Skip to main content
Acta Crystallographica Section F: Structural Biology Communications logoLink to Acta Crystallographica Section F: Structural Biology Communications
. 2016 Sep 27;72(Pt 10):795–798. doi: 10.1107/S2053230X16013406

Expression and crystallographic studies of the Arabidopsis thaliana GDP-d-mannose pyrophosphorylase VTC1

Shun Zhao a,b,*, Lin Liu a
PMCID: PMC5053166  PMID: 27710946

The GDP-d-mannose pyrophosphorylase VTC1 from A. thaliana was crystallized and co-crystallized with its substrate. X-ray diffraction data were collected for crystallographic analysis.

Keywords: ascorbic acid biosynthesis, GDP-d-mannose pyrophosphorylase, Arabidopsis thaliana

Abstract

GDP-d-mannose pyrophosphorylase catalyzes the production of GDP-d-mannose, an intermediate product in the plant ascorbic acid (AsA) biosynthetic pathway. This enzyme is a key regulatory target in AsA biosynthesis and is encoded by VITAMIN C DEFECTIVE 1 (VTC1) in the Arabidopsis thaliana genome. Here, recombinant VTC1 was expressed, purified and crystallized. Diffraction data were obtained from VTC1 crystals grown in the absence and presence of substrate using X-rays. The ligand-free VTC1 crystal diffracted X-rays to 3.3 Å resolution and belonged to space group R32, with unit-cell parameters a = b = 183.6, c = 368.5 Å, α = β = 90, γ = 120°; the crystal of VTC1 in the presence of substrate diffracted X-rays to 1.75 Å resolution and belonged to space group P21, with unit-cell parameters a = 70.8, b = 83.9, c = 74.5 Å, α = γ = 90.0, β = 114.9°.

1. Introduction  

Ascorbic acid (AsA), or vitamin C, commonly functions as an antioxidant and enzymatic cofactor in animals and plants (Englard & Seifter, 1986 ▸; Smirnoff, 2000 ▸; Foyer & Noctor, 2011 ▸). Plants are the major AsA source for humans, in which the gene encoding the last enzyme in the AsA-biosynthetic pathway is mutated and its product is nonfunctional (Chatterjee, 1973 ▸). AsA also plays a key role in plant growth and development by enhancing plant tolerance to various stresses (Hemavathi et al., 2010 ▸; Tóth et al., 2011 ▸; Vacca et al., 2004 ▸).

The major AsA-biosynthetic pathway in plants starts from GDP-d-mannose (Smirnoff et al., 2001 ▸). This differs from AsA biosynthesis in most animals and the alternative pathway in plants and Euglena, which starts from UDP-d-glucose (Linster & van Schaftingen, 2007 ▸; Wheeler et al., 2015 ▸). VITAMIN C DEFECTIVE 1 (VTC1)/CYTOKINESIS DEFECTIVE 1 (CYT1), hereafter referred to as VTC1, is a GDP-d-mannose pyrophosphorylase (GMPP) in the model plant Arabidopsis thaliana (Conklin et al., 1997 ▸; Nickle & Meinke, 1998 ▸; Lukowitz et al., 2001 ▸). VTC1 catalyzes the conversion of d-mannose 1-phosphate to GDP-d-mannose, the first rate-limiting step of the major AsA-biosynthetic pathway in plants (Wheeler et al., 1998 ▸). In the vtc1 mutant, the AsA level decreases 70% compared with the wild type (Conklin et al., 1997 ▸, 1999 ▸). VTC1 is tightly regulated by multiple mechanisms. At the transcriptional level, ETHYLENE RESPONSE FACTOR 98 acts as a positive regulator of VTC1 (Zhang et al., 2012 ▸). At the post-translational level, the photomorphogenic factor COP9 signalosome subunit 5B interacts with VTC1 and promotes VTC1 degradation though proteasomes in the dark (Wang, Yu et al., 2013 ▸; Wang, Zhang et al., 2013 ▸). Recently, two VTC1 stimulators, KONJAC1 and KONJAC2, have been identified (Sawake et al., 2015 ▸). Both proteins can interact with VTC1 and enhance its GMPP activity.

Despite the accumulated physiological studies of VTC1, the structural basis of the catalytic activity of this enzyme and its regulation is still unknown. Here, we report the purification, crystallization and diffraction of ligand-free VTC1 and VTC1 in the presence of its substrate.

2. Materials and methods  

2.1. Protein expression and purification  

The full-length gene for VTC1 (AT2G39770) was amplified from an A. thaliana cDNA library by PCR and was ligated into the pEASY-Blunt simple cloning vector (TransGen Biotech, People’s Republic of China). The gene was inserted into the expression vector pET-28a(+) (Novagen) between NcoI and HindIII sites. The resulting plasmid encodes C-terminally His6-tagged VTC1. This plasmid was transformed into Escherichia coli strain BL21(DE3) and the cells were cultured in LB medium. When the cell density reached an OD600 of 0.6–0.8, protein expression was introduced with 0.2 mM isopropyl β-d-1-thiogalactopyranoside and the cells were grown at 289 K for 16 h. The cells were then harvested by centrifugation (5000g, 10 min) and resuspended in buffer A (20 mM Tris–HCl pH 7.5, 150 mM NaCl) supplemented with 20 mM imidazole. The cells were disrupted by ultrasonication on ice and were centrifuged at 30 000g for 30 min. The supernatant was loaded onto a pre-equilibrated Ni2+–nitrilotriacetic acid column (Qiagen) and the unbound protein was washed with buffer A supplemented with 20 mM imidazole. The recombinant protein was subsequently eluted with buffer A supplemented with 200 mM imidazole. The protein was further purified by gel-filtration chromatography using a HiLoad 16/60 Superdex 200 column (GE Healthcare) pre-equilibrated with buffer A. The elution peak was collected, pooled and concentrated by ultrafiltration with a 30 kDa cutoff centrifugal filter (Millipore). The purity and concentration were determined by SDS–PAGE and a Bradford assay, respectively. The expression information is given in Table 1 ▸.

Table 1. VTC1 construction and expression information.

Source organism A. thaliana
DNA source cDNA
Forward primer CATGCCATGGGCATGAAGGCACTCATTCTTGTTG
Reverse primer CCCAAGCTTCATCACTATCTCTGGCTTCAAGAT
Cloning vector pEASY-Blunt simple cloning vector
Expression vector pET-28a(+)
Expression host E. coli BL21(DE3)
Complete amino-acid sequence of the construct produced MGMKALILVGGFGTRLRPLTLSFPKPLVDFANKPMILHQIEALKAVGVDEVVLAINYQPEVMLNFLKDFETKLEIKITCSQETEPLGTAGPLALARDKLLDGSGEPFFVLNSDVISEYPLKEMLEFHKSHGGEASIMVTKVDEPSKYGVVVMEESTGRVEKFVEKPKLYVGNKINAGIYLLNPSVLDKIELRPTSIEKETFPKIAAAQGLYAMVLPGFWMDIGQPRDYITGLRLYLDSLRKKSPAKLTSGPHIVGNVLVDETATIGEGCLIGPDVAIGPGCIVESGVRLSRCTVMRGVRIKKHACISSSIIGWHSTVGQWARIENMTILGEDVHVSDEIYSNGGVVLPHKEIKSNILKPEIVMKLAAALEHHHHHH

2.2. Crystallization  

The sitting-drop vapour-diffusion technique was used for crystallization screening. The initial crystallization conditions for VTC1 without ligands were screened at 277 and 289 K using concentrations of 7.5 and 15 mg ml−1, respectively. The process was carried out by mixing protein and reservoir solution in a 1:1 volume ratio. The ligand-free VTC1 crystal was grown using 0.1 M bis(2-hydroxyethyl)iminotris(hydroxymethyl)methane (bis-tris) pH 6.5, 25%(w/v) PEG 3350, 0.2 M lithium sulfate. The co-crystallization of VTC1 with GTP and d-mannose 1-phosphate was set up as for ligand-free VTC1. The VTC1 protein was incubated with GTP and d-mannose 1-phosphate in a 1:5:5 molar ratio on ice for 1 h. The co-crystallized VTC1 crystal was grown in 0.1 M magnesium formate, 15%(w/v) PEG 3350.

2.3. Data collection  

All of the crystals were transferred to crystallization buffer supplemented with 10% glycerol for 30 s and flash-cooled in liquid nitrogen. All diffraction data were collected on beamline BL17U at Shanghai Synchrotron Radiation Facility at a wavelength of 0.9793 Å at 100 K and were recorded on an ADSC Quantum 315r detector with 0.5 s exposure for every 1° oscillation (Wang et al., 2015 ▸). All data sets were processed, integrated and scaled with DENZO and SCALEPACK in the HKL-2000 package (Otwinowski & Minor, 1997 ▸).

3. Results and discussion  

To investigate the mechanism of catalysis by VTC1, we produced and crystallized full-length ligand-free VTC1 (Fig. 1 ▸ a). We also obtained crystals of VTC1 in the presence of GTP and d-mannose 1-phosphate (Fig. 1 ▸ b). Because VTC1 crystals in the presence of substrate were obtained in a condition containing Mg2+, an activator of VTC1, the protein molecules in solution may contain product molecules. The crystallization information is listed in Table 2 ▸.

Figure 1.

Figure 1

Crystals of ligand-free VTC1 and co-crystallized VTC1. (a) Crystal of ligand-free VTC1 obtained using 0.1 M bis-tris pH 6.5, 25%(w/v) PEG 3350, 0.2 M lithium sulfate; (b) crystal of VTC1 in the presence of GTP and d-­mannose 1-phosphate obtained using 0.1 M magnesium formate, 15%(w/v) PEG 3350.

Table 2. Crystallization of ligand-free VTC1 and co-crystallized VTC1.

  Ligand-free VTC1 Co-crystallized VTC1
Method Sitting-drop vapour diffusion Sitting-drop vapour diffusion
Plate type 48-well plates, Hampton Research 48-well plates, Hampton Research
Temperature (K) 289 289
Protein concentration (mg ml−1) 7.5 7.5
Buffer composition of protein solution 20 mM Tris–HCl pH 7.5, 150 mM NaCl 20 mM Tris–HCl pH 7.5, 150 mM NaCl
Composition of reservoir solution 0.1 M bis-tris pH 6.5, 25%(w/v) PEG 3350, 0.2 M lithium sulfate 0.1 M magnesium formate, 15%(w/v) PEG 3350
Volume and ratio of drop 2 µl, 1:1 2 µl, 1:1
Volume of reservoir (µl) 200 200

We also confirmed the integrity of the VTC1 protein in the co-crystallized crystals. Crystals were picked up from the drop, washed with reservoir solution, dissolved in SDS–PAGE loading buffer and subsequently checked by SDS–PAGE. It showed only a single band near to 45 kDa (Fig. 2 ▸), which corresponds to the molecular weight of VTC1. This band was then identified by the peptide mass fingerprinting method, with a top score of 198 and a sequence coverage of 61%.

Figure 2.

Figure 2

SDS–PAGE analysis of a crystal of VTC1 grown in the presence of substrate. Lane M, molecular-weight markers (labelled in kDa); lane 1, buffer used to wash the crystals; lane 2, crystal sample of VTC1 grown in the presence of substrate.

Two data sets were collected and the statistics of data collection are summarized in Table 3 ▸. The ligand-free VTC1 crystal diffracted X-rays to 3.3 Å resolution (Fig. 3 ▸ a) and its space group is R32, which differs from that of the crystal of co-crystallized VTC1, with unit-cell parameters a = b = 183.6, c = 368.5 Å, α = β = 90, γ = 120°. The VTC1 crystals grown in the presence of substrate diffracted to a high resolution of 1.75 Å (Fig. 3 ▸ b), with space group P21 and unit-cell parameters a = 70.8, b = 83.9, c = 74.5 Å, α = γ = 90.0, β = 114.9°. We are working towards phase solution by single-wavelength anomalous dispersion using selenomethionine-containing crystals.

Table 3. Data collection and processing.

  Ligand-free VTC1 Co-crystallized VTC1
Diffraction source BL17U, SSRF BL17U, SSRF
Wavelength (Å) 0.9793 0.9793
Temperature (K) 100 100
Detector ADSC Q315r ADSC Q315r
Crystal-to-detector distance (mm) 400 120
Rotation range per image (°) 1 1
Total rotation range (°) 100 180
Exposure time per image (s) 0.5 0.5
Space group R32 P21
a, b, c (Å) 183.6, 183.6, 368.5 70.8, 83.9, 74.5
α, β, γ (°) 90.0, 90.0, 120.0 90.0, 114.9, 90.0
Mosaicity (°) 0.54 0.32
Resolution range (Å) 50–3.30 (3.42–3.30) 50.0–1.75 (1.81–1.75)
Total No. of reflections 201448 300113
No. of unique reflections 36128 78685
Completeness (%) 99.5 (99.6) 98.6 (97.6)
Multiplicity 5.6 (5.7) 3.8 (3.8)
〈I/σ(I)〉 14.0 (3.1) 21.5 (2.5)
R r.i.m. † 0.126 (0.598) 0.069 (0.648)
R merge ‡ 0.115 (0.544) 0.087 (0.906)
†

R r.i.m. = Inline graphic Inline graphic, where Ii(hkl) is the intensity of the ith measurement of an equivalent reflection with indices hkl.

‡

R merge = Inline graphic Inline graphic, where Ii(hkl) is the ith observation of reflection hkl and 〈I(hkl)〉 is the weighted intensity for all observations i of reflection hkl.

Figure 3.

Figure 3

The X-ray diffraction patterns of a ligand-free VTC1 crystal and a VTC1 crystal grown in the presence of substrate. (a) Diffraction image of ligand-free VTC1 to a resolution of 3.3 Å; (b) diffraction image of VTC1 in the presence of GTP and d-mannose 1-phosphate to a resolution of 1.75 Å.

Acknowledgments

We thank the staff at Shanghai Synchrotron Radiation Facility for technical support during data collection. This work was supported by the National Natural Science Foundation of China (Grant No. 31170688).

References

  1. Chatterjee, I. B. (1973). Science, 182, 1271–1272. [DOI] [PubMed]
  2. Conklin, P. L., Norris, S. R., Wheeler, G. L., Williams, E. H., Smirnoff, N. & Last, R. L. (1999). Proc. Natl Acad. Sci. USA, 96, 4198–4203. [DOI] [PMC free article] [PubMed]
  3. Conklin, P. L., Pallanca, J. E., Last, R. L. & Smirnoff, N. (1997). Plant Physiol. 115, 1277–1285. [DOI] [PMC free article] [PubMed]
  4. Englard, S. & Seifter, S. (1986). Annu. Rev. Nutr. 6, 365–406. [DOI] [PubMed]
  5. Foyer, C. H. & Noctor, G. (2011). Plant Physiol. 155, 2–18. [DOI] [PMC free article] [PubMed]
  6. Hemavathi, Upadhyaya, C. P., Akula, N., Young, K. E., Chun, S. C., Kim, D. H. & Park, S. W. (2010). Biotechnol. Lett. 32, 321–330. [DOI] [PubMed]
  7. Linster, C. L. & Van Schaftingen, E. (2007). FEBS J. 274, 1–22. [DOI] [PubMed]
  8. Lukowitz, W., Nickle, T. C., Meinke, D. W., Last, R. L., Conklin, P. L. & Somerville, C. R. (2001). Proc. Natl Acad. Sci. USA, 98, 2262–2267. [DOI] [PMC free article] [PubMed]
  9. Nickle, T. C. & Meinke, D. W. (1998). Plant J. 15, 321–332. [DOI] [PubMed]
  10. Otwinowski, Z. & Minor, W. (1997). Methods Enzymol. 276, 307–326. [DOI] [PubMed]
  11. Sawake, S., Tajima, N., Mortimer, J. C., Lao, J., Ishikawa, T., Yu, X., Yamanashi, Y., Yoshimi, Y., Kawai-Yamada, M., Dupree, P., Tsumuraya, Y. & Kotake, T. (2015). Plant Cell, 27, 3397–3409. [DOI] [PMC free article] [PubMed]
  12. Smirnoff, N. (2000). Curr. Opin. Plant Biol. 3, 229–235. [PubMed]
  13. Smirnoff, N., Conklin, P. L. & Loewus, F. A. (2001). Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 437–467. [DOI] [PubMed]
  14. Tóth, S. Z., Nagy, V., Puthur, J. T., Kovács, L. & Garab, G. (2011). Plant Physiol. 156, 382–392. [DOI] [PMC free article] [PubMed]
  15. Vacca, R. A., de Pinto, M. C., Valenti, D., Passarella, S., Marra, E. & De Gara, L. (2004). Plant Physiol. 134, 1100–1112. [DOI] [PMC free article] [PubMed]
  16. Wang, J., Yu, Y., Zhang, Z., Quan, R., Zhang, H., Ma, L., Deng, X. W. & Huang, R. (2013). Plant Cell, 25, 625–636. [DOI] [PMC free article] [PubMed]
  17. Wang, J., Zhang, Z. & Huang, R. (2013). Plant Signal. Behav. 8, e24536. [DOI] [PMC free article] [PubMed]
  18. Wang, Q.-S. et al. (2015). Nucl. Sci. Tech. 26, 010102.
  19. Wheeler, G., Ishikawa, T., Pornsaksit, V. & Smirnoff, N. (2015). Elife, 4, e06369. [DOI] [PMC free article] [PubMed]
  20. Wheeler, G. L., Jones, M. A. & Smirnoff, N. (1998). Nature (London), 393, 365–369. [DOI] [PubMed]
  21. Zhang, Z., Wang, J., Zhang, R. & Huang, R. (2012). Plant J. 71, 273–287. [DOI] [PubMed]

Articles from Acta Crystallographica. Section F, Structural Biology Communications are provided here courtesy of International Union of Crystallography

RESOURCES