pacing threshold) and prolonged pulse stimulation (8 ms) of the proximal and distal CS were performed [in 10-ms decrements from 250-150 ms, with a pacing cycle length (CL) of 5-10 s] and repeated 3-5 times. In cases showing sustained AF/flutter, cardioversion was performed to restore sinus rhythm.
In non-PAF patients, PV isolation was performed as the first step. If AF did not stop, then an additional ablation of the complex fractionated atrial electrogram (CFAE) sites was performed sequentially on the basis of the results of the CFAE maps obtained after pulmonary vein isolation (PVI). The ablation of the CFAE sites was stopped when we observed persistence of the CL, elimination of the CFAE sites, or abolishment of the local fractionated potentials (bipolar voltage, < 0.05 mV). If the AF did not stop after additional ablation of the CFAE sites, then the sinus rhythm was restored by performing electric cardioversion.
Follow-up of AF recurrences
After discharge, patients received follow-up at 2 weeks after the catheter ablation and every 1-3 months thereafter, with a follow-up duration of 1 year. Follow-up was conducted at our cardiology clinic or with the referring physicians, and either 24-h Holter monitoring or cardiac event recording with a recording duration of 1 week was performed. Antiarrhythmic drugs were prescribed for 8 weeks to prevent any early recurrence of AF. An AF recurrence was defined as an episode lasting more than 1 min and was confirmed by electrocardiography performed 3 months after the ablation (blanking period). The end-point for the follow-up was the clinically documented recurrence of atrial arrhythmias or repeat ablation procedures.
Genotyping
DNA was extracted from the buffy coat using the high pure polymerase chain reaction (PCR) template preparation kit (Roche, Mannheim, Germany). For rapid genotyping of the 2 SNPs, rs2200733 and rs7193343, TaqMan-based real-time PCR (rt-PCR) was performed followed by analysis of the melting curve. Commercially synthesized primers, TaqMan GTXpress reagents, and allele-specific fluorescent reporters (Applied Biosystems, California, USA) were used in the PCR reactions. Information on the SNPs is provided in Supplemental Table 1. All samples were run in duplicate. Melting curves that showed distinctive peaks at different temperatures were identified for each sample. On the basis of allelic discrimination, the variants were classified as wild-type, heterozygous, or homozygous. Using this method, a call rate of more than 98% was achieved for both variants. Hardy-Weinberg statistics of rs2200733, and rs7193343 were 1.73 (p=0.19), and 0.67 (p=0.41), respectively. We also screened rs13376333 which found no TT alleles in our study population. Considering of the possible limitation of study power, we did not proceed to further analysis.
Supplemental Table 1. Nucleotide sequences and primers of the single nucleotide polymorphisms.
| NCBI SNP reference/ABI assay ID | Context sequence [SNP] |
| rs2200733/C_16158671 | GTGGTACTTGGGTTTTGATTTTGAT[C/T]AGAGAAAATTAGAACAGGTAATATT |
| rs7193343/C_29343982 | GGCATGTCAATTAAAGGGGTCACCA[C/T]AAACAAGCTGTTCAAACTTTCCCCT |
NCBI, National Center for Biotechnology Information; SNP, single nucleotide polymorphism.
Statistical analysis
Continuous variables are expressed as the mean ± standard deviation (SD). Comparisons between continuous variables were performed using the two-sample t test. Categorical data were compared using Chi-square test. An additive genetic model was assumed, and the genotypes were analyzed by Cox regression to study the association with AF recurrence. The results were further adjusted for baseline characteristics (age, sex, coronary artery disease, diabetes mellitus, hypertension, history of AF, and left atrial diameter). The Akaike Information Criterion (AIC) was used to compare the model of risk-allele combination to the individual SNPs. A p-value less than 0.05 was considered statistically significant.
RESULTS
Baseline characteristics
The baseline characteristics and enrollment of the patients are summarized in Figure 1A and Table 1. The rs7193343CC variant was associated with non-PAF in both univariate and multivariate analysis [Table 2, odds ratio (OR) = 0.28, 95% confidence intervals (CI) 0.10-0.78, p = 0.01]. No significant differences were noted in the clinical and echocardiographic variables of patients with the rs2200733 genotype.
Figure 1.
The single nucleotide polymorphism predictive model of atrial fibrillation (AF)-free survival after catheter ablation in the patients with paroxysmal AF (PAF). (A) The patient enrollment of the present study; (B) The rs2200733 variants could not predict AF-free survival in the patients with PAF; (C) The rs7193343 variants could predict AF-free survival in the patients with PAF.
Table 1. Baseline patient characteristics.
| Number | 383 |
| Age (years) | 61.9 ± 14.0 |
| Male (%) | 242 (63.2%) |
| Non-PAF (%) | 162 (42.3%) |
| DM (%) | 68 (17.8%) |
| HTN (%) | 194 (50.6%) |
| CAD (%) | 29 (7.6%) |
| AF history (months) | 70.0 ± 71.0 |
| LAD (mm) | 41.0 ± 8.5 |
| LVEF (%) | 62.3 ± 11.4 |
| Amiodarone (%) | 75 (19.6%) |
| ACEI/ARB (%) | 79 (20.6%) |
| Statins (%) | 178 (46.5%) |
ACEI/ARB, angiotensin-converting enzyme/angiotensin receptor inhibitors; CAD, coronary artery disease; DM, diabetes mellitus; HTN, hypertension; LAD, left atrial diameter; LVEF, left ventricular ejection fraction; PAF, paroxysmal atrial fibrillation.
Table 2. The association between rs7193343 variants and non-paroxysmal atrial fibrillation.
| PAF | Non-PAF | Univariate | Multivariate | ||
| N = 221 | N = 162 | p-value | Odds ratio (95% CI.) | p-value | |
| rs7193343 CC allele (%) | 15.4 | 7.4 | 0.03 | 0.28 (0.10-0.78) | 0.01 |
| Age (years) | 57.9 ± 12.8 | 67.5 ± 13.7 | < 0.001 | 1.05 (1.02-1.07) | < 0.001 |
| Male (%) | 63.3 | 63 | 0.99 | ||
| DM (%) | 13.1 | 24.1 | 0.01 | 1.04 (0.48-2.24) | 0.93 |
| HTN (%) | 41.6 | 63 | < 0.001 | 1.42 (0.71-2.85) | 0.32 |
| CAD (%) | 7.3 | 8 | 0.94 | ||
| LAD (mm) | 37.8 ± 7.2 | 45.7 ± 7.9 | < 0.001 | 1.15 (1.10-1.20) | < 0.001 |
| LVEF (%) | 62.9 ± 9.9 | 61.5 ± 13.3 | 0.33 | ||
| Amiodarone (%) | 24.4 | 13 | 0.01 | 0.50 (0.24-1.05) | 0.07 |
| ACEI/ARB (%) | 31.7 | 66.7 | < 0.001 | 2.79 (1.43-5.45) | 0.003 |
| Statins (%) | 19.9 | 21.6 | 0.78 | ||
| AF history (months) | 69.3 ± 74.6 | 72.4 ± 59.0 | 0.81 |
Abbreviations are in Table 1.
Univariate analysis revealed predictors of recurrence after catheter ablation
The recurrence of AF or atrial arrhythmia was considered as the end-point of the follow-up. The mean follow-up duration was 444 ± 11 days. The recurrence rate in the patients with PAF (n = 143) was 32.9% (n = 47), and that in the patients with non-PAF (n = 46) was 67.4% (n = 31).
In the patients with PAF, the clinical and echocardiographic variables were not associated with AF recurrence after catheter ablation (Table 3). However, in patients with non-PAF, LAD was the only parameter that was associated with AF recurrence in the univariate analysis. In the total population of AF patients, male gender and LAD were associated with recurrence.
Table 3. Univariate Cox analyses of atrial fibrillation recurrences.
| PAF (N = 143) | Non-PAF (N = 46) | Total (N = 189) | ||||
| HR (95%CI) | p-value | HR (95%CI) | p-value | HR (95%CI) | p-value | |
| Age | 1.00 (0.97-1.03) | 0.84 | 0.98 (0.94-1.02) | 0.32 | 1.00 (0.97-1.02) | 0.68 |
| Male | 1.49 (0.75-2.94) | 0.25 | 2.18 (0.29-16.22) | 0.45 | 1.96 (1.06-3.64) | 0.03 |
| DM | 1.73 (0.54-5.59) | 0.36 | 1.27 (0.17-9.46) | 0.82 | 1.78 (0.65-4.88) | 0.26 |
| HTN | 1.72 (0.89-3.32) | 0.11 | 1.33 (0.66-2.71) | 0.75 | 1.21 (0.75-1.93) | 0.44 |
| CAD | 1.28 (0.31-5.27) | 0.74 | 1.65 (0.22-12.34) | 0.63 | 1.17 (0.37-3.70) | 0.79 |
| AF duration | 1.00 (0.99-1.01) | 0.6 | 1.00 (0.99-1.01) | 0.37 | 1.00 (0.99-1.00) | 0.44 |
| LAD | 1.02 (0.97-1.07) | 0.41 | 1.12 (1.04-1.21) | 0.003 | 1.06 (1.02-1.10) | 0.001 |
| LVEF | 0.99 (0.94-1.03) | 0.55 | 0.98 (0.94-1.03) | 0.41 | 0.97 (0.94-1.01) | 0.11 |
| Amiodarone | 0.91 (0.48-1.73) | 0.77 | 0.97 (0.22-1.08) | 0.08 | 0.78 (0.47-1.28) | 0.33 |
| ACEI/ARB | 0.49 (0.20-1.25) | 0.14 | 0.67 (0.31-1.44) | 0.31 | 0.92 (0.52-1.62) | 0.76 |
| Statins | 0.63 (0.25-1.60) | 0.33 | 0.90 (0.12-6.76) | 0.92 | 0.57 (0.25-1.31) | 0.19 |
HR, hazard ratio; the abbreviations are listed as Table 1.
The rs7193343 variants were independently associated with the recurrence of PAF, even after adjusting for baseline characteristics (Table 4). The rs2200733 variants were not associated with the recurrence of PAF. In the patients with non-PAF, none of the SNP variants was associated with AF recurrence after catheter ablation; this might imply that the genetic predispositions of SNPs in the patients with non-PAF are not as important as that in the patients with PAF. Figures 1B and C show the Kaplan-Meier curve for the prediction of AF-free survival by the variants of the 2 SNPs in PAF patients (mean follow-up duration: 482 ± 19 days).
Table 4. The Association of SNPs with atrial fibrillation recurrences.
| Additive model | PAF (N = 143) | Non-PAF (N = 46) | Total AF (N = 189) | |||
| HR (95% CI) | p-value | HR (95% CI) | p-value | HR (95% CI) | p-value | |
| rs7193343 | ||||||
| Unadjusted | 1.93 (1.20-3.14) | 0.01 | 1.00 (0.51-1.94) | 0.99 | 1.65 (1.14-2.39) | 0.01 |
| Adjusted* | 2.10 (1.10-4.00) | 0.02 | 1.71 (1.05-2.80) | 0.03 | ||
| rs2200733 | ||||||
| Unadjusted | 1.42 (0.88-2.28) | 0.15 | 0.97 (0.58-1.64) | 0.92 | 1.23 (0.87-1.76) | 0.25 |
AF, atrial fibrillation; CI, confidence interval; HR, hazard ratio; PAF, paroxysmal atrial fibrillation; SNPs, single nucleotide polymorphisms.
* Adjusted model: adjusting for age, sex, coronary artery disease, diabetes mellitus, hypertension, atrial fibrillation history, left atrial diameter.
The additive value of the rs7193343 and rs2200733 variants
Because the different variants of the SNPs are located on different chromosomes and may have different non-interactive functions, we tried to test whether the prediction of AF recurrence after catheter ablation could be improved by considering the findings for multiple loci. The haplotype frequency is provided in Supplemental Table 2. The combined score for rs7193343 and rs2200733 could further improve the predictive value (shown in Supplemental Table 3). The risk alleles TT, TC, and CC of rs7193343 were given weighted scores of 2, 1, and 0, respectively; the risk alleles CC, TC, and TT of rs2200733 were given weighted scores of 2, 1, and 0, respectively. In each patient, the sum of the weighted scores from rs7193343 and rs2200733 was used to predict AF-free survival. We observed that the combination score had a significantly better predictive value (Figure 2) and was independently associated with the recurrence of PAF [hazard ratio (HR): 1.18, 95% CI = 1.73-2.82, p = 0.01] even after adjusting for baseline characteristics. The AIC for the combination score was 401.8. The AIC of the additive model of rs7193343 was 407.3, respectively. The lower AIC value obtained in the combination model of the 2 risk alleles showed that the combination of risk alleles was a better model than the individual risk alleles.
Supplemental Table 2. Haplotype frequency (%).
| rs7193343TT | rs7193343TC | rs7193343CC | |
| rs2200733TT | 29.6% | 19.6% | 4.2% |
| rs2200733TC | 21.2% | 15.3% | 5.3% |
| rs2200733CC | 1.6% | 2.6% | 0.5% |
Supplemental Table 3. The weighted score of each risk allele of rs2200733 and rs7193343.
| Score weight | |
| rs7193343 | |
| TT | 2 |
| TC | 1 |
| CC | 0 |
| rs2200733 | |
| CC | 2 |
| TC | 1 |
| TT | 0 |
Figure 2.
The predictive model of atrial fibrillation (AF)-free survival after catheter ablation by combining the risk alleles of rs2200733 and rs7193343 in the patients with paroxysmal AF (PAF).
Electrophysiological characteristics
As shown in Supplemental Table 4, the rs7193343, and rs2200733 variants were not associated with different left and right atrial voltage, activation time, and fractionated intervals (mean or minimal). Similarly, the incidences of non-pulmonary vein ectopies were not different between variants.
Supplemental Table 4. Electrophysiological characteristics in different single nucleotide polymorphisms.
| LAV (mV) | LAT (ms) | RAV (mV) | RAT (ms) | Mean FI (ms) | Minimal FI (ms) | Nonpulmonary vein ectopies (%) | |
| rs7193343 | |||||||
| TT | 2.0 ± 0.7 | 103.8 ± 34.5 | 2.0 ± 0.7 | 110.7 ± 30.1 | 96.1 ± 29.6 | 46.4 ± 9.8 | 13.1% |
| CT | 1.9 ± 0.8 | 106.9 ± 34.5 | 1.8 ± 0.6 | 112.2 ± 38.5 | 87.0 ± 21.0 | 44.9 ± 8.6 | 11.3% |
| CC | 2.0 ± 0.5 | 119.9 ± 46.0 | 1.8 ± 0.5 | 101.9 ± 32.1 | 86.8 ± 19.1 | 48.1 ± 3.2 | 15.8% |
| rs2200733 | |||||||
| TT | 2.0 ± 0.7 | 103.1 ± 31.0 | 1.9 ± 0.6 | 116.3 ± 38.0 | 98.5 ± 29.1 | 47.0 ± 10.6 | 15.8% |
| CT | 1.8 ± 0.7 | 111.1 ± 41.6 | 1.9 ± 0.6 | 103.8 ± 27.9 | 86.7 ± 24.5 | 44.5 ± 8.3 | 10.1% |
| CC | 1.7 ± 1.1 | 109.0 ± 32.5 | 1.7 ± 0.7 | 107.3 ± 34.6 | 90.4 ± 9.0 | 47.8 ± 3.5 | 0% |
FI, fractionated interval; LAT, left atrial activation time; LAV, left atrial voltage; RAT, right atrial activation time; RAV, right atrial voltage.
DISCUSSION
Major findings
The rs7193343 variant was independently associated with non-PAF and was associated with the recurrence of AF in the PAF patients. In the patients with non-PAF, none of the SNP variants was associated with AF recurrence. An additive value was noted when the findings for both rs7193343 and rs2200733 variants were used together to predict the outcome, suggesting that the combination of variants increased the predictive value.
Association of the rs7193343 variants with AF recurrence
To our knowledge, this is the first study to report the association of rs7193343 variants with the outcome after catheter ablation. In a study by the Cohorts for Heart and Aging Research in Genomic Epidemiology (CHARGE) – AF consortium, rs7193343 was identified as the susceptibility locus for AF.2 The present study further supports the role of rs7193343 variants in AF recurrence after catheter ablation. The correlation between the recurrence of AF and rs7193343 variants was clinically relevant. We noted differences in the distribution of rs7193343 variants among the PAF and non-PAF patients. The incidence of the homogenous rs7193343 C allele in patients with non-PAF was significantly lower than that in PAF patients. Although the underlying mechanisms and possible clinical implications remain unclear, the findings of our study have raised an interesting theory: that the rs7193343 C allele might be associated with less persistent AF and may help to identify patients who develop non-PAF. However, a large-scale validation study is required to confirm these observations. A similar result for rs7193343 variants was not obtained in a Han Chinese population, consistent with the observation that the Taiwanese may be genetically distinct from the Han Chinese.2 The present study investigated only patients with AF, which was different from the previous GWAS. The present results highlighted the clinical impact of rs7193343 variants, which appear to be associated with non-PAF and outcomes after catheter ablation. Attempts to verify if these findings could be replicated, particularly in a different ethnic population, will be important.
Association of rs2200733 variants with AF recurrence
The rs2200733 variants has been reported to be associated with AF recurrence after catheter ablation in a Caucasian population.6 The present study did not show any significant association between rs2200733 variants and AF recurrence. Compared to the study by Husser, the present study performed follow-ups for a longer period, and no predictive value of rs2200733 variants was noted in non-PAF patients. In addition, the frequency of the rs2200733 C allele in the Caucasian population studied by Husser was greater than that in the population examined in the present study (72.5% vs. 25.7%, respectively). The dramatic difference of allele frequencies between the populations of European and Taiwanese ancestries may explain the lack of association between rs2200733 variants and AF recurrence in Taiwanese cohorts. Therefore, the association of rs2200733 variants with AF recurrence after catheter ablation was different. However, these variations may also be explained by differences in the methodology and instrumentation. For example, in the study by Husser, a pre-selected tip temperature of 48 °C, and the maximum power of 30-50 W was used for the pulmonary vein isolation during catheter ablation, while in our laboratory, a power of 25-30 W was used. Complex fractionated electrograms were the standard target site for ablation in non-PAF patients in our study, but this was not performed in Husser’s report. Different strategies for catheter ablation may lead to different outcomes, and this may explain the different results between the two studies.
Risk stratification by combining risk alleles
Lubitz et al. reported that a combination of independent signals and increasing number of risk alleles accounted for an increased risk of AF. One risk allele of the most significantly associated SNP rs2200733 conferred an odds ratio of 1.8, whereas a combination of six risk alleles increased the AF risk six-fold.7 Similarly, we attempted to use a combination of risk alleles for predicting PAF recurrence after catheter ablation. Although only 2 risk alleles were used in the present study, the combination still improved the predictive value. However, because the predictive value of each individual SNP considered in the present study was only modest, it may be clinically relevant to assess several risk alleles together to further increase the predictive power. These findings suggest that a genetic risk profile can possibly be used to predict the response to catheter ablation with greater accuracy.
The mechanisms such as biological pathways regarding the presence of SNP variants and AF recurrence after catheter ablation remain unknown. AF recurrence in patients after catheter ablation is mostly due to pulmonary vein reconnection, the incomplete elimination of cardiomyocytes around pulmonary vein ostium. The presence of SNP rs2200733 variants was associated with the regulation of PITX2, which was involved in the signal pathways of small heat shock protein.12 The presence of SNP rs2200733 variants in the cardiomyocytes might be associated with different responses after heat shock, and therefore, cardiomyocytes survival and pulmonary reconnection after ablation would be different. Using RNA interference or CRISPER to decrease the expression of PITX2 in cardiomyocytes, and observing the responses after heat shock might be helpful to prove the hypothesis. The rs7193343 CC variant was suggestive of regulating ZFHX3, which interacts with the terminal end of the protein inhibitor of activated STAT 3. STAT3 mediate the inflammatory process or angiotensin II-related pathways in AF animal models,13 by which the rs7193343 CC variant might contribute to AF persistence, rather than AF recurrence.
The clinical value of screening each individual by genetic markers before catheter ablation remains unclear. Although catheter ablation has been suggested for the patients refractory to anti-arrhythmic drugs in the guideline, it is possible the patients with low score (such as score is zero) will benefit if catheter ablation could be performed as early as possible to avoid AF induced remodeling and anti-arrhythmic drugs related complications. Contrarily, catheter ablation might not be the first choice in those with scores greater than 3 because of high recurrence rate, and the alternative should be considered.
Limitations
The statistical power of the present study may be limited given the small sample size of patients with non-PAF. Therefore, a large-scale study may be necessary. There were 14 AF loci identified by genome side screening until now; however, only a few of them have been linked to the responses after catheter ablation. Because we found no TT alleles of rs13376333 in our study population, we did not proceed to further analysis considering the possible limitation of study power. Therefore, only the results from two SNPs at chromosomes 4q25 (rs2200733 near PITX2), and 16q22 (rs7193343 in ZFHX3) were described. A systemic screen of SNPs such as genome-wide screening might be needed to provide a future insight into the responses after catheter ablation. The follow-up strategy in the present study complied with the ACC/AHA guideline, in which the regular follow-up by Holter or an event monitor was suggested. However, these methods are still limited by the under-estimation of AF recurrence.14 CHA2DS2VASc in AF recurrence after ablation was not included in the analysis, which might also be an important factor for AF recurrence.15
CONCLUSIONS
The rs7193343 variants were associated with AF recurrence after catheter ablation in PAF patients, but not in non-PAF patients. The rs7193343CC variant was identified as an independently associated factor of non-PAF.
Acknowledgments
This work was supported by research grants from the Taipei Veterans General Hospital (V98C1-037, V99C1-120, V101B-005), National Scientific Council (NSC98-2314-B-010-031-MY3, NSC 99-2911-I-008-100, NSC 100-2314-B-075-051, NSC 101-2321-B-075-004).
CONFLICT OF INTEREST
None declared.
REFERENCES
- 1.Gudbjartsson DF, Arnar DO, Helgadottir A, et al. Variants conferring risk of atrial fibrillation on chromosome 4q25. Nature. 2007;448:353–357. doi: 10.1038/nature06007. [DOI] [PubMed] [Google Scholar]
- 2.Gudbjartsson DF, Holm H, Gretarsdottir S, et al. A sequence variant in ZFHX3 on 16q22 associates with atrial fibrillation and ischemic stroke. Nat Genet. 2009;41:876–878. doi: 10.1038/ng.417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Wang J, Klysik E, Sood S, et al. Pitx2 prevents susceptibility to atrial arrhythmias by inhibiting left-sided pacemaker specification. Proc Natl Acad Sci USA. 2010;107:9753–9758. doi: 10.1073/pnas.0912585107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Kirchhof P, Kahr PC, Kaese S, et al. PITX2c is expressed in the adult left atrium, and reducing Pitx2c expression promotes atrial fibrillation inducibility and complex changes in gene expression. Circ Cardiovasc Genet. 2011;4:123–133. doi: 10.1161/CIRCGENETICS.110.958058. [DOI] [PubMed] [Google Scholar]
- 5.Berry FB, Miura Y, Mihara K, et al. Positive and negative regulation of myogenic differentiation of C2C12 cells by isoforms of the multiple homeodomain zinc finger transcription factor ATBF1. J Biol Chem. 2001;276:25057–25065. doi: 10.1074/jbc.M010378200. [DOI] [PubMed] [Google Scholar]
- 6.Husser D, Adams V, Piorkowski C, et al. Chromosome 4q25 variants and atrial fibrillation recurrence after catheter ablation. J Am Coll Cardiol. 2010;55:747–753. doi: 10.1016/j.jacc.2009.11.041. [DOI] [PubMed] [Google Scholar]
- 7.Lubitz SA, Sinner MF, Lunetta KL, et al. Independent susceptibility markers for atrial fibrillation on chromosome 4q25. Circulation. 2010;122:976–984. doi: 10.1161/CIRCULATIONAHA.109.886440. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Fuster V, Ryden LE, Cannom DS, et al. ACC/AHA/ESC 2006 Guidelines for the Management of Patients with Atrial Fibrillation: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Revise the 2001 Guidelines for the Management of Patients With Atrial Fibrillation): developed in collaboration with the European Heart Rhythm Association and the Heart Rhythm Society. Circulation. 2006;114:e257–e354. doi: 10.1161/CIRCULATIONAHA.106.177292. [DOI] [PubMed] [Google Scholar]
- 9.Sinner MF, Ellinor PT, Meitinger T, et al. Genome-wide association studies of atrial fibrillation: past, present, and future. Cardiovasc Res. 2011;89:701–709. doi: 10.1093/cvr/cvr001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Lin YJ, Tai CT, Chang SL, et al. Efficacy of additional ablation of complex fractionated atrial electrograms for catheter ablation of nonparoxysmal atrial fibrillation. J Cardiovasc Electrophysiol. 2009;20:607–615. doi: 10.1111/j.1540-8167.2008.01393.x. [DOI] [PubMed] [Google Scholar]
- 11.Hu YF, Yeh HI, Tsao HM, et al. Impact of circulating monocyte CD36 level on atrial fibrillation and subsequent catheter ablation. Heart Rhythm. 2011;8:650–656. doi: 10.1016/j.hrthm.2010.12.036. [DOI] [PubMed] [Google Scholar]
- 12.Lahvic JL, Ji Y, Marin P, et al. Small heat shock proteins are necessary for heart migration and laterality determination in zebrafish. Dev Biol. 2013;384:166–180. doi: 10.1016/j.ydbio.2013.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Zhou M, Liao Y, Tu X. The role of transcription factors in atrial fibrillation. J Thorac Dis. 2015;7:152–158. doi: 10.3978/j.issn.2072-1439.2015.01.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Calkins H, Kuck KH, Cappato R, et al. 2012 HRS/EHRA/ECAS expert consensus statement on catheter and surgical ablation of atrial fibrillation: recommendations for patient selection, procedural techniques, patient management and follow-up, definitions, endpoints, and research trial design: a report of the Heart Rhythm Society (HRS) Task Force on Catheter and Surgical Ablation of Atrial Fibrillation. Developed in partnership with the European Heart Rhythm Association (EHRA), a registered branch of the European Society of Cardiology (ESC) and the European Cardiac Arrhythmia Society (ECAS); and in collaboration with the American College of Cardiology (ACC), American Heart Association (AHA), the Asia Pacific Heart Rhythm Society (APHRS), and the Society of Thoracic Surgeons (STS). Endorsed by the governing bodies of the American College of Cardiology Foundation, the American Heart Association, the European Cardiac Arrhythmia Society, the European Heart Rhythm Association, the Society of Thoracic Surgeons, the Asia Pacific Heart Rhythm Society, and the Heart Rhythm Society. Heart Rhythm. 2012;9:632–696 e621. doi: 10.1016/j.hrthm.2011.12.016. [DOI] [PubMed] [Google Scholar]
- 15.Chen JJ, Chiu FC, Chua SK, et al. Outcome of circumferential pulmonary vein isolation for ablation of atrial fibrillation: a single center experience. Acta Cardiol Sin. 2013;29:457–461. [PMC free article] [PubMed] [Google Scholar]