Skip to main content
Oncotarget logoLink to Oncotarget
. 2016 Mar 30;7(19):27665–27675. doi: 10.18632/oncotarget.8491

Single-nucleotide polymorphisms in PSCA and the risk of breast cancer in a Chinese population

Meng Wang 1, Xijing Wang 1, Sidney W Fu 2, Xinghan Liu 1, Tianbo Jin 3, Huafeng Kang 1, Xiaobin Ma 1, Shuai Lin 1, Haitao Guan 1, Shuqun Zhang 1, Kang Liu 1, Cong Dai 1, Yuyao Zhu 1, Zhijun Dai 1,2
PMCID: PMC5053679  PMID: 27050280

Abstract

This study explored the associations between common PSCA single-nucleotide polymorphisms (rs2294008, rs2978974, and rs2976392) and breast cancer among 560 breast cancer cases and 583 controls (Chinese Han women). We found rs2294008 was significantly associated with a high risk of breast cancer (homozygote model, odds ratio [OR]: 1.67, 95% confidence interval [CI]: 1.06–2.59; recessive, OR: 1.64, 95% CI: 1.06–2.53). And stratification by menopausal status revealed an association of the minor allele of rs2294008 with breast cancer risk among premenopausal (homozygote model, OR: 2.41, 95% CI: 1.03–5.66; recessive, OR: 2.80, 95 % CI: 1.21–6.47) and postmenopausal women (allele model, OR: 1.29, 95% CI: 1.01–1.65). Rs2978974 influenced the breast cancer risk among postmenopausal women in heterozygote model (OR: 1.47, 95% CI: 1.05–2.07). When stratified by clinicopathologic features, the T allele of rs2294008 was associated with progesterone receptor status (homozygote model, OR: 1.98, 95% CI: 1.08–3.63; recessive, OR: 1.87, 95% CI: 1.04–3.37), and the rs2976392 polymorphism was associated with high lymph node metastasis risk in homozygote model (OR: 2.09, 95%CI: 1.01–4.31). Further haplotype analysis suggested that Trs2294008 Ars2976392 Grs2978974 haplotype enhances breast cancer risk (OR:1.52, 95%CI:1.23-1.89, P<0.001). Therefore, among Chinese Han women, the PSCA rs2294008, rs2978974, and rs2976392 minor alleles are associated with increased breast cancer risk especially in progesterone receptor positive breast cancer patients, with breast cancer risk in postmenopausal women, and with high lymph node metastasis risk, respectively. Moreover, Trs2294008 Ars2976392 Grs2978974 haplotype was associated with significantly increased risk of breast cancer.

Keywords: PSCA, single-nucleotide polymorphisms, breast cancer, susceptibility

INTRODUCTION

Breast cancer is the most common cancer and the principal cause of cancer-related deaths among Chinese women [1], accounted for 248,620 new cases and 60,473 cancer-related deaths during 2011 [2]. It is a multi-factorial disease influenced by complex interactions between genetic, environmental, and lifestyle factors [3]. Genetic research provides insight into carcinogenesis, including the development and treatment of breast cancer. Single-nucleotide polymorphisms (SNPs) are variations in a single base pair in the DNA sequence and have been widely studied in cancer research in recent years. Several genes that affect breast cancer risk, including BRCA1 (breast cancer 1), BRCA2 (breast cancer 2), PTEN (phosphatase and tensin homolog deleted on chromosome ten), and TP53 (tumor protein p53) have been identified [48].

PSCA encodes a 123-amino acid immature lymphocyte cell surface maker with 30% homology to stem cell antigen type 2, a member of the Thy-1/Ly-6 family and is located on chromosome 8q24.2 [10]. PSCA was initially identified as a prostate-specific antigen over-expressed in >80% of prostate cancers, including metastatic and hormone-related cancers [10, 11]. Recent studies have shown that PSCA is also abnormally expressed in bladder cancer [1214], gastric cancer [1517], renal cell carcinoma [18], oesophageal cancer [19], gallbladder cancer [2022], and pancreatic cancer [23]. Studies in vitro indicated that PSCA being transfected into PSCA-negative cells caused down-regulated cell proliferation, thus affecting survival of gastric cancer cells [24]. And, down-regulation of PSCA in a human bladder cancer cell line led to inhibition of cell growth via activation of several immune signaling pathways [25]. Genome-wide association studies have revealed many PSCA polymorphisms, among which rs2294008 C>T, rs2978974 G>A, and rs2976392 G>A are the most widely studied ones and may influence susceptibility to different types of cancer [22, 26, 27]. However, few studies have been performed to investigate the associations of these three PSCA SNPs with breast cancer. A single study with small sample sizes (456 patients and 461controls) revealed that the PSCA SNPs were associated with breast cancer susceptibility among Korean women [9]. Therefore, the present study aimed to comprehensively examine the potential association of three SNPs (rs2294008 C>T, rs2978974 G>A, and rs2976392 G>A) in PSCA with the risk of breast cancer among a population of Chinese women.

RESULTS

Associations between PSCA SNPs and the risk of breast cancer

Detailed allele frequencies and genotype distributions of the three polymorphisms are shown in Table 1. The distributions of rs2294008, rs2978974, and rs2976392 in the control group were in accordance with Hardy-Weinberg equilibrium (P = 0.195, P = 0.164, and P = 0.179, respectively). Both the homozygote and recessive models of rs2294008 revealed an associated with a high risk of breast cancer (TT vs. CC, odds ratio [OR]: 1.67, 95% confidence interval [CI]: 1.06–2.59, P = 0.03; TT vs. CC+TC, OR: 1.64, 95% CI: 1.06–2.53, P = 0.02). We further calculated the power of the rs2294008 SNP homozygote and recessive model analyses, and we were able to reject the null hypothesis that the TT frequency for case and controls is equal with probability (power) = 0.896. No significant associations with rs2976392 and rs2978974 were found in any of the models.

Table 1. Genotype frequencies of PSCA polymorphisms in cases and controls.

Model Genotype Cases (n,%) Control (n,%) P OR (95% CI)
rs2294008 HWE: P=0.195
Co-dominant CC 273 (48.8%) 299 (51.3%)
Heterozygote TC 231 (41.3%) 247 (42.4%) 0.85 1.02 (0.80-1.31)
Homozygote TT 56 (10.0%) 37 (6.3%) 0.03 1.67 (1.06-2.59)
Dominant CC 273 (48.8%) 299 (51.3%)
TC+TT 287 (51.3%) 284 (48.7%) 0.39 1.11 (0.88-1.40)
Recessive CC+TC 504 (90.0%) 546 (93.7%)
TT 56 (10.0%) 37 (6.3%) 0.02 1.64 (1.06-2.53)
Overdominant CC+TT 329 (%) 336 (57.6%)
TC 231 (%) 247 (42.4%) 0.70 0.96 (0.76-1.21)
Allele C 777(69.4%) 845 (72.5%)
T 343(30.6%) 321 (27.5%) 0.10 1.16 (0.97-1.39)
rs2976392 HWE: P=0.164
Co-dominant GG 287 (51.3%) 298 (51.1%)
Heterozygote GA 230 (41.1%) 247 (42.4%) 0.79 0.97 (0.76-1.23)
Homozygote AA 43 (7.7%) 38 (6.5%) 0.50 1.18 (0.74-1.87)
Dominant GG 287 (51.3%) 298 (51.1%)
GA+AA 273 (48.8%) 285 (48.9%) 0.96 1.00 (0.79-1.25)
Recessive GG+GA 517 (92.3%) 545 (93.5%)
AA 43 (7.7%) 38 (6.5%) 0.45 1.19 (0.76-1.88)
Overdominant GG+AA 330 (58.9%) 336 (57.6%)
GA 230 (41.1%) 247 (42.4%) 0.66 0.95 (0.75-1.20)
Allele G 804 (71.8%) 843 (72.3%)
A 316 (28.2%) 323 (27.7%) 0.79 1.03 (0.85-1.23)
rs2978974* HWE: P=0.179
Co-dominant GG 254 (45.4%) 283 (48.5%)
Heterozygote GA 259 (46.3%) 256 (43.9%) 0.33 1.13 (0.89-1.44)
Homozygote AA 46 (8.2%) 44 (7.5%) 0.50 1.17 (0.75-1.82)
Dominant GG 254 (45.4%) 283 (48.5%)
GA+AA 305 (54.6%) 300 (51.5%) 0.29 1.13 (0.90-1.43)
Recessive GG+GA 513 (91.8%) 539 (92.5%)
AA 46 (8.2%) 44 (7.5%) 0.67 1.10 (0.71-1.69)
Overdominant GG+AA 300 (53.7%) 327 (56.1%)
GA 259 (46.3%) 256 (43.9%) 0.41 1.10 (0.87-1.39)
Allele G 767(68.6%) 822 (70.5%)
A 351(31.4%) 344 (29.0%) 0.33 1.09 (0.92-1.31)

OR: odds ratio; 95%CI: confidence interval.

*

Cases of rs2978974 polymorphism missing n = 1

Adjusted for age and body mass index.

Subgroup analyses according to age and menopausal status

Stratification analyses according to age revealed no significant associations between the three PSCA SNPs and the risk of breast cancer (all, P > 0.05) (Table 2). While, stratification analyses according to menopausal status (Table 3) found that the minor allele of rs2294008 was a risk factor among both premenopausal women (homozygote model, OR: 2.41, 95% CI: 1.03–5.66, P = 0.04; recessive model, OR: 2.80, 95% CI: 1.21–6.47, P = 0.01) and postmenopausal women (allele model: OR: 1.29, 95% CI: 1.01–1.65, P = 0.04). For rs2978974, a significant association with high breast cancer risk was found among postmenopausal women in the heterozygote model (OR: 1.47, 95% CI: 1.05–2.07, P = 0.03). There were no significant associations with rs2976392 in any of the subgroups.

Table 2. Association between PSCA SNPs and age of breast cancer patients.

Age(years) genotype distributions(case/control) Co-dominant Dominant Recessive Allele
AA Aa aa P OR (95%CI) P OR (95%CI) P OR (95%CI) P OR (95%CI)
rs2294008
<49 135/157 128/131 31/23 0.46m
0.13n
1.14(0.81-1.59)m
1.57(0.87-2.82)n
0.26 1.20 (0.87-1.65) 0.18 1.48 (0.84-2.60) 0.15 1.20 (0.94-1.53)
≥49 138/142 103/116 25/14 0.62m
0.08n
0.91(0.64-1.30)m
1.84(0.92-3.68)n
0.94 1.01 (0.72-1.42) 0.06 1.91 (0.97-3.76) 0.40 1.12 (0.86-1.47)
rs2976392
<49 156/163 117/130 21/18 0.72m
0.56n
0.94(0.67-1.31)m
1.22(0.63-2.37)n
0.87 0.97 (0.71-1.34) 0.50 1.25 (0.65-2.40) 0.89 1.02 (0.79-1.31)
≥49 131/135 113/117 22/20 0.98m
0.71n
1.00(0.70-1.42)m
1.13(0.59-2.18)n
0.93 1.02 (0.72-1.42) 0.90 0.98 (0.70-1.38) 0.81 1.03 (0.79-1.34)
rs2978974
<49 135/159 142/138 17/14 0.25m
0.34n
1.21(0.87-1.68)m
1.43(0.68-3.01)n
0.20 1.23 (0.90-1.70) 0.48 1.30 (0.63-2.69) 0.21 1.17 (0.91-1.51)
≥49 119/124 117/118 29/30 0.86m
0.98n
1.03(0.72-1.48)m
1.01(0.57-1.78)n
0.87 1.03 (0.73-1.44) 0.98 1.00 (0.58-1.70) 0.92 1.01 (0.79-1.31)

A: Major allele; a: Minor allele;

m= Heterozygote model;

n= Homozygote model; OR: odds ratio; 95%CI: confidence interval.

Table 3. Association between PSCA SNPs and menopausal status of breast cancer patients.

menopausal status genotype distributions (case/control) Co-dominant Dominant Recessive Allele
AA Aa aa P OR (95%CI) P OR (95%CI) P OR (95%CI) P OR (95%CI)
rs2294008
Premenopausal 143/138 101/135 20/8 0.07m
0.04n
0.72(0.51-1.02)m
2.41(1.03-5.66)n
0.24 0.82 (0.58-1.13) 0.01 2.80 (1.21-6.47) 0.95 0.99 (0.76-1.30)
Postmenopausal 130/161 120/112 36/29 0.11m
0.12n
1.33(0.94-1.88m
1.54(0.90-2.64)n
0.06 1.37 (0.99-1.90) 0.25 1.36 (0.81-2.28) 0.04 1.29 (1.01-1.65)
rs2976392
Premenopausal 131/140 118/129 15/12 0.90m
0.47n
0.98(0.69-1.38)m
1.34(0.60-2.96)n
0.96 1.01 (0.72-1.41) 0.45 1.35 (0.62-2.94) 0.77 1.04(0.80-1.36)
Postmenopausal 156/158 112/118 28/26 0.82m
0.77n
0.96(0.68-1.35)m
1.09(0.61-1.94)n
0.93 0.99 (0.71-1.36) 0.72 1.11 (0.63-1.94) 0.93 1.01 (0.79-1.30)
rs2978974
Premenopausal 129/131 115/137 20/13 0.37m
0.23n
0.85(0.60-1.21)m
1.56(0.75-3.27)n
0.60 0.91 (0.65-1.28) 0.15 1.69 (0.82-3.47) 0.90 1.02 (0.78-1.32)
Postmenopausal 125/152 144/119 26/31 0.03m
0.95n
1.47(1.05-2.07)m
1.02(0.58-1.81)n
0.05 1.38 (1.00-1.90) 0.55 0.85 (0.49-1.46) 0.23 1.16 (0.91-1.48)

A: Major allele; a: Minor allele;

m= Heterozygote model;

n= Homozygote model; OR: odds ratio; 95%CI: confidence interval.

Associations between PSCA SNPs and the clinicopathological features of breast cancer

We evaluated the associations of PSCA SNPs with various clinicopathological features including: tumor size, lymph node metastasis, and the expressions of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER-2). The T allele of rs2294008 was associated with positive PR status (homozygote model, OR: 1.98, 95% CI: 1.08–3.63, P = 0.03; recessive model, OR: 1.87, 95% CI: 1.04–3.37, P = 0.03) (Table 4). The minor allele of rs2976392 was associated with a high risk of lymph node metastasis in the homozygote model (OR: 2.09, 95% CI: 1.01–4.31, P = 0.04). However, rs2978974 was not significantly associated with any of the clinicopathological features.

Table 4. The associations between the PSCA polymorphisms and clinical characteristics of breast cancer patients.

Variables AA Aa aa Co-dominant Dominant Recessive Allele
P OR (95%CI) P OR (95%CI) P OR (95%CI) P OR (95%CI)
rs2294008
Tumor size
<2 cm 98 75 15 1.00 (reference)
≥2 cm 175 156 41 0.42m
0.19n
1.17(0.80-1.69)m
1.53(0.81-2.91)n
0.26 1.23 (0.86-1.74) 0.26 1.43 (0.77-2.65) 0.16 1.21 (0.92-1.60)
LN metastasis
Negative 109 98 29 1.00 (reference)
Positive 164 133 27 0.57m
1.10n
0.90(0.63-1.29)m
0.62(0.35-1.10)n
0.30 0.84(0.60-1.17) 1.12 0.65(0.37-1.13) 1.13 0.82(0.64-1.06)
ER
Negative 124 110 13 1.00 (reference)
Positive 143 149 21 0.36m
0.37n
1.18(0.83-1.66)m
1.40(0.67-2.91)n
0.29 1.20(0.86-1.67) 0.48 1.30(0.64-2.64) 0.28 1.16(0.89-1.50)
PR
Negative 132 105 18 1.00 (reference)
Positive 141 126 38 0.52m
0.03n
1.12(0.79-1.60)m
1.98(1.08-3.63)n
0.19 1.25(0.90-1.74) 0.03 1.87(1.04-3.37) 0.05 1.30(1.00-1.68)
HER-2
Negative 190 166 33 1.00 (reference)
Positive 83 65 23 0.58m
0.12n
0.90(0.61-1.32)m
1.60(0.88-2.88)n
0.95 1.01(0.71-1.45) 0.52 1.21(0.68-2.13) 0.38 1.13(0.86-1.49)
rs2976392
Tumor size
<2 cm 97 78 13 1.00 (reference)
≥2 cm 190 152 30 0.98m
0.64n
1.00(0.69-1.44)m
1.18(0.59-2.36)n
0.91 1.02(0.72-1.45) 0.63 1.18(0.60-2.32) 0.77 1.04(0.79-1.37)
LN metastasis
Negative 120 105 11 1.00 (reference)
Positive 167 125 32 0.38m
0.04n
0.86(0.60-1.21)m
2.09(1.01-4.31)n
0.87 0.97(0.70-1.36) 0.15 1.67(0.83-3.38) 0.41 1.12(0.86-1.46)
ER
Negative 125 99 23 1.00 (reference)
Positive 162 131 20 0.91m
0.22n
1.02(0.72-1.45)m
0.67(0.35-1.28)n
0.79 0.96(0.68-1.33) 0.20 0.67(0.36-1.24) 0.45 0.91(0.70-1.18)
PR
Negative 129 104 22 1.00 (reference)
Positive 158 126 21 0.95m
0.45n
0.99(0.70-1.40)m
0.78(0.41-1.48)n
0.78 0.95(0.68-1.33) 0.44 0.78(0.42-1.46) 0.58 0.93(0.72-1.21)
HER-2
Negative 192 166 31 1.00 (reference)
Positive 95 64 12 0.20m
0.50n
0.78(0.41-1.48)m
0.78(0.39-1.59)n
0.18 0.78(0.54-1.12) 0.70 0.87(0.44-1.74) 0.22 0.84(0.63-1.11)
rs2978974
Tumor size
<2 cm 89 87 12 1.00 (reference)
≥2 cm 165 172 34 0.73m
0.24n
1.07(0.74-1.54)m
1.53(0.75-3.10)n
0.52 1.12(0.79-1.60) 0.26 1.48(0.75-2.93) 0.34 1.14(0.87-1.50)
LN metastasis
Negative 113 104 18 1.00 (reference)
Positive 141 155 28 0.32m 1.19(0.84-1.70)m
1.25(0.66-2.37)n
0.28 1.20(0.86-1.68) 0.68 1.14(0.62-2.12) 0.32 1.14(0.88-1.47)
ER
Negative 108 121 18 1.00 (reference)
Positive 146 138 28 0.34m
0.67n
0.84(0.60-1.20)m
1.15(0.61-2.19)n
0.47 0.88(0.63-1.24) 0.47 1.25(0.68-2.33) 0.81 0.97(0.75-1.25)
PR
Negative 117 122 16 1.00 (reference)
Positive 137 137 30 0.81m
0.16n
0.96(0.68-1.36)m
1.60(0.83-3.08)n
0.85 1.03(0.74-1.44) 0.12 1.64(0.87-3.07) 0.43 1.11(0.86-1.43)
HER-2
Negative 176 185 27 1.00 (reference)
Positive 78 74 19 0.60m
0.16n
0.90(0.62-1.32)m
1.59(0.83-3.03)n
0.96 0.99(0.69-1.42) 0.10 1.67(0.90-3.10) 0.52 1.09(0.83-1.44)

A: Major allele; a: Minor allele;

m= Heterozygote model;

n= Homozygote model; OR: odds ratio; 95%CI: confidence interval; LN: lymph node; ER: estrogen receptor; PR: progesterone receptor; Her-2: human epidermal growth factor receptor-2.

Association between PSCA haplotypes and breast cancer risk

We analyzed the association between PSCA haplotypes and the risk of breast cancer. Table 5 shows that Trs2294008 Ars2976392 Grs2978974 haplotype was associated with a significantly increased risk of breast cancer (OR: 1.52, 95%CI: 1.23–1.89, P<0.001). The “others” (haplotypes with frequency <1% were merged) were broadly distributed in cases at a low level (OR: 0.46, 95%CI: 0.29-0.71, P<0.001). The significance of this result is limited given the naturally low frequencies of these haplotypes. We did not discover any associations with Crs2294008 Grs2976392 Ars2978974 and Trs2294008 Ars2976392 Ars2978974 in breast cancer.

Table 5. The haplotype frequencies of PSCA polymorphisms and breast cancer risk.

Haplotypes Controls (N=1166) n, % Cases (N=1120) n, % OR (95% CI) p
rs2294008 rs2976392 rs2978974
C G G 526 (45.12%) 454(40.52%) 1.00 (reference)
C G A 317(27.17%) 315(28.12%) 1.15(0.94-1.41) 0.168
T A G 225(19.28%) 296(26.39%) 1.52 (1.23-1.89) <0.001
T A A 22 (1.90%) 25(2.26%) 1.32(0.73-2.37) 0.357
Others 76 (6.52%) 30(2.72%) 0.46 (0.29-0.71) <0.001

DISCUSSION

Genetic studies have provided insight into various diseases, including cancers. Understanding the associations between different genes and cancers can improve prevention, treatment, and prognosis estimation. Genome-wide association studies have revealed many genetic markers of different cancers. Recently numerous studies have indicated that PSCA may influence a diverse group of cancers, including gastric, bladder, renal, and pancreatic cancers [9, 1223, 26]. However, there is little insight into the relationship between PSCA and breast cancer.

Rs2294008 is located in exon 1 of PSCA and its C to T transition has been shown to reduce transcriptional activity of an upstream fragment of PSCA [28, 29]. Precious meta-analyses discovered that T allele of rs2294008 was a risk factor for cancer, particularly for gastric and bladder cancers [26, 27]. The T allele of rs2294008 increased risk for gastric cancer in Asian populations [30, 31] and the genetic variant rs2294008 was identified to confer genetic susceptibility for bladder cancer risk in both Caucasian [12] and Asian [14, 20] populations. In this study, we found that the minor allele of rs2294008 was associated with a high risk of breast cancer among both premenopausal and postmenopausal women. There was no association between rs2294008 and ER status, although PR-positive tumors were associated with the T allele. In contrast, a study based on Korean women reported that the minor allele of rs2294008 was associated with reduced breast cancer risk among premenopausal women, increased breast cancer risk among postmenopausal women, and that the T allele increased the ER-negative breast cancer risk [9]. Whist similar, our study provides a more robust analysis as it includes more patients as well as more detailed stratified analyses. Given the heterogeneous nature of breast cancer, the discrepancies between our findings and those of Kim et al. [9] may be explained by various factors, including region, lifestyle, genetic testing methods, and study design.

Rs2976392 is located in the intron 2 of PSCA and has a strong linkage disequilibrium with rs2294008 C > T [24, 32]. The association of this SNP and cancer susceptibility has been widely investigated. Recent meta-analysis has revealed the PSCA rs2976392 polymorphism was significantly associated with increased overall cancer risk [27]. Rs2978974 in the promoter region of PSCA showed low linkage disequilibrium with rs2294008 and the Ars2978974 allele was shown to contribute to bladder cancer susceptibility, presumably due to the loss of binding of ELK1 or other ETS proteins to the PSCA promoter [12]. A study based on 405 gallbladder cancer patients and 247 healthy controls showed that the PSCA haplotype Trs2294008 Ars2978974 conferred low risk of gallbladder cancer in males, while in females, the Trs2294008 Grs2978974 haplotype was related to increased gallbladder cancer risk [22]. Kim et al. found that there was no statistically significant relationship between rs2976392 and breast cancer risk, which is concordant with our study. However, we found the rs2976392 SNP was associated with an increased risk of lymph node metastasis. This study provides the first investigation of associations between rs2978974 and breast cancer risk. We demonstrated that the minor allele of rs2978974 specifically increased the risk of breast cancer among postmenopausal women, while it was not associated with the risk of breast cancer among all patients, and was not associated with patient age or any of the clinicopathological features.

It is believed that haplotypes may be more important than any single SNP analysis in influencing a clinical response [33, 34]. To our knowledge, this is the first report of haplotypes in PSCA rs2294008, rs2976392, and rs2978974 polymorphisms. Haplotype analysis indicated that the Trs2294008 Ars2976392 Grs2978974 haplotype was associated with significantly increased risk of breast cancer.

This study has several limitations. First, the single-center design may preclude extrapolation of our findings to other patient populations or ethnic groups. Second, we used a hospital-based case-control design, which may involve selection bias. Third, our sample size was relatively small, which may limit the strength of our stratified analyses. Fourth, we did not consider other important risk factors (e.g., high-dose radiation exposure at the chest, alcohol consumption, and other benign breast lesions), as we did not have access to these data. Therefore, a large well-designed prospective study is needed to validate our findings. Furthermore, biological function studies are crucial for elucidating the role of PSCA in breast cancer.

Our study revealed that the PSCA rs2294008 polymorphism influenced the risk of breast cancer among Chinese women and the rs2978974 polymorphism may specifically increase the risk of breast cancer in postmenopausal women. We found that rs2294008 was associated with PR-positive status and rs2976392 was associated with lymph node metastasis among Chinese women with breast cancer. Furthermore, the Trs2294008 Ars2976392 Grs2978974 haplotype may increase the susceptibility to breast cancer.

MATERIALS AND METHODS

Study population

We included the cases with pathologically-confirmed breast cancer, without history of any cancer, were treated at the Department of Oncology (Second Affiliated Hospital of Xi'an Jiaotong University) between January 2013 and October 2014. The healthy individuals who had visited the medical examination center at the Second Affiliated Hospital of Xi'an Jiaotong University for a check-up during the study period were included as controls. All individuals were Chinese Han women, and the controls were frequency-matched to the cases according to age (±5 years) and menopausal status. Finally, 560 eligible patients with an average age 49.09 ± 11.02 years and 583 healthy age-matched controls were included in the study (Table 6). The cases and controls exhibited similar clinical characteristics with the exception of body mass index (BMI) (P = 0.038).

Table 6. The characteristics of breast cancer cases and cancer-free controls.

Characteristics Cases Controls P
Number 560 583
Age (mean ± SD) 49.09±11.02 48.80±8.28 0.612
Menopausal status
 Premenopausal 264 281
 Postmenopausal 296 302 0.716
Procreative times
 <2 289 291 0.594
 ≥2 271 292
Body mass index (kg/m2)
 (mean ± SD) 22.52±2.84 22.95±3.21 0.038
Tumor size <2 cm 188
≥2 cm 372
LN metastasis Negative 236
Positive 324
ER Negative 247
Positive 313
PR Negative 255
Positive 305
Her-2 Negative 389
Positive 171

LN: lymph node; ER: estrogen receptor; PR: progesterone receptor; Her-2: human epidermal growth factor receptor-2.

A standardized epidemiological questionnaire was used to collect demographic and personal information. Clinical information was collected from medical records and pathological reports. All participants were informed regarding the study's purpose and experimental procedures, and provided their written informed consent. The Human Research Committee at our institution approved the use of blood samples.

SNP selection and genotyping

Peripheral blood samples were collected in a standard tube and stored at −80°C. Genomic DNA was extracted from the peripheral whole blood samples using the Universal Genomic DNA Extraction Kit (version 3.0; TaKaRa, Japan). To achieve a power of at least 50%, only SNPs with a minor allele frequency of >0.01 were included. Three primers were designed to amplify fragments of rs2294008, rs2978974, and rs2976392. Primers and PCR product sequences are shown in Table 7. DNA concentrations were measured by spectrometry (DU530 UV/VIS spectrophotometer; Beckman Instruments, Fullerton, CA, USA), Sequenom MassARRAY RS1000 was used for genotyping, and the related data were managed using Sequenom Typer 4.0 Software [35].

Table 7. Primers used for this study.

SNP_ID 1st-PCRP 2nd-PCRP UEP_SEQ
rs2294008 ACGTTGGATGTATAAAGTCACCTGAGGCCC ACGTTGGATGATCAACAGGGCAAGCAGCAC ccatGGCAAGCAGCACAGCCTTC
rs2976392 ACGTTGGATGATCTTTCTGGCCATCTGTCC ACGTTGGATGAGATGCTGGGTGATTGTTGG GGAAGGAAAACAGCACA
rs2978974 ACGTTGGATGTTGGACCCCAGCTAAGTAAG ACGTTGGATGTCCCGGTGCAGTTTCTGATG ggtGCAGTGCTGCCTTCC

Statistical analysis

Microsoft Excel and SPSS software (version 21.0; SPSS Inc., Chicago, IL, USA) were used for all analyses. P-values were calculated using the χ2 test, and all tests were two-tailed; a P-value of <0.05 was considered statistically significant. The exact test was used to examine the distribution of each SNP among the controls, and their accordance with the Hardy-Weinberg equilibrium. Five different genetic models were used to evaluate the risk of breast cancer, with “A” used to indicate the major allele and “a” used to indicate the minor allele: the allele model (a vs. A); the co-dominant model (homozygote model: aa vs. AA; heterozygote model: Aa vs. AA); the recessive model (aa vs. AA+Aa); the dominant model (AA vs. Aa+aa); and the over-dominant model (AA+aa vs. Aa). The allelic frequencies for each SNP were compared between cases and controls in each model using the χ2 test and SNPStats software [36, 37]. Power calculations were made by PS software (Power and Sample Size Calculation, which was downloaded online: http://biostat.mc.vanderbilt.edu/wiki/Main/PowerSampleSize). Phase2.1 software was used to conduct all common haplotypes [34] and SPSS software was used to estimate the ORs and 95 % CIs for each haplotype. As shown in Table 6, there was a significant difference in BMI between breast cancer cases and controls (P = 0.038). BMI may be a confounder in the development of breast cancer. Therefore, to control for its effects, we used stratification analyses. First, we calculated OR1 and OR2 by stratification for BMI. Then, the ratio of the OR (unadjusted OR) and OR1/OR2 was calculated. If the ratio was close to 1, the results did not need to be adjusted, indicating that BMI was not a confounder. Otherwise, we would need to adjust results for BMI.

Acknowledgments

This study was supported by National Natural Science Foundation, China (No. 81471670; 81274136); China Postdoctoral Science Foundation (No. 2014M560791; 2015T81037); the Fundamental Research Funds for the Central Universities, China (No. 2014qngz-04); the International Cooperative Project (No. 2013KW-32-01)and Science and Technology Plan of Innovation Project, Shaanxi province, China (No. 2015KTCL03-06). We also thanks for the language editing by Editage.

Footnotes

COMPETING INTERESTS

The authors have declared that no competing interest exists.

REFERENCES

  • 1.Zeng H, Zheng R, Zhang S, Zou X, Chen W. Female breast cancer statistics of 2010 in China: estimates based on data from 145 population-based cancer registries. J Thorac Dis. 2014;6:466–470. doi: 10.3978/j.issn.2072-1439.2014.03.03. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chen W, Zheng R, Zeng H, Zhang S, He J. Annual report on status of cancer in China, 2011. Chin J Cancer Res. 2015;27:2–12. doi: 10.3978/j.issn.1000-9604.2015.01.06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lichtenstein P, Holm NV, Verkasalo PK, Iliadou A, Kaprio J, Koskenvuo M, Pukkala E, Skytthe A, Hemminki K. Environmental and heritable factors in the causation of cancer–analyses of cohorts of twins from Sweden, Denmark, and Finland. N Engl J Med. 2000;343:78–85. doi: 10.1056/NEJM200007133430201. [DOI] [PubMed] [Google Scholar]
  • 4.Ellsworth RE, Decewicz DJ, Shriver CD, Ellsworth DL. Breast Cancer in the Personal Genomics Era. Curr Genomics. 2010;11:146–161. doi: 10.2174/138920210791110951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fackenthal JD, Olopade OI. Breast cancer risk associated with BRCA1 and BRCA2 in diverse populations. Nat Rev Cancer. 2007;7:937–948. doi: 10.1038/nrc2054. [DOI] [PubMed] [Google Scholar]
  • 6.Fanale D, Amodeo V, Corsini LR, Rizzo S, Bazan V, Russo A. Breast cancer genome-wide association studies: there is strength in numbers. Oncogene. 2012;31:2121–2128. doi: 10.1038/onc.2011.408. [DOI] [PubMed] [Google Scholar]
  • 7.Katoh M. Cancer genomics and genetics of FGFR2 (Review) Int J Oncol. 2008;33:233–237. [PubMed] [Google Scholar]
  • 8.Yu KD, Di GH, Fan L, Chen AX, Yang C, Shao ZM. Lack of an association between a functional polymorphism in the interleukin-6 gene promoter and breast cancer risk: a meta-analysis involving 25,703 subjects. Breast Cancer Res Treat. 2010;122:483–488. doi: 10.1007/s10549-009-0706-5. [DOI] [PubMed] [Google Scholar]
  • 9.Kim SY, Yoo JY, Shin A, Kim Y, Lee ES, Lee YS. Prostate stem cell antigen single nucleotide polymorphisms influence risk of estrogen receptor negative breast cancer in Korean females. Asian Pac J Cancer Prev. 2012;13:41–48. doi: 10.7314/apjcp.2012.13.1.041. [DOI] [PubMed] [Google Scholar]
  • 10.Reiter RE, Gu Z, Watabe T, Thomas G, Szigeti K, Davis E, Wahl M, Nisitani S, Yamashiro J, Le Beau MM, Loda M, Witte ON. Prostate stem cell antigen: a cell surface marker overexpressed in prostate cancer. Proc Natl Acad Sci USA. 1998;95:1735–40. doi: 10.1073/pnas.95.4.1735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gu Z, Thomas G, Yamashiro J, Shintaku IP, Dorey F, Raitano A, Witte ON, Said JW, Loda M, Reiter RE. Prostate stem cell antigen (PSCA) expression increases with high gleason score, advanced stage and bone metastasis in prostate cancer. Oncogene. 2000;19:1288–1296. doi: 10.1038/sj.onc.1203426. [DOI] [PubMed] [Google Scholar]
  • 12.Fu YP, Kohaar I, Rothman N, Earl J, Figueroa JD, Ye Y, Malats N, Tang W, Liu L, Garcia-Closas M, Muchmore B, Chatterjee N, Tarway M, et al. Common genetic variants in the PSCA gene influence gene expression and bladder cancer risk. Proc Natl Acad Sci USA. 2012;109:4974–4979. doi: 10.1073/pnas.1202189109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Wang P, Ye D, Guo J, Liu F, Jiang H, Gong J, Gu C, Shao Q, Sun J, Zheng SL, Yu H, Lin X, Xia G, et al. Genetic score of multiple risk-associated single nucleotide polymorphisms is a marker for genetic susceptibility to bladder cancer. Genes Chromosomes Cancer. 2014;53:98–105. doi: 10.1002/gcc.22121. [DOI] [PubMed] [Google Scholar]
  • 14.Ma Z, Hu Q, Chen Z, Tao S, Macnamara L, Kim ST, Tian L, Xu K, Ding Q, Zheng SL, Sun J, Xia G, Xu J. Systematic evaluation of bladder cancer risk-associated single-nucleotide polymorphisms in a Chinese population. Mol Carcinog. 2013;52:916–921. doi: 10.1002/mc.21932. [DOI] [PubMed] [Google Scholar]
  • 15.Lochhead P, Frank B, Hold GL, Rabkin CS, Ng MT, Vaughan TL, Risch HA, Gammon MD, Lissowska J, Weck MN, Raum E, Müller H, Illig T, et al. An association between a variation in the PSCA gene and upper gastrointestinal cancer in Caucasians. Gastroenterology. 2011;140:435–441. doi: 10.1053/j.gastro.2010.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gu X, Zhang W, Xu L, Cai D. Quantitative assessment of the influence of prostate stem cell antigen polymorphisms on gastric cancer risk. Tumour Biol. 2014;35:2167–2174. doi: 10.1007/s13277-013-1287-9. [DOI] [PubMed] [Google Scholar]
  • 17.Zhao J, Geng P, Li Z, Cui S, Zhao J, Wang L, Li J, Ji F, Li G, Shen G, Lin M, Shen C. Prostate stem cell antigen rs2294008 polymorphism differentially contributes to Helicobacter pylori-negative gastric cancer among various populations in China. Mol Clin Oncol. 2013;1:493–498. doi: 10.3892/mco.2013.70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Elsamman EM, Fukumori T, Tanimoto S, Nakanishi R, Takahashi M, Toida K, Kanayama HO. The expression of prostate stem cell antigen in human clear cell renal cell carcinoma: a quantitative reverse transcriptase polymerase chain reaction analysis. BJU Int. 2006;98:668–673. doi: 10.1111/j.1464-410X.2006.06350.x. [DOI] [PubMed] [Google Scholar]
  • 19.Dai N, Zheng M, Wang C, Ji Y, Du J, Zhu C, He Y, Zhu M, Zhu X, Sun M, Dai J, Ma H, Chen J, et al. Genetic variants at 8q24 are associated with risk of esophageal squamous cell carcinoma in a Chinese population. Cancer Sci. 2014;105:731–735. doi: 10.1111/cas.12399. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wang P, Ye D, Guo J, Liu F, Jiang H, Gong J, Gu C, Shao Q, Sun J, Zheng SL, Yu H, Lin X, Xia G, et al. Genetic score of multiple risk-associated single nucleotide polymorphisms is a marker for genetic susceptibility to bladder cancer. Genes Chromosomes Cancer. 2014;53:98–105. doi: 10.1002/gcc.22121. [DOI] [PubMed] [Google Scholar]
  • 21.Ono H, Chihara D, Chiwaki F, Yanagihara K, Sasaki H, Sakamoto H, Tanaka H, Yoshida T, Saeki N, Matsuo K. Missense allele of a single nucleotide polymorphism rs2294008 attenuated antitumor effects of prostate stem cell antigen in gallbladder cancer cells. J Carcinog. 2013;12:4. doi: 10.4103/1477-3163.109030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Rai R, Sharma KL, Misra S, Kumar A, Mittal B. PSCA gene variants (rs2294008 and rs2978974) confer increased susceptibility of gallbladder carcinoma in females. Gene. 2013;530:172–177. doi: 10.1016/j.gene.2013.08.058. [DOI] [PubMed] [Google Scholar]
  • 23.Grubbs EG, Abdel-Wahab Z, Tyler DS, Pruitt SK. Utilizing quantitative polymerase chain reaction to evaluate prostate stem cell antigen as a tumor marker in pancreatic cancer. Ann. Surg. Oncol. 2006;13:1645–1654. doi: 10.1245/s10434-006-9029-5. [DOI] [PubMed] [Google Scholar]
  • 24.Study Group of Millennium Genome Project for Cancer. Genetic variation in PSCA is associated with susceptibility to diffuse-type gastric cancer. Nat. Genet. 2008;40(6):730–40. doi: 10.1038/ng.152. [DOI] [PubMed] [Google Scholar]
  • 25.Marra E, Uva P, Viti V, Simonelli V, Dogliotti E, De Rinaldis E, Lahm A, La Monica N, Nicosia A, Ciliberto G, Palombo F. Growth delay of human bladder cancer cells by Prostate Stem Cell Antigen downregulation is associated withactivation of immune signaling pathways. B.M.C Cancer. 2010;10:129. doi: 10.1186/1471-2407-10-129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wang M, Wang XJ, Ma YF, Ma XB, Dai ZM, Lv Y, Lin S, Liu XH, Yang PT, Dai ZJ. PSCA rs2294008 C > T polymorphism contributes to gastric and bladder cancer risk. Ther Clin Risk Manag. 2015;11:237–245. doi: 10.2147/TCRM.S77089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Gu Y, Dai QS, Hua RX, Zhang B, Zhu JH, Huang JW, Xie BH, Xiong SQ, Tan GS, Li HP. PSCA s2294008 C>T and rs2976392 G>A polymorphisms contribute to cancer susceptibility: evidence from published studies. Genes Cancer. 2015;6:254–264. doi: 10.18632/genesandcancer.63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Saeki N, Gu J, Yoshida T, Wu X. Prostate stem cell antigen: a Jekyll and Hyde molecule. Clin Cancer Res. 2010;16:3533–3538. doi: 10.1158/1078-0432.CCR-09-3169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wang M, Chu H, Lv Q, Wang L, Yuan L, Fu G, Tong N, Qin C, Yin C, Zhang Z, Xu J. Cumulative effect of genome-wide association study-identified genetic variants for bladder cancer. Int J Cancer. 2014;135:2653–2660. doi: 10.1002/ijc.28898. [DOI] [PubMed] [Google Scholar]
  • 30.Zhao J, Geng P, Li Z, Cui S, Zhao J, Wang L, Li J, Ji F, Li G, Shen G, Lin M, Shen C. Prostate stem cell antigen rs2294008 polymorphism differentially contributes to Helicobacter pylori-negative gastric cancer among various populations in China. Mol Clin Oncol. 2013;1:493–498. doi: 10.3892/mco.2013.70. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Rizzato C, Kato I, Plummer M, Muñoz N, Canzian F. Genetic variation in PSCA and risk of gastric advanced preneoplastic lesions and cancer in relation to Helicobacter pylori infection. PLoS One. 2013;8:e73100. doi: 10.1371/journal.pone.0073100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Chandra V, Kim JJ, Gupta U, Mittal B, Rai R. Impact of DCC (rs714) and PSCA (rs2294008 and rs2976392) Gene Polymorphism in Modulating Cancer Risk in Asian Population. Genes (Basel) 2016;7:E9. doi: 10.3390/genes7020009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chu CM, Chen CJ, Chan DC, Wu HS, Liu YC, Shen CY, Chang TM, Yu JC, Harn HJ, Yu CP, Yang MH. CDH1 polymorphisms and haplotypes in sporadic diffuse and intestinal gastric cancer: a case-control study based on direct sequencing analysis. World J Surg Oncol. 2014;12:80. doi: 10.1186/1477-7819-12-80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Cheng XL, Ning T, Xu CQ, Li Y, Zhu BS, Hou FT, Zhang SY, Chen ZP. Haplotype analysis of CTLA4 gene and risk of esophageal squamous cell carcinoma in Anyang area of China. Hepatogastroenterology. 2011;58:432–437. [PubMed] [Google Scholar]
  • 35.Thomas RK, Baker AC, Debiasi RM, Winckler W, Laframboise T, Lin WM, Wang M, Feng W, Zander T, MacConaill L, Lee JC, Nicoletti R, Hatton C, et al. High-throughput oncogene mutation profiling in human cancer. Nat Genet. 2007;39:347–351. doi: 10.1038/ng1975. [DOI] [PubMed] [Google Scholar]
  • 36.Solé X1, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22:1928–1929. doi: 10.1093/bioinformatics/btl268. [DOI] [PubMed] [Google Scholar]
  • 37.Adamec C. Example of the use of the nonparametric test: Test χ2 for comparison of 2 independent examples. Cesk Zdrav. 1964;12:613–619. [PubMed] [Google Scholar]

Articles from Oncotarget are provided here courtesy of Impact Journals, LLC

RESOURCES