Skip to main content
NCBI home page
British Journal of Pharmacology logoLink to British Journal of Pharmacology
. 2016 Aug 31;173(19):2894–2909. doi: 10.1111/bph.13569

Butein provides neuroprotective and anti‐neuroinflammatory effects through Nrf2/ARE‐dependent haem oxygenase 1 expression by activating the PI3K/Akt pathway

Dong‐Sung Lee 1, Gil‐Saeng Jeong 2,✉
PMCID: PMC5055139  PMID: 27465039

Abstract

Background and Purpose

Butein, 3,4,2′,4′‐tetrahydroxychalcone, has various pharmacological effects. However, no study has demonstrated the specific neurobiological mechanisms of the effects of butein in neuronal cells. The present study examined the role of butein as an antioxidative and anti‐inflammatory inducer of haem oxygenase 1 (HO1) in mouse hippocampal HT22, BV2 microglial and primary mouse hippocampus neurons.

Experimental Approach

We investigated the neuroprotective effects of butein on glutamate‐induced HT22 cell and primary mouse hippocampal neuron death and its anti‐neuroinflammatory effects on LPS‐induced activation of BV2 cells. We elucidated the underlying mechanisms by assessing the involvement of NF‐κB, HO1, nuclear factor‐E2‐related factor 2 (Nrf2) and Akt signalling.

Key Results

Butein decreased cellular oxidative injury and the production of ROS in glutamate‐treated HT22 cells and primary mouse hippocampal neurons. Furthermore, butein suppressed LPS‐induced pro‐inflammatory enzymes and mediators in BV2 microglia. Butein inhibited IL‐6, IL‐1β and TNF‐α production and mRNA expression. In addition, butein decreased NO and PGE2 production and inducible NOS and COX‐2 expression through the NF‐κB signalling pathway. Butein up‐regulated Nrf2/ARE‐mediated HO1 expression through the PI3K/Akt pathway and this was positively associated with its cytoprotective effects and anti‐neuroinflammatory actions.

Conclusion and Implications

Our results indicate that butein effectively prevents glutamate‐induced oxidative damage and LPS‐induced activation and that the induction of HO1 by butein through the PI3K/Akt pathway and Nrf2 activation appears to play a pivotal role in its effects on neuronal cells. Our results provide evidence for the neuroprotective properties of butein.

Abbreviations

ARE

antioxidant response element

HO1

haem oxygenase 1

iNOS

inducible NOS

Nrf2

nuclear factor‐E2‐related factor 2

Tables of Links

TARGETS
Other protein targets a Enzymes b
Bcl‐2 Akt (PKB)
Bcl‐xL Caspase‐3
TNF‐α COX‐2
HO1
iNOS
LIGANDS
IL‐1β LY294002
IL‐6 NO
Glutamate PGE2
LPS Tin protoporphyrin IX (SnPP IX)
Open in a new tab

These Tables list key protein targets and ligands in this article which are hyperlinked to corresponding entries in http://www.guidetopharmacology.org, the common portal for data from the IUPHAR/BPS Guide to PHARMACOLOGY (Southan et al., 2016) and are permanently archived in the Concise Guide to PHARMACOLOGY 2015/16 (a,bAlexander et al., 2015a, 2015b).

Introduction

Brain tissues are particularly vulnerable to oxidative stress and inflammatory conditions that may occur pathologically as a result of neurodegenerative disorders, such as Parkinson's, Alzheimer's and Huntington's disease (Hald and Lotharius, 2005). Glutamate generates oxidative stress by various different mechanisms, which leads to the depletion of glutathione, elevated Ca2+ levels, increased ROS production and inhibition of the cellular uptake of cystine via the cystine/glutamate transport system (Rőssler et al., 2004). HT22 is an immortalized neuronal cell line derived from the mouse hippocampus that lacks functional ionotropic glutamate receptors. Therefore, HT22 cells have been used to show that excitotoxicity is not involved in glutamate‐induced cellular damage (Maher and Davis, 1996; Jeong et al., 2008). In addition, neuroinflammation plays a key role in the generation of oxidative stress and the pathogenesis of neurodegenerative diseases (Gonzalez‐Scarano and Baltuch, 1999; Vila et al., 2001). Microglia are activated in the injured brain and release various toxic factors, including pro‐inflammatory cytokines, NO and arachidonic acid (Chao et al., 1992; Meda et al., 1995; Streit et al., 2004). The immortalized BV‐2 cell line derived from murine microglial is generally used as an in vitro microglial model (Blasi et al., 1990). The immortalized BV‐2 cells exhibit phenotypical properties as well as functional features comparable with primary microglial cells (Bocchini et al., 1992). In the present study, we used BV‐2 cells to elucidate the role of immune stimulation in microglial cell survival and death (Boje and Arora, 1992). NF‐κB is involved in the regulation of many inflammatory genes that encode mediators of immune, acute‐phase and inflammatory responses (Connelly et al., 2001). The production of pro‐inflammatory cytokines in microglia is also regulated by NF‐κB (Fiebich et al., 2002; Wang et al., 2002; Jeong et al., 2013). The generation of ROS is increased in activated microglia and the ensuing oxidative damage induces an inflammatory condition. Therefore, therapeutic efforts have been aimed at mitigating the deleterious effects of ROS or inhibiting their formation and so prevent or be beneficial in neuroinflammatory conditions.

Normal cells possess a variety of antioxidant systems to counteract oxidative and inflammatory stresses. Enzymatic antioxidants, such as haem oxygenase 1 (HO1) contribute to the detoxification of xenobiotics and the expression of stress response proteins (Lee et al., 1971). HO enzymes are one of the pivotal components in the cellular antioxidant system. The three by‐products of the HO reaction, which include biliverdin/bilirubin, carbon monoxide and free ferrous iron, have protective effects against oxidative stress and inflammation (Morse and Choi, 2002; Lee et al., 2006). HO1 is involved in various disease states, including ischaemic stroke and neurodegenerative disease (Pappolla et al., 1998; Panahian et al., 1999). Previous studies have reported that cerebellar granule cells from transgenic mice neurons that overexpress HO1 appear to be relatively resistant to H2O2‐ and glutamate‐stimulated oxidative damage (Chen et al., 2000). Similarly, neuroblastoma cell lines transfected with HO1 cDNA are less prone, than untreated cells, to oxidative injury resulting from exposure to β‐amyloid or H2O2 (Le et al., 1999; Takeda et al., 2000). In addition, the HO1 in microglia has also been reported to have an anti‐neuroinflammatory action (Lim et al., 2005; Min et al., 2008), which was correlated with the suppression of pro‐inflammatory cytokines and chemokines in activated microglia (Otterbein et al., 2000). Enhancing the expression of HO1 also represses the expression of pro‐inflammatory enzymes, thereby reducing COX‐2‐driven PGE2 and the production of NO derived from inducible nitric oxide synthase (iNOS) (Suh et al., 2006). Thus, intracellular antioxidant enzymes including HO1 are mainly modulated at the transcriptional level, and its expression is associated with the activation of nuclear factor‐E2‐related factor 2 (Nrf2) (Qiang et al., 2004). Nrf2 is a transcription factor of basic leucine zipper that normally remains in the cytoplasm bound to Keap 1 protein, a Nrf2 inhibitor, but translocates to the nucleus after an external stimulus. Nrf2 is associated with the antioxidant response element (ARE) sequence, which is the promoter sites of specific genes (Itoh et al., 1997). In addition, HO1 is up‐regulated by activating Nrf2, which then reduces oxidative stress in disease models of neurodegeneration (de Vries et al., 2008; Lee and Jeong, 2014). Some researchers have indicated that PI3K/Akt signalling may be involved in activating the transcription of Nrf2, which is widely viewed as a mediator of neuroprotection by its ability to up‐regulate various antioxidant enzymes (Enomoto et al., 2001; Narasimhan et al., 2011).

Butein (3,4,2′,4′‐tetrahydroxychalcone) is a major active component of Toxicodendron vernicifluum or Rhus verniciflua (Kang et al., 2004). R. verniciflua contains an abundance of flavonoids, such as quercetin, fustin, fisetin, sulfuretin and butein; hence, it exerts antioxidant, anti‐inflammatory and other biological effects. Butein is a major active flavonoid with pharmacological effects, such as endothelium‐dependent vasodilatation (Yu et al., 1995), the induction of apoptosis (Iwashita et al., 2000; Kim et al., 2001), inhibition of the symptoms of diabetes (Lim et al., 2001) and inhibition of various enzymes (Zhang et al., 1997; Yang et al., 2001). Butein has also been found to have antioxidant and anti‐inflammatory properties in various disease models (Sogawa et al., 1994; Chan et al., 1998). In addition, some studies have suggested that butein or R. verniciflua bark extract and its active flavonoids inhibit neurobiological effects (Cho et al., 2012; Cho et al., 2013). Therefore, in the present study we have focused on the molecular targets and specific mechanisms underlying the anti‐neurodegenerative activities of butein. We demonstrated that butein possesses neuroprotective effects in mouse hippocampal HT22 cells and anti‐neuroinflammatory effects in murine microglial BV2 cells. We also elucidated the underlying mechanisms of butein and determined whether its up‐regulation of HO1 expression via the PI3K/Akt pathway and Nrf2 plays a pivotal role in its effects on neurons.

Methods

Cells and primary mouse hippocampal neuron cultures

HT22 mouse hippocampal and BV2 microglial cells were obtained from Prof. Hyun Park at Wonkwang University (Iksan, Korea). Cells were retained in DMEM medium supplemented with 10% heat‐inactivated FBS, L‐glutamine (2 mM), streptomycin (100 mg·mL−1) and penicillin G (100 U·mL−1), and were incubated in a humidified atmosphere containing 95% air and 5% CO2 at 37°C. 3‐[4,5‐Dimethylthiazol‐2‐yl]‐2,5‐diphenyltetrazolium bromide (50 mg·mL−1) was added to well plates for 4 h. To assess cell viability, formazan dissolved in acidic 2‐propanol was added to the cells and optical density was determined at 590 nm. Primary mouse hippocampal neurons were obtained from the Gibco Life Technology (Gaithersburg, MD, USA) and cultured in Neurobasal® medium (Gibco Life Technology) with 10% heat‐inactivated FBS, penicillin G, streptomycin, L‐glutamine and additional supplements until day 4 of culture. Passage 2 was used for the experiments.

Measurement of reactive oxygen species

ROS measurement was conducted as described previously (Lee and Jeong, 2014). HT22 cells (2.5 × 104 cells·mL−1 in 24‐well plates) were treated with 5 mmol·L−1 glutamate in the presence or absence of butein or SnPP (HO inhibitor) and incubated for 12 h. The cells were stained with 10 μM of 2′,7′‐dichlorofluorescein diacetate for 30 min in the dark. After being washed, the cells were extracted with 1% Triton X‐100 for 10 min at 37°C. Fluorescence was measured using the Spectramax Gemini XS (Molecular Devices, Sunnyvale, CA, USA) at an excitation wavelength of 490 nm and an emission wavelength of 525 nm. The cells were observed immediately under a laser‐scanning confocal microscope (Leica TCS SP2; Leica Microsystems Inc., Buffalo Grove, IL, USA). The fluorescence of 2',7'‐dichlorofluorescein diacetate was excited at 488 nm with an argon laser, and emissions were filtered with a 515‐nm long pass filter.

DNA fragmentation assay

DNA fragmentation was evaluated using the Cellular DNA fragmentation elisa kit (Roche Diagnostics, Mannheim, Germany). This is a photometric elisa that detects 5′‐bromo‐2′‐deoxy‐uridine‐labelled DNA fragments formed during apoptosis. After treatment with glutamate and butein for 24 h, the cells were harvested and the pellets were collected. The cytoplasmic DNA fragments were isolated using the Cellular DNA fragmentation elisa kit according to the manufacturer's instructions. Photometric readings were obtained at 450 nm in an elisa reader (Bio‐rad, Hercules, CA, USA).

Caspase activity assay

Cell caspase activity was tested using a caspase‐3 assay kit from Sigma. This caspase‐3 colorimetric assay is based on hydrolysis of the peptide substrate acetyl‐Asp‐Glu‐Val‐Asp p‐nitroanilide by caspase‐3, resulting in the release of the p‐nitroaniline moiety. After treatment with glutamate and butein for 24 h, the cells were harvested and washed with cold PBS. The pellets were lysed in lysis buffer containing 50 mM HEPES pH 7.4, 5 mM DTT and 5 mM CHAPS (3‐((3‐Cholamidopropyl)dimethylammonium)‐1‐propanesulfonate). Caspase activity assay was performed according to the manufacturer's instructions, and absorbance was measured in an elisa reader at 405 nm.

Western blot analysis

The pellets of cells were lysed using RIPA lysis buffer and protein concentration was determined using the Bradford Assay Reagent (Bio‐Rad, PA, USA). Equal amounts of proteins were then separated by SDS‐PAGE and transferred to a Hybond‐enhanced chemiluminescence nitrocellulose membrane (Bio‐Rad, PA, USA). The membrane was blocked and incubated with primary antibodies (all at 1:1000) at 4°C overnight. The bands were visualized with enhanced chemiluminescence and quantified by densitometry. All the blots presented are representative of at least three independent experiments, and the data are presented as the mean ± SD of three independent experiments. The extracts of nuclear protein and cytoplasmic protein were performed using the NE‐PER reagent from Pierce Biotechnology (Rockford, IL USA) respectively.

Luciferase assays and siRNA transfections of HO1 and Nrf2

The luciferase assays and siRNA transfections were conducted as described previously (Lee and Jeong, 2014). To construct the ARE‐luciferase vector, tandem repeats of double‐stranded oligonucleotides spanning the 5′‐TGACTCAGCA‐3′ Nrf2 binding site were introduced into the restriction sites of the pGL2 promoter plasmid (Promega, Madison, WI, USA). The reliability of this transfection process was tested using a commercially available reagent, Lipofectamine 2000 (Invitrogen), according to the manufacturer's instructions. The cell lysate for the luciferase assay was mixed with luciferase substrate solution (Promega), and luciferase activity was measured using a luminometer. Luciferase activity was determined in triplicate for each experiment and normalized for each sample using β‐galactosidase activity. In addition, siRNA transfections of HO1 and Nrf2 were tested using a commercially available reagent Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Briefly, cells were transiently transfected with Nrf2 siRNA and HO1 siRNA for 6 h and recovered in fresh media containing 10% FBS for 24 h.

Real‐time PCR analysis

RNA was extracted from cells or tissues using an RNeasy Mini Kit (Qiagen). For real‐time PCR, first‐strand cDNA was synthesized from 1 μg total RNA using an Advantage RT‐for‐PCR Kit (Takara Korea Biomedical Inc., Seoul, Korea). Relative messenger RNA levels were determined by real‐time PCR using a Brilliant II SYBR Green QPCR Master Mix Kit (Stratagene) and an Mx3000P thermal cycler (Stratagene). All cDNA levels where normalized to the level of GAPDH. The primer sequences were designed using PrimerQuest (Integrated DNA Technologies, Cambridge, MA, USA). The primer sequences were as follows: IL‐1β (forward 5′‐AATTGGTCATAGCCCGCACT‐3′, reverse 5′‐AAGCAATGTGCTGGTGCTT C‐3′), IL‐6 (forward 5′‐ACTTCACAAGTCGGAGGCTT‐3′, reverse 5′‐TGCAAGTGCAT CATCGTTGT‐3′), TNF‐α (forward 5′‐CCAGACCCTCACACTCACAA‐3′, reverse 5′‐ ACAAGGTACAACCCATCGGC‐3′), HO1 (forward 5′‐CTCTTGGCTGGCTTCCTT‐3′, reverse 5′‐GGCTCCTTCCTCCTTTCC‐3′) and GAPDH (forward 5′‐AGGTCGGTGTGAACG GATTTG‐3′, reverse 5′‐TGTAGACCATGTAGTTGAGGTCA‐3′).

Immunofluorescence

The cells were cultured on the Lab‐Tek II chamber slides and the samples treated as indicated in the figure legends. The cells were treated with 20 μM of a particular compound for 1 h, fixed in formalin and permeabilized with cold acetone. The cells were probed with NF‐κB p65 antibody and FITC ‐labelled secondary antibody (Alexa Fluor 488; Invitrogen). To visualize the nuclei, the cells treated with 4′,6‐diamino‐2‐phenylindole (DAPI; 1 μg·mL−1) for 30 min and washed with PBS for 5 min. After being washed, the cells were treated with 50 μL VectaShield (Vector Laboratories, Burlingame, CA, USA). Stained cells were visualized and photographed using a Provis AX70 fluorescence microscope (Olympus Optical, Tokyo, Japan).

Determination of nitrite, PGE2, TNF‐α and IL‐1β production and NF‐κB DNA binding activity

The nitrite concentration in media was determined using a method based on the Griess reaction to estimate NO production (Lee and Jeong, 2014). The PGE2, TNF‐α, IL‐6 and IL‐1β levels in culture media and NF‐κB DNA‐binding activity in the nuclear extracts were measured using a commercially available kit from R&D Systems and Active Motif. The assay was performed according to the manufacturer's instructions.

Statistical analysis

Data are expressed as the mean ± SEM of five or six independent experiments and assessed by t‐test with Welch's correction or one‐way anova followed by Tukey's multiple post hoc comparison tests using GraphPad Prism software version 3.03 software (GraphPad Software Inc., San Diego, CA, USA). The post hoc tests for multiple comparisons were performed only if F achieved P < 0.05, and there was no significant variance in homogeneity. A value of P < 0.05 was considered statistically significant. The data and statistical analysis comply with the recommendations on experimental design and analysis in pharmacology (Curtis et al., 2015).

Materials

Butein from Sigma Chemical Co. (St. Louis, MO, USA), tin protoporphyrin IX (SnPP IX) from Porphyrin Products (Logan, UT, USA), Lipofectamine 2000 from Invitrogen Life Technologies (Grand Island, NY, USA), elisa kits for PGE2, IL‐6, IL‐1β and TNF‐α from R&D Systems (Minneapolis, MN, USA), antibodies to Nrf2, phosphorylated‐Akt, Akt from Cell Signaling Technology (Danvers, MA, USA) and HO1 antibody, LY294002 from Calbiochem (San Diego, CA, USA) were used in this study. DMEM and other tissue culture reagents were acquired from Gibco BRL (Grand Island, NY, USA). Small interfering RNA (siRNA) for HO1 and Nrf2 and antibodies to Bcl‐2, Bcl‐xL, iNOS, COX‐2, phosphorylated‐IκB‐α, NF‐κB p65, NF‐κB p50 and actin were brought from Santa Cruz Biotechnology (Santa Cruz, CA, USA).

Results

Effects of butein on glutamate‐induced cell damage and ROS generation in HT22 cells

To determine the cytotoxic potential of butein (Figure 1A), its effects on the viability of HT22 cells (Figure 1B) and BV2 cells (Figure 1C) were evaluated. A concentration of 10 μM showed no cytotoxic effects according to the MTT assay. However, a higher concentration reduced the viability of these cells slightly (Figure 1B and 1C). Treatment with glutamate for 24 h decreased HT22 cell viability compared with that of the untreated cells, and butein dose‐dependently increased the viability of glutamate‐treated cells (Figure 1D and F). Glutamate also doubled ROS production, but 10 μM butein effectively suppressed ROS production of glutamate‐treated cells (Figure 1E and 1G).

Figure 1.

Figure 1

Open in a new tab

Chemical structure of butein (A), its effects on glutamate‐induced oxidative neurotoxicity (D, F) and ROS generation (E, G). (B, C) HT22 cells and BV2 microglia were incubated for 72 h with various concentrations of butein (1–20 μM). (D, F) HT22 cells were pretreated for 12 h with the indicated concentrations of butein (1–10 μM) and then incubated for 12 h with glutamate (5 mM). Exposing HT22 cells to 5 mM glutamate for 12 h increased ROS production (E), followed by incubation with 10 μM of the ROS‐sensitive fluorophore DCF (G). Data are presented as mean ± SEM (n = 6). * P < 0.01 versus untreated control. # P < 0.05 versus group treated with glutamate. Trolox (50 μmol·L−1) was used as a positive control.

Effects of butein on glutamate‐induced apoptotic action in HT22 cells

A fragmented DNA elisa was used to quantify apoptotic cell damage (Figure 2A). After treatment with glutamate for 24 h, the amount of fragmented DNA increased 5.4 ± 0.3‐fold compared with that in the control. However, pretreatment with butein for 12 h reduced the amount of fragmented DNA induced by glutamate in HT22 cells (Figure 2A). Caspase‐3, a key component of the apoptotic machinery, cleaves a broad spectrum of cellular target proteins leading to cell death (Mi et al., 2003). Therefore, we also examined the inhibitory effects of butein on glutamate‐induced caspase‐3 activity in HT22 cells. HT22 cells were pretreated with butein (1, 2, 5 and 10 μM) for 12 h and then treated with 5 mM glutamate for 24 h. A colorimetric assay confirmed the increased caspase‐3 activity in glutamate‐treated HT22 cells, but in the groups pretreated with butein a dose‐dependent decrease in caspase‐3 activity was observed (Figure 2B). To determine the molecular mechanisms of glutamate‐induced apoptosis, we tested the expression of the apoptotic proteins Bcl‐2 and Bcl‐xL in HT22 cells. Figure 2C and D show that glutamate reduced the expression of Bcl‐2 and Bcl‐xL. However, pretreatment with butein for 12 h dose‐dependently increased the expression of Bcl‐2 and Bcl‐xL in glutamate‐treated HT22 cells (Figure 2C and 2D).

Figure 2.

Figure 2

Open in a new tab

Effects of butein on glutamate‐induced DNA fragmentation (A), caspase‐3 activity (B), Bcl‐2 expression (C) and Bcl‐xL expression (D) in HT22 cells. HT22 cells were pretreated with the indicated concentrations of butein (1–10 μM) for 12 h and then treated with glutamate (5 mM) for 12 h. (A) After treatment with glutamate and butein, the cells were harvested and pelleted by centrifugation at 200 × g for 10 min. Cytoplasmic DNA fragments were isolated with a Cellular DNA fragmentation elisa kit according to the manufacturer's instructions. (B) Caspase‐3 activity was measured by a colorimetric assay. (C, D) Western blot analyses of protein expression were performed. Data are presented as mean ± SEM (n = 5). * P < 0.05 versus untreated control. # P < 0.05 versus groups treated with glutamate.

Effects of butein on the production of pro‐inflammatory mediators and expression of pro‐inflammatory proteins through the NF‐κB pathway in BV2 microglia stimulated with LPS

Next, we tested the effects of butein on microglia stimulated with LPS to investigate the effects of butein on neuroinflammatory conditions in BV2 microglia. Butein inhibited IL‐1β production and mRNA expression (Figure 3A and D), IL‐6 production and mRNA expression (Figure 3B and E) and TNF‐α production and mRNA expression (Figure 3C and F) in a dose‐dependent manner. In addition, pretreatment of LPS‐stimulated BV2 cells with butein for 12 h decreased NO and PGE2 production and iNOS and COX‐2 expression (Figure 4) in a dose‐dependent manner.

Figure 3.

Figure 3

Open in a new tab

Effects of butein on LPS‐induced production of pro‐inflammatory cytokines (A–C) and mRNA expression of pro‐inflammatory cytokines (D–F) in BV2 microglia. (A–F) BV2 microglia were pretreated with the indicated concentrations of butein (1–10 μM) for 12 h and then treated with LPS (500 ng·mL−1) for 24 h. IL‐1β (A), IL‐6 (B) and TNF‐α (C) mRNA expression levels were determined by real‐time PCR. Western blot analyses of protein expression were performed. The culture media were collected, and the concentrations of IL‐1β (D), IL‐6 (E) and TNF‐α (F) were determined using elisa kits. Data are presented as mean ± SEM (n = 6). * P < 0.05 versus untreated control. # P < 0.05 versus groups treated with LPS.

Figure 4.

Figure 4

Open in a new tab

Effects of butein on LPS‐induced production (A, B) and expression (C, D) of pro‐inflammatory mediators through the NF‐κB pathway (E‐H) in BV2 microglia. (A‐H) BV2 microglia were pretreated with the indicated concentrations of butein (1–10 μM) for 12 h and then treated with LPS (500 ng·mL−1) for 24 h (A–D) or 20 min (E–H). (A) The culture media were collected, and the concentration of PGE2 was determined using an elisa kit. (B) The nitrite present in the conditioned medium was determined using a method based on the Griess reaction. (C–F) Western blot analyses of protein expression were performed. (G) A commercially available NF‐κB elisa was used to test nuclear extracts and determine the degree of NF‐κB binding. Data are presented as mean ± SEM (n = 6). * P < 0.05 versus untreated control. # P < 0.05 versus groups treated with LPS.

To elucidate the specific mechanisms underlying the suppression of pro‐inflammatory enzymes and mediators by butein, we examined the effects of butein on IκB‐α phosphorylation and degradation. In the cytoplasm of cells, IκB‐α is an inhibitor that associates with NF‐κB. Western blot analysis showed that butein inhibited the LPS‐induced IκB‐α phosphorylation and degradation in the cytoplasm of BV2 microglia (Figure 4F). IκB‐α was degraded in BV2 microglia after treatment with LPS for 1 h, and this degradation was significantly decreased by butein. Moreover, the levels of nuclear p65 and p50 proteins in BV2 microglia increased after treatment with LPS for 1 h, whereas the levels of p65 and p50 declined after treatment with LPS following pretreatment with butein for 12 h (Figure 4E). Similar nuclear p65 results were observed by immunofluorescence microscopy (Figure 4H). Analogous effects of butein on NF‐κB DNA‐binding activity were also observed in BV2 microglia (Figure 4G). These findings indicate that the anti‐inflammatory effect of butein is associated with the suppression NF‐κB activation.

Effects of butein on Nrf2 nuclear translocation and Nrf2/ARE‐mediated HO1 induction in HT22 cells and BV2 microglia

We next examined whether butein affects HO1 protein in HT22 cells and BV2 microglia. Butein significantly increased the expression of the HO1 protein in both HT22 cells and BV2 microglia (Figure 5A and B). In addition, butein increased HO1 mRNA expression in HT22 cells and BV2 microglia (Figure 5C and D). Nrf2 is a key upstream modulator of the induction of HO1 (Alam et al., 1999). Therefore, we investigated whether treatment with butein would induce Nrf2 translocation to nuclei in both HT22 cells and BV2 microglia. From the Nrf2 levels in the nuclear fraction of butein‐treated HT22 cells and BV2 microglia, it was shown that butein induced a gradual increase in the translocation of Nrf2 into the nuclei (Figure 6A and E). Similar results were observed using immunofluorescence microscopy in both HT22 cells and BV2 microglia (Figure 6D and H). In addition, the reporter assay showed that butein dose‐dependently increased ARE‐driven luciferase activity in HT22 cells and BV2 microglia (Figure 6C and G), and this activation of ARE was powerfully associated with the increase in HO1 expression (Figure 5). Moreover, the function of Nrf2 in the regulation of HO1 induced by butein was studied using siRNA against Nrf2. HT22 cells and BV2 microglia were transiently transfected with Nrf2 siRNA and treated with butein for 12 h (HO1) or 120 min (nuclear Nrf2). The transfected Nrf2 siRNA cells completely obstructed the Nrf2 nuclear translocation, and abolished butein‐induced HO1 expression in both HT22 cells and BV2 microglia.

Figure 5.

Figure 5

Open in a new tab

Effects of butein on HO‐1 protein (A, B) and mRNA (C, D) expression in HT22 cells and BV2 microglia. (A–D) HT22 cells and BV2 microglia were incubated with the indicated concentrations of butein (1–10 μM) for 12 h. (A, B) Western blot analyses of protein expression were performed. (C, D) HO1 mRNA expression levels were determined by real‐time PCR. Data are presented as mean ± SEM (n = 6). * P < 0.05 versus untreated control. # P < 0.05 versus groups treated with LPS. CoPP was used as the positive control.

Figure 6.

Figure 6

Open in a new tab

Effects of butein on nuclear translocation of Nrf2 (A, D, E, H), ARE activation (C, G) and Nrf2‐mediated HO1 expression (B, F) in HT22 cells and BV2 microglia. HT22 cells (A–D) and BV2 microglia (E–H) were treated with butein (10 μM) for 30, 60 and 120 min. Nuclei were separated from the cytosol using PER‐Mammalian Protein Extraction buffer. HT22 cells (B) and BV2 microglia (F) were transiently transfected with Nrf2 siRNA and then treated with butein (10 μM) for 12 h (HO1) or 120 min (nuclear Nrf2). (A, B, E, F) Western blot analyses of protein expression were performed. (C, G) Quiescent cells transiently transfected with ARE‐luciferase or control vector were incubated for 1 h with the indicated concentrations of butein in the presence of 5% FBS. Cell lysates were assayed for luciferase activity measured as the fold induction by normalizing the transfection efficiency and dividing values of each experiment relative to the control. Data are presented as mean ± SEM (n = 5). * P < 0.05 versus untreated control.

Effects of butein‐induced HO1 expression in glutamate‐stimulated HT22 cells and LPS‐stimulated BV2 microglia

To confirm that pre‐incubation with butein significantly suppressed LPS‐induced neuroinflammation through the NF‐κB signalling pathway (Figures 3 and 4), and that this effect was correlated with Nrf2‐mediated HO1 expression (Figure 5), we investigated whether this effect of butein was reversed by pretreatment with SnPP, an HO1 inhibitor (Figure 7). BV2 microglia were pretreated in the absence or presence of SnPP or butein, followed by stimulation with LPS for 24 h. SnPP treatment reversed the inhibitory action of butein on PGE2, NO, IL‐1β, IL‐6 and TNF‐α production and NF‐κB DNA‐binding activity. In addition, the effect of butein on HO1 expression and on inhibition of pro‐inflammatory mediators was studied using siRNA against HO1. BV2 microglia were transiently transfected with HO1 siRNA and treated with butein followed by LPS. The treatment with SnPP and transfection of HO1 siRNA fractionally reversed the inhibitory effects of butein on PGE2, NO, IL‐1β, IL‐6 and TNF‐α production and NF‐κB DNA‐binding activity (Figure 7A‐F). These results confirm the hypothesis that HO1 induction contributes to the inhibitory effects of butein on the expression of pro‐inflammatory proteins and production of pro‐inflammatory mediators. In addition, we examined whether butein‐induced HO1 expression mediated its protective action. HT22 cells were co‐treated in the absence or presence of butein, SnPP or HO1 siRNA. SnPP and HO1 siRNA significantly inhibited the butein‐mediated cytoprotection (Figure 7G). Butein‐induced HO1 expression was also required for inhibition of ROS generation (Figure 7H).

Figure 7.

Figure 7

Open in a new tab

Effects of butein are mediated through the HO1 expression pathway (A–H) on glutamate‐induced oxidative neurotoxicity (G) and ROS generation (H) and LPS‐induced pro‐inflammatory mediators and cytokine production (A–F) in HT22 cells and BV2 microglia. BV2 microglia and HT22 cells were treated with butein (10 μM) in the presence or absence of SnPP IX (50 μM) and HO‐1 siRNA and then exposed to LPS for 24 h (A–E), 20 min (F) or glutamate for 12 h (G, H). (A, C, D, E) The culture media were collected and the concentrations of PGE2 (A), IL‐1β (C), IL‐6 (D) and TNF‐α (E) were determined using elisa kits. (B) The nitrite present in the conditioned medium was determined using a method based on the Griess reaction. (F) A commercially available NF‐κB elisa was used to test nuclear extracts and determine the degree of NF‐κB binding. Data are presented as mean ± SEM (n = 6). * P < 0.05.

Effects of butein‐induced HO1 expression are mediated through the PI3K/Akt pathway in HT22 cells and BV2 microglia

PI3K activation is involved in the up‐regulation of HO1 induced by natural phytochemicals (Martin et al., 2004). Accordingly, we tested whether butein‐induced HO1 expression occurs via the activation of PI3K. To correlate Akt activation with HO1 expression induced by butein, we investigated Akt phosphorylation in both HT22 cells and BV2 microglia. Akt was phosphorylated from 15 to 60 min but phosphorylation declined slowly thereafter in HT22 cells and BV2 microglia (Figure 8A and D). Moreover, pretreatment with LY294002, a PI3K pathway inhibitor, abolished butein‐induced cytoprotection (Figure 8B) in HT22 cells. Pretreating BV2 microglia with LY294002 (PI3K specific inhibitor) reversed the inhibitory effects of butein on NO production (Figure 8E). We also tested whether PI3K/Akt signalling is intimately linked to butein‐induced activation of Nrf2 or HO1 expression. LY294002 inhibited butein‐induced HO1 expression and Nrf2 nuclear translocation in HT22 and BV2 microglia (Figure 8C and F), suggesting that Nrf2‐mediated HO1 up‐regulation by butein is closely associated with the PI3K/Akt signalling pathway in both HT22 cells and BV2 microglia.

Figure 8.

Figure 8

Open in a new tab

Effects of butein‐induced HO1 expression and Nrf2 translocation are mediated through the PI3K/Akt cascade in HT22 cells (A–C) and BV2 microglia (D–F). HT22 cells (A) and BV2 microglia (D) were treated with butein (10 μM) for the indicated times. HT22 cells untreated or treated with butein (10 μM) in the presence or absence of LY294002 (10 μM) for 3 h were exposed to glutamate for 12 h (B), or BV2 microglia were exposed to LPS for 24 h (E). HT22 cells (C) and BV2 microglia (F) were treated with LY294002 for 3 h and then with butein (10 μM) for 12 h (HO‐1) or 120 min (nuclear Nrf2). Data are presented as mean ± SEM (n = 5). * P < 0.05 versus untreated control (A, D). * P < 0.05 (B, E).

Effects of butein on BV2 microglia‐mediated neurotoxicity

As activated microglia exert neurotoxic effects by releasing pro‐inflammatory enzymes and mediators (Block et al., 2007), we investigated whether inhibiting microglial activation with butein protected dopaminergic neurons. As shown in Figure 9, when conditioned media from LPS‐stimulated BV2 microglia were added to cultured HT22 cells, neuron death, as measured by the MTT assay, increased significantly after 48 h. However, pretreatment of BV2 cells with butein prior to LPS stimulation and adding conditioned media to dopaminergic neurons significantly reduced neuron death in a concentration‐dependent manner, demonstrating the neuroprotective effects of butein. The conditioned media from LPS‐stimulated BV2 microglia also increased ROS production, and butein effectively suppressed this increase (Figure 9B).

Figure 9.

Figure 9

Open in a new tab

Effects of butein on microglia‐mediated neurotoxicity (A, C) and ROS production (B) in HT22 cells. (A–C) HT22 cells were treated with conditioned media from BV2 microglia exposed to LPS (500 ng·mL−1) for 48 h with or without butein pretreatment. Data are presented as mean ± SEM (n = 5). * P < 0.05 versus untreated control. # P < 0.05 versus group with conditioned media from BV2 microglia.

Effects of butein on glutamate‐induced cell damage and ROS generation is mediated through HO1 expression pathway in primary mouse hippocampal neurons

Next, we investigated whether the effect of butein‐mediated HO1 expression protected primary mouse hippocampal neurons. As shown in Figure 10, treatment with glutamate for 24 h decreased the viability of primary mouse hippocampal neurons compared with that of untreated neurons, but butein increased cell survival (Figure 10A). Glutamate also increased ROS production in these neurons, whereas butein effectively suppressed this increase (Figure 10B). In addition, the neuroprotective effect of the increase in HO1 expression induced by butein was studied using SnPP treatment. SnPP reversed the inhibitory effects of butein on neurotoxicity (Figure 10A) and ROS production (Figure 10B) in primary mouse hippocampal neurons. Butein also increased HO1 expression in primary mouse hippocampal neurons.

Figure 10.

Figure 10

Open in a new tab

Effects of butein on glutamate‐induced cytotoxicity (A), inhibition of ROS generation (B) and the expression of HO1 (C) in primary mouse hippocampal neurons. (A, B) The primary mouse hippocampal neurons were treated with butein (5 or 10 μM) in the presence or absence of SnPP IX (50 μM) and then exposed to glutamate (1 mM) for 24 h. (C) The primary mouse hippocampal neurons were incubated with the indicated concentrations of butein for 12 h. Western blot analyses of protein expression were performed. Data are presented as mean ± SEM (n = 5). * P < 0.5 versus untreated control. # P < 0.05 versus groups treated with glutamate. $ P < 0.05 versus group treated with butein + glutamate. CoPP was used as the positive control.

Discussion and conclusions

Regulating the degree of generation of neuronal oxidative stress and activation of microglia by up‐regulating HO1 is an important intervention when formulating a strategy to treat neurological diseases. As part of ongoing research, we demonstrated that the natural chemical butein, which up‐regulates the expression of HO1 in vitro, significantly increases HO1 expression via the Nrf‐2/Akt pathway in HT22 cells and BV2 microglia. Butein inhibited glutamate‐induced mouse hippocampal HT22 cell death and the LPS‐induced neuroinflammatory response and our results indicate that the underlying mechanism may involve in changes in NF‐κB, HO1, Nrf‐2 and Akt signalling.

A number of diseases that injure the CNS are induced by neuronal oxidative stress and neuro‐inflammation in brain tissues (Hald and Lotharius, 2005). Various oxidants are produced as by‐products of normal aerobic cell metabolism, and ROS levels are particularly high in patients with neurodegenerative diseases. In addition, inflammatory processes in the CNS are also believed to play a pivotal role in neuronal cell damage in neurodegenerative disorders. Glutamate induces death of neurons through both non‐receptor‐initiated oxidative toxicity and receptor‐mediated excitotoxicity (Lipton, 2007). In the present study, butein markedly reduced glutamate‐induced HT22 cell death and ROS production (Figure 1). In addition to ROS production, glutamate‐induced oxidative injury of neurons has also been ascribed to an increase in calcium influx, which can lead to mitochondrial dysfunction and apoptosis and result in cell death (Kumar et al., 2012). Caspase‐3 is a key component in the apoptotic machinery that cleaves a broad spectrum of cellular target proteins leading to cell death (Mi et al., 2003). Bcl‐2 and Bcl‐xL, as anti‐apoptotic proteins, play crucial roles in the regulation of apoptosis. Pretreatment with butein reduced the amount of fragmented DNA and caspase‐3 activity induced by glutamate and also increased Bcl‐2 and Bcl‐xL protein expression in HT22 cells and protected these cells from glutamate‐induced apoptosis (Figure 2).

Microglia are the brain's macrophages and comprise 10–20% of all cells in the CNS. Microglia play key roles in immune defence and tissue repair (Bocchini et al., 1992). Activation of BV2 microglial cells leads to the release of inflammatory mediators, such as ROS, NO, arachidonic acid metabolites, TNFs and ILs (Boje and Arora, 1992). NF‐кB (originally called the p50‐p65 heterodimer) is a core mediator of the immune response (Connelly et al., 2001). Our results show that butein inhibits the increase in iNOS, COX‐2, IL‐1β, IL‐6, TNF‐α, NO and PGE2 induced through the NF‐κB signalling pathway (Figures 3 and 4) in BV2 microglia, suggesting that butein has potent anti‐neuroinflammatory properties.

HO1 expression is highly inducible in various cell types including neurons. HO1 is affiliated to the heat–shock protein family. It protects mammalian cells from oxidative stress‐related cell damage by degrading toxic haem into CO, biliverdin and free iron. HO1 and its by‐products appear to play a leading role in various cytoprotective mechanisms (Morse and Choi, 2002; Lee et al., 2006). HO1 also has a cytoprotective effect against glutamate‐stimulated oxidative HT22 cell damage (Rőssler et al., 2004). The anti‐neuroinflammatory action of HO1 in microglia is due to its ability to regulate NF‐κB signalling, which is essential for haem degradation and is an important component of the cell inflammatory mechanism (Otterbein et al., 2003; Lim et al., 2005; Min et al., 2008). Nrf2 translocation regulates the expression of many detoxifying and antioxidant genes and belongs to the Cap‐n‐Collar family along with Nrf1 and Nrf3. When cells are subjected to a variety of inflammatory conditions and oxidative environmental stressors, they commonly respond by modifying genes encoding a set of detoxifying phase II enzymes; this response is mainly associated with the activation of transcription factors, such as Nrf2 (Copple et al., 2008). Exposing cells to naturally occurring antioxidants with acceptors of the Michael‐reaction obstructs the Keap1‐Nrf2 complex; free Nrf2 binds to ARE in the nucleus and activates the transcription of the associated genes (Itoh et al., 1997). The Nrf2 transcription factor plays a leading role in the ARE‐mediated induction of phase II detoxifying enzymes and activation of inducible genes, such as HO1, catalase, glutathione (GSH), glutathione‐S‐transferase, glutathione reductase, glutathione peroxidase, superoxide dismutase and γ‐glutamyl cysteine ligase (Balogun et al., 2003). Therefore, inhibiting the generation of oxidative stress by up‐regulating Nrf2‐mediated HO1 expression is a pivotal intervention when formulating a strategy to treat neurological diseases. We found that butein effectively increased HO1 protein and mRNA expression in HT22 cells and BV2 microglia by up‐regulating the Nrf2/ARE signalling pathway (Figure 5). In addition, butein increase the levels of Nrf2 in the nucleus and ARE activation in HT22 cells and BV2 microglia (Figure 6). Experiments with the HO inhibitor, SnPP and HO1 siRNA indicated that the expression of HO1 evoked by butein was positively associated with cytoprotective effects in mouse hippocampal HT22 cells and the anti‐neuroinflammatory actions in BV2 microglia (Figure 7).

PI3K/Akt signalling responds to oxidative stimulation by modulating various intracellular downstream signalling events including apoptosis, cell growth and differentiation (Manning and Cantley, 2007). In addition, PI3K promotes neuronal cell survival by activating Akt phosphorylation and Nrf2 nuclear translocation (Enomoto et al., 2001; Narasimhan et al., 2011). We found that activating the PI3K/Akt pathway was involved in butein‐induced cytoprotective effects in HT22 cells and anti‐neuroinflammatory actions in BV2 microglia. In our study, butein increased Akt phosphorylation, and the PI3K pathway inhibitor (LY294002) abolished butein‐induced cytoprotection and NO inhibition. Consistent with these findings, we showed that Nrf2/ARE‐mediated HO1 expression through the activation of PI3K/Akt signaling is involved in butein‐mediated cytoprotective effects and anti‐neuroinflammatory actions in HT22 cells and BV2 microglia (Figure 8).

Phagocytosis is a crucial mechanism used to eliminate cell debris or pathogens in neuropathological conditions occurring in microglia, and activated microglia trigger phagocytic activity. One study has suggested that activated microglia exert neurotoxic effects by releasing pro‐inflammatory mediators (Block et al., 2007). In addition, several studies have suggested that activated microglia evoke a neurotoxic action by releasing pro‐inflammatory enzymes and mediators (Park et al., 2011; Dutta et al., 2012; Lee and Jeong, 2014; Park et al., 2014). Therefore, we used mouse hippocampal HT22 cells as a neuronal model system to investigate the protective effects of butein on LPS‐induced toxicity in BV2 microglia. When conditioned media from LPS‐stimulated microglia were added to cultured HT22 cells, cell viability decreased, but pretreatment with butein significantly decreased neuronal cell death, demonstrating the neuroprotective effects of butein. The conditioned media from LPS‐stimulated BV2 microglia also increased ROS production, and butein effectively suppressed this effect (Figure 9). We also checked whether butein‐mediated HO1 expression protected primary mouse hippocampal neurons; it had a significant neuroprotective effect and inhibited ROS generation by up‐regulating HO1 expression in glutamate‐induced primary mouse hippocampal neurons (Figure 10). Many sites are available for flavonoids to interact with key molecular pathways. The most important flavonoid active site is the B‐ring catechol group capable of readily donating hydrogen electrons to stabilize radical species (Rice‐Evans et al., 1996). The B‐ring catechol group is able to chelate transition metal ions including iron and copper (Bors et al., 2001). In addition, flavonoids increase phase II enzymes by activating Nrf2, by possibly involving an upstream effect on PI3K/Akt signalling (Agullo et al., 1997). Flavonoid metabolites, such as butein, have electrophilic activity and covalently bind to GSH and DNA (van der Woude et al., 2006). The effects of flavonoid, such as butein, at these signalling or active sites may be beneficial for treating neuronal diseases. Therefore, our results clearly suggest that butein‐mediated HO1 expression, induced via Nrf2 activation, is involved in its neuroprotective action.

In conclusion, our results suggest that butein effectively prevents glutamate‐induced HT22 cell oxidative damage and LPS‐induced activation of BV2 microglia, and the induction of HO1 evoked by butein through the activation of the PI3K/Akt and Nrf2 signalling pathways appears to play a pivotal role in this effect on HT22 cells and BV2 microglia. We only investigated the effects of butein on microglia‐stimulated inflammatory conditions as regards neuronal cell damage and ROS generation, but we did not test the specific mechanisms of its effects on the interaction between neurons and microglia. Based on our results, these two different effects of butein may be mediated by independent pathways. Nevertheless, our results provide insights into the mechanisms underlying butein‐induced neurocytoprotection and its anti‐inflammatory effects, which were mediated by the upregulation of Nrf2‐induced HO1 expression and suggest possible strategies for its neuroprotective action. Our results provide evidence for the beneficial role of butein in neuroprotection. We also suggest that specific mechanisms of interaction between neurons and microglia are an option for improving the therapeutic efficacy of butein.

Author contributions

D.S.L. performed the experiments and wrote the manuscript; G.S.J. designed the study and contributed to the writing of the manuscript.

Conflict of interest

The authors declare no conflicts of interest.

Declaration of transparency and scientific rigour

This Declaration acknowledges that this paper adheres to the principles for transparent reporting and scientific rigour of preclinical research recommended by funding agencies, publishers and other organisations engaged with supporting research.

Acknowledgements

This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. NRF‐2016R1A6A1A03011325).

Lee, D. ‐S. , and Jeong, G. ‐S. (2016) Butein provides neuroprotective and anti‐neuroinflammatory effects through Nrf2/ARE‐dependent haem oxygenase 1 expression by activating the PI3K/Akt pathway. British Journal of Pharmacology, 173: 2894–2909. doi: 10.1111/bph.13569.

References

  1. Agullo G, Gamet‐Payrastre L, Manenti S, Viala C, Remesy C, Chap H et al (1997). Relationship between flavonoid structure and inhibition of phosphatidylinositol 3‐kinase: a comparison with tyrosine kinase and protein kinase C inhibition. Biochem Pharmacol 53: 1649–1657. [DOI] [PubMed] [Google Scholar]
  2. Alam J, Stewart D, Touchard C, Bionapally S, Choi AM, Cook JL (1999). Nrf2, a Cap'n'Collar transcription factor, regulates induction of the heme oxygenase‐1 gene. J Biol Chem 274: 26071–26078. [DOI] [PubMed] [Google Scholar]
  3. Alexander SPH, Kelly E, Marrion N, Peters JA, Benson HE, Faccenda E et al. (2015a). The Concise Guide to PHARMACOLOGY 2015/16: Overview. Br J Pharmacol 172: 5729–5143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Alexander SPH, Fabbro D, Kelly E, Marrion N, Peters JA, Benson HE et al. (2015b). The Concise Guide to PHARMACOLOGY 2015/16: Enzymes. Br J Pharmacol 172: 6024–6109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Balogun E, Hoque M, Gong P, Killeen E, Green CJ, Foresti R et al. (2003). Curcumin activates the heme oxygenase‐1 gene via regulation of Nrf2 and the antioxidant‐responsive element. Biochem J 371: 887–895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Blasi E, Barluzzi R, Bocchini V, Mazzolla R, Bistoni F (1990). Immortalization of murine microglial cells by a v‐raf/v‐myc carrying retrovirus. J Neuroimmunol 27: 229–237. [DOI] [PubMed] [Google Scholar]
  7. Block ML, Zecca L, Hong JS (2007). Microglia‐mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 8: 57–69. [DOI] [PubMed] [Google Scholar]
  8. Bocchini V, Mazzolla R, Barluzzi R, Blasi E, Sick P, Kettenmann H (1992). An immortalized cell line expresses properties of activated microglial cells. J Neurosci Res 31: 616–621. [DOI] [PubMed] [Google Scholar]
  9. Boje KM, Arora PK (1992). Microglial‐produced nitric oxide and reactive nitrogen oxides mediate neuronal cell death. Brain Res 587: 250–256. [DOI] [PubMed] [Google Scholar]
  10. Bors W, Michel C, Stettmaier K (2001). Structure‐activity relationships governing antioxidant capacities of plant polyphenols. Methods Enzymol 335: 166–180. [DOI] [PubMed] [Google Scholar]
  11. Chan SC, Chang YS, Wang JP, Chen SC, Kuo SC (1998). Three new flavonoids and antiallergic, anti‐inflammatory constituents from the heartwood of Dalbergia odorifera . Planta Med 64: 153–158. [DOI] [PubMed] [Google Scholar]
  12. Chao CC, Hu S, Molitor TW, Shaskan EG, Peterson PK (1992). Activated microglia mediate neuronal cell injury via a nitric oxide mechanism. J Neurosci Res 149: 2736–2741. [PubMed] [Google Scholar]
  13. Chen K, Gunter K, Maines MD (2000). Neurons overexpressing heme oxygenase‐1 resist oxidative stress‐mediated cell death. J Neurochem 75: 304–313. [DOI] [PubMed] [Google Scholar]
  14. Cho N, Choi JH, Yang H, Jeong EJ, Lee KY, Kim YC et al. (2012). Neuroprotective and anti‐inflammatory effects of flavonoids isolated from Rhus verniciflua in neuronal HT22 and microglial BV2 cell lines. Food Chem Toxicol 50: 1940–1945. [DOI] [PubMed] [Google Scholar]
  15. Cho N, Lee KY, Huh J, Choi JH, Yang H, Jeong EJ et al. (2013). Cognitive‐enhancing effects of Rhus verniciflua bark extract and its active flavonoids with neuroprotective and anti‐inflammatory activities. Food Chem Toxicol 58: 355–361. [DOI] [PubMed] [Google Scholar]
  16. Connelly L, Palacios‐Callender M, Ameixa C, Moncada S, Hobbs AJ (2001). Biphasic regulation of NF‐κB activity underlies the pro‐ and anti‐inflammatory actions of nitric oxide. J Immunol 166: 3873–3881. [DOI] [PubMed] [Google Scholar]
  17. Copple IM, Goldring CE, Kitteringham NR, Park BK (2008). The Nrf2‐Keap1 defence pathway: role in protection against drug‐induced toxicity. Toxicology 246: 24–33. [DOI] [PubMed] [Google Scholar]
  18. Curtis MJ, Bond RA, Spina D, Ahluwalia A, Alexander SP, Giembycz MA et al. (2015). Experimental design and analysis and their reporting: new guidance for publication in BJP. Br J Pharmacol 172: 3461–3471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. de Vries HE, Witte M, Hondius D, Rozemuller AJ, Drukarch B, Hoozemans J et al. (2008). Nrf2‐induced antioxidant protection: a promising target to counteract ROS‐mediated damage in neurodegenerative disease? Free Radic Biol Med 45: 1375–1383. [DOI] [PubMed] [Google Scholar]
  20. Dutta G, Barber DS, Zhang P, Doperalski NJ, Liu B (2012). Involvement of dopaminergic neuronal cystatin C in neuronal injury‐induced microglial activation and neurotoxicity. J Neurochem 122: 752–763. [DOI] [PubMed] [Google Scholar]
  21. Enomoto A, Itoh K, Nagayoshi E, Haruta J, Kimura T, O'Connor T et al. (2001). High sensitivity of Nrf2 knockout mice to acetaminophen hepatotoxicity associated with decreased expression of ARE‐regulated drug metabolizing enzymes and antioxidant genes. Toxicol Sci 59: 169–177. [DOI] [PubMed] [Google Scholar]
  22. Fiebich BL, Lieb K, Engels S, Heinrich M (2002). Inhibition of LPS‐induced p42/44 MAP kinase activation and iNOS/NO synthesis by parthenolide in rat primary microglial cells. J Neuroimmunol 132: 18–24. [DOI] [PubMed] [Google Scholar]
  23. Gonzalez‐Scarano F, Baltuch G (1999). Microglia as mediators of inflammatory and degenerative diseases. Annu Rev Neurosci 22: 219–240. [DOI] [PubMed] [Google Scholar]
  24. Hald A, Lotharius J (2005). Oxidative stress and inflammation in Parkinson's disease: is there a causal link? Exp Neurol 193: 279–290. [DOI] [PubMed] [Google Scholar]
  25. Itoh K, Chiba T, Takahashi S, Ishii T, Igarashi K, Katoh Y et al. (1997). An Nrf2/small Maf heterodimer mediates the induction of phase II detoxifying enzyme genes through antioxidant response elements. Biochem Biophys Res Commun 236: 313–322. [DOI] [PubMed] [Google Scholar]
  26. Iwashita K, Kobori M, Yamaki K, Tsushida T (2000). Flavonoids inhibit cell growth and induce apoptosis in B16 melanoma 4A5 cells. Biosci Biotechnol Biochem 64: 1813–1820. [DOI] [PubMed] [Google Scholar]
  27. Jeong GS, An RB, Pae HO, Chung HT, Yoon KH, Kang DG et al. (2008). Cudratricusxanthone A protects mouse hippocampal cells against glutamate‐induced neurotoxicity via the induction of heme oxygenase‐1. Planta Med 74: 1368–1373. [DOI] [PubMed] [Google Scholar]
  28. Jeong YH, Hyun JW, Kim Van Le T, Kim DH, Kim HS (2013). Kalopanaxsaponin A exerts anti‐inflammatory effects in lipopolysaccharide‐stimulated microglia via inhibition of JNK and NF‐kappaB/AP‐1 pathways. Biomol Ther 21: 332–337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kang DG, Lee AS, Mun YJ, Woo WH, Kim YC, Sohn EJ et al. (2004). Butein ameliorates renal concentrating ability in cisplatin‐induced acute renal failure in rats. Biol Pharm Bull 27: 366–370. [DOI] [PubMed] [Google Scholar]
  30. Kim NY, Pae HO, Oh GS, Kang TH, Kim YC, Rhew HY et al. (2001). Butein, a plant polyphenol, induces apoptosis concomitant with increased caspase‐3 activity, decreased Bcl‐2 expression and increased Bax expression in HL‐60 cells. Pharmacol Toxicol 88: 261–266. [DOI] [PubMed] [Google Scholar]
  31. Kumar S, Kain V, Sitasawad SL (2012). High glucose‐induced Ca2 + overload and oxidative stress contribute to apoptosis of cardiac cells through mitochondrial dependent and independent pathways. Biochim Biophys Acta 1820: 907–920. [DOI] [PubMed] [Google Scholar]
  32. Le WD, Xie WJ, Appel SH (1999). Protective role of heme oxygenase‐1 in oxidative stress‐induced neuronal injury. J Neurosci Res 56: 652–658. [DOI] [PubMed] [Google Scholar]
  33. Lee DS, Jeong GS (2014). Arylbenzofuran isolated from Dalbergia odorifera suppresses lipopolysaccharide‐induced mouse BV2 microglial cell activation, which protects mouse hippocampal HT22 cells death from neuroinflammation‐mediated toxicity. Eur J Pharmacol 728: 1–8. [DOI] [PubMed] [Google Scholar]
  34. Lee KH, Huang ES, Piandosi C, Pagano J, Geissman TA (1971). Cytotoxicity of sesquiterpene lactones. Cancer Res 31: 1649–1654. [PubMed] [Google Scholar]
  35. Lee BS, Heo JH, Kim YM, Shim SM, Pae HO, Kim YM et al. (2006). Carbon monoxide mediates heme oxygenase 1 induction via Nrf2 activation in hepatoma cells. Biochem Biophys Res Commun 343: 965–972. [DOI] [PubMed] [Google Scholar]
  36. Lim SS, Jung SH, Ji J, Shin KH, Keum SR (2001). Synthesis of flavonoids and their effects on aldose reductase and sorbitol accumulation in streptozotocin‐induced diabetic rat tissues. J Pharm Pharmacol 53: 653–668. [DOI] [PubMed] [Google Scholar]
  37. Lim CS, Jin DQ, Mol H, Oh SJ, Lee JU, Hwang JK et al. (2005). Antioxidant and anti‐inflammatory activities of xanthorrhizol in hippocampal neurons and primary cultured microglia. J Neurosci Res 82: 831–838. [DOI] [PubMed] [Google Scholar]
  38. Lipton SA (2007). Pathologically activated therapeutics for neuroprotection. Nat Rev Neurosci 8: 803–808. [DOI] [PubMed] [Google Scholar]
  39. Maher P, Davis JB (1996). The role of monoamine metabolism in oxidative glutamate toxicity. J Neurosci 16: 6394–6401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Manning BD, Cantley LC (2007). AKT/PKB signaling: Navigating downstream. Cell 129: 1261–1274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Martin D, Rojo AI, Salinas M, Diaz R, Gallardo G, Alam J et al. (2004). Regulation of heme oxygenase‐1 expression through the phosphatidylinositol 3′‐kinase/Akt pathway and the Nrf2 transcription factor in response to the antioxidant phytochemical carnosol. J Biol Chem 279: 8919–8929. [DOI] [PubMed] [Google Scholar]
  42. Meda L, Cassatella MA, Szendrei GI, Otvos L, Baron P Jr, Villalba M et al. (1995). Activation of microglial cells by β‐amyloid protein and interferon‐γ. Nature 374: 647–650. [DOI] [PubMed] [Google Scholar]
  43. Mi Y, Thomas SD, Xu X, Casson LK, Miller DM, Bates PJ (2003). Apoptosis in leukemia cells is accompanied by alterations in the levels and localization of nucleolin. J Biol Chem 278: 8572–8579. [DOI] [PubMed] [Google Scholar]
  44. Min KJ, Kim JH, Jou I, Jeo EH (2008). Adenosine induces hemeoxygenase‐1 expression in microglia through the activation of phosphatidylinositol 3‐kinase and nuclear factor E2‐related factor 2. Glia 56: 1028–1037. [DOI] [PubMed] [Google Scholar]
  45. Morse D, Choi AM (2002). Heme oxygenase‐1: the “emerging molecule” has arrived. Am J Respir Cell Mol Biol 27: 8–16. [DOI] [PubMed] [Google Scholar]
  46. Narasimhan M, Mahimainathan L, Rathinam ML, Riar AK, Henderson GI (2011). Overexpression of Nrf2 protects cerebral cortical neurons from ethanol induced apoptotic death. Mol Pharmacol 80: 988–999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Otterbein LE, Bach FH, Alam J, Soares M, Tao L, Wysk M et al. (2000). Carbon monoxide has anti‐inflammatory effects involving the mitogen‐activated protein kinase pathway. Nat Med 6: 422–428. [DOI] [PubMed] [Google Scholar]
  48. Otterbein LE, Soares MP, Yamashita K, Bach FH (2003). Heme oxygenase‐1: unleashing the protective properties of heme. Trends Immunol 24: 449–455. [DOI] [PubMed] [Google Scholar]
  49. Panahian N, Yoshiura M, Maines MD (1999). Overexpression of heme oxygenase‐1 is neuroprotective in a model of permanent middle cerebral artery occlusion in transgenic mice. J Neurochem 72: 1187–1203. [DOI] [PubMed] [Google Scholar]
  50. Pappolla MA, Chyan YJ, Omar RA, Hsiao K, Perry G, Smith MA et al. (1998). Evidence of oxidative stress and in vivo neurotoxicity of beta‐amyloid in a transgenic mouse model of Alzheimer's disease: a chronic oxidative paradigm for testing antioxidant therapies in vivo . Am J Pathol 152: 871–877. [PMC free article] [PubMed] [Google Scholar]
  51. Park SE, Sapkota K, Kim S, Kim H, Kim SJ (2011). Kaempferol acts through mitogen‐activated protein kinases and protein kinase B/AKT to elicit protection in a model of neuroinflammation in BV2 microglial cells. Br J Pharmacol 164: 1008–1025. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Park SY, Bae YS, Ko MJ, Lee SJ, Choi YW (2014). Comparison of anti‐inflammatory potential of four different dibenzocyclooctadiene lignans in microglia; action via activation of PKA and Nrf‐2 signaling and inhibition of MAPK/STAT/NF‐κB pathways. Mol Nutr Food Res 58: 738–748. [DOI] [PubMed] [Google Scholar]
  53. Qiang W, Cahill JM, Liu J, Kuang X, Liu N, Scofield VL et al. (2004). Activation of transcription factor Nrf‐2 and its downstream targets in response to moloney murine leukemia virus ts1‐induced thiol depletion and oxidative stress in astrocytes. J Virol 78: 11926–11938. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Rice‐Evans CA, Miller NJ, Paganga G (1996). Structure‐antioxidant activity relationships of flavonoids and phenolic acids. Free Radic Biol Med 20: 933–956. [DOI] [PubMed] [Google Scholar]
  55. Rőssler OG, Bauer I, Chung HY, Thiel G (2004). Glutamate‐induced cell death of immortalized murine hippocampal neurons: neuroprotective activity of heme oxygenase‐1, heat shock protein 70, and sodium selenite. Neurosci Lett 362: 253–257. [DOI] [PubMed] [Google Scholar]
  56. Sogawa S, Nihro Y, Ueda H, Miki T (1994). Protective effects of hydroxychalcones on free radical‐induced cell damage. Biol Pharm Bull 17: 251–256. [DOI] [PubMed] [Google Scholar]
  57. Southan C, Sharman JL, Benson HE, Faccenda E, Pawson AJ, Alexander SP et al. (2016). The IUPHAR/BPS Guide to PHARMACOLOGY in 2016: towards curated quantitative interactions between 1300 protein targets and 6000 ligands. Nucleic Acids Res. 44: D1054–D1068. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Streit WJ, Mrak RE, Griffin WST (2004). Microglia and neuroinflammation: a pathological perspective. J Neuroinflammation 1: 1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Suh GY, Jin Y, Yi AK, Wang XM, Choi AM (2006). CCAAT/enhancer‐binding protein mediates carbon monoxide‐induced suppression of cyclooxygenase‐2. Am J Respir Cell Mol Biol 35: 220–226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Takeda A, Perry G, Abraham NG, Dwyer BE, Kutty RK, Laitinen JT et al. (2000). Overexpression of heme oxygenase in neuronal cells, the possible interaction with Tau. J Biol Chem 275: 5395–5399. [DOI] [PubMed] [Google Scholar]
  61. van der Woude H, Boersma MG, Alink GM, Vervoort J, Rietjens IM (2006). Consequences of quercetin methylation for its covalent glutathione and DNA adduct formation. Chem Biol Interact 160: 193–203. [DOI] [PubMed] [Google Scholar]
  62. Vila M, Jackson‐Lewis V, Guegan C, Wu DC, Teismann P, Choi DK et al. (2001). The role of glial cells in Parkinson's disease. Curr Opin Neurol 14: 483–489. [DOI] [PubMed] [Google Scholar]
  63. Wang MJ, Lin WW, Chen HL, Chang YH, Ou HC, Kuo JS et al. (2002). Silymarin protects dopaminergic neurons against lipopolysaccharide‐induced neurotoxicity by inhibiting microglia activation. Eur J Neurosci 16: 2103–2112. [DOI] [PubMed] [Google Scholar]
  64. Yang EB, Guo YJ, Zhang K, Chen YZ, Mack P (2001). Inhibition of epidermal growth factor receptor tyrosine kinase by chalcone derivatives. Biochim Biophys Acta 1550: 144–152. [DOI] [PubMed] [Google Scholar]
  65. Yu SM, Cheng ZJ, Kuo SC (1995). Endothelium‐dependent relaxation of rat aorta by butein, a novel cyclic AMP‐specific phosphodiesterase inhibitor. Eur J Pharmacol 280: 69–77. [DOI] [PubMed] [Google Scholar]
  66. Zhang K, Yang EB, Tang WY, Wong KP, Mack P (1997). Inhibition of glutathione reductase by plant polyphenols. Biochem Pharmacol 54: 1047–1053. [DOI] [PubMed] [Google Scholar]

Articles from British Journal of Pharmacology are provided here courtesy of The British Pharmacological Society

RESOURCES