Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Oct 10.
Published in final edited form as: Eur J Immunol. 2009 Jan;39(1):178–191. doi: 10.1002/eji.200838389

Photodynamic vaccination of hamsters with inducible suicidal mutants of Leishmania amazonensis elicits immunity against visceral leishmaniasis

Shraddha Kumari 1, Mukesh Samant 1, Prashant Khare 1, Pragya Misra 1, Sujoy Dutta 3, Bala Krishna Kolli 3, Sharad Sharma 2, Kwang Poo Chang 3, Anuradha Dube 1,*
PMCID: PMC5056643  NIHMSID: NIHMS138325  PMID: 19053149

Abstract

Leishmania, naturally residing in the phagolysosomes of macrophages, is a suitable carrier for vaccine delivery. Genetic complementation of these trypanosomatid protozoa to partially rectify their defective heme-biosynthesis renders them inducible with δ-aminolevulinate to develop porphyria for selective photolysis, leaving infected host-cells unscathed. Delivery of released “vaccines” to antigen-presenting cells is thus expected to enhance immune response, while their self-destruction presents added advantages of safety. Such suicidal-L. amazonensis was found to confer immunoprophylaxis and immunotherapy on hamsters against L. donovani. Neither heat-killed nor live parasites without suicidal induction were effective. Photodynamic vaccination of hamsters with the suicidal-mutants reduced the parasite loads by 99% and suppressed the development of disease. These suppressions were accompanied by an increase in Leishmania-specific delayed-type hypersensitivity and lymphoproliferation as well as in the levels of splenic iNOS, IFN-γ and IL-12 expressions and of Leishmania-specific IgG2 in the serum. Moreover, a single intravenous administration of T-cells from vaccinated hamsters was shown to confer on naïve animals an effective cellular immunity against L. donovani challenges. The absence of lesion development at vaccination sites and parasites in the draining lymphnodes, spleen and liver further indicates that the suicidal mutants provide a safe platform for vaccine delivery against experimental visceral leishmaniasis.

Keywords: Porphyrinogenic mutant, suicidal vaccination, visceral leishmaniasis, T-cell adoptive transfer

Introduction

World Health Organization (WHO) considers leishmaniasis to be one of the most serious, epidemic-prone parasitic diseases of the poor and disadvantaged. An estimated 350 million people are at risk of Leishmania infection worldwide with ~1.5 million new cases of cutaneous leishmaniasis (CL) and 500,000 cases of visceral leishmaniasis (VL) reported each year. Recent epidemics of VL or kala-azar in Sudan and India have resulted in over 100,000 deaths [1]. With the advent of the HIV epidemics, VL has emerged as an important opportunistic infection in AIDS patients [2, 3]. In India, high incidence of kala-azar has been reported from the states of Bihar, Assam, West Bengal and Eastern Uttar Pradesh. A recent survey in Bihar has recorded an alarming 100,000 cases, of which 10,000 are unresponsive to antimonials. The numerous relapses due to the increasing incidence of drug resistance are also associated with the toxic antileishmanial drugs in use [4]. Hence, the development of an effective vaccine becomes all the more urgent in the absence of suitable antileishmanial drugs to control this disease.

Effective vaccines for VL require their activity to elicit cell-mediated immunity (CMI) capable of activating macrophages to a microbicidal state [5]. Further, it is desirable to have a suitable animal model for human kala-azar adequate for realistic evaluation of vaccine safety and efficacy. Golden hamster (Mesocricetus auratus) is the best animal model of human VL in having the same clinico-pathological features, including a relentless increase in visceral parasitic burdens, progressive cachexia, hepatosplenomegaly, pancytopenia, hypergammaglobulinemia and ultimately death [6, 7].

Several vaccination strategies using live, killed and defined vaccines have been attempted with particular emphasis on their efficacy against CL instead of VL [3]. The only successful immunization strategy in humans has been the “leishmanization”, which is based on the development of durable immunity after recovery from infection at a chosen site, usually the arm, with viable nonattenuated parasites [8, 9]. The use of live vaccines is very promising since they most closely mimic the natural course of infection and, therefore, may elicit similarly effective immunity after cure. However, its use has been restricted or abandoned entirely due to the safety concerns. Nevertheless, WHO/Tropical Disease Research (WHO/TDR) has very recently revived the consideration of using live, but genetically attenuated vaccines [10]. Other potentially usable live vaccines include Leishmania administered at a low dose [11], drug-attenuated Leishmania [12], recombinant Leishmania expressing cytokines [13] or suicide markers [14] and parasites with CpG-oligodeoxynucleotide motifs [15]. However, these experimental vaccines have yet to reach the clinical trial stage. While each of them produced some level of protective efficacy, the completeness and longevity of this protection has not been clearly demonstrated. Hence, no effective vaccine currently exists against any form of human leishmaniasis.

Recently, a xenotransgenic L. amazonensis was constructed by a novel suicidal design, which was predicted to effect its specific and selective destruction in infected macrophages [16]. This inducible suicidal mutant was produced transgenically to partially rectify its natural defects in heme biosynthesis. The second and third enzymes (ALAD: δ-aminolevulinate dehydratase, PBGD: porphobilinogen deaminase) of the heme-biosynthetic pathway were episomally expressed in Leishmania. This transfectant was thus responsive to δ-aminolevulinate (ALA), the product of the first enzyme in this pathway, for accumulation of photosensitive uroporphyrin. This porphyrin can be excited by light to produce leishmanolytic oxidative species. With a complete heme metabolic pathway, the host-cells only develop a very low level of transient porphyria in response to ALA. This parasite versus host-cell difference in accumulation of porphyrins was exploited to achieve selective photolysis of Leishmania in the phagolysosomes of the antigen presenting cells. The basic principle for using the suicidal mutants as vaccine carriers is that they retain infection-molecules for homing to phagolysosomes, thereby delivering vaccines to the desirable destination. Induction of their photolysis therein achieves not only vaccine release for appropriate processing and presentation but also their self-destruction.

An ideal live vaccine should elicit long-term effective immune responses without undue persistence in the vaccinated host, as safety is an important criterion for the use of live vaccines in humans. The potential utility of the suicidal-mutants as a vaccine candidate was explored here against Indian kala-azar in hamster model. Results obtained demonstrated the efficacy of such photodynamic vaccination. In addition, a long-lasting protective immunity was found to develop by a single-intravenous injection of lymphnode T-cells from porphyrinogenic vaccinated hamsters. This adoptive transfer is capable of protecting naïve hamsters to L. donovani challenges.

Results

Absence of cutaneous lesion and amastigotes in porphyrinogenic vaccinated hamsters

The site of vaccination was inspected in all groups for evidence of any cutaneous lesions - a characteristic of CL. The lesions of 0.3–0.65 cm in diameter appeared at the site of injection after three weeks of vaccination, but only in animals of the control nonporphyrinogenic groups, viz. DT−ALA and ST+ALA (see Materials and Methods for these and other abbreviations). In contrast, porphyrinogenic (DT+ALA) produced no visible lesion throughout the experiment period till day 180 post-challenges (p.c.), indicative of an excellent safety margin. This was further confirmed by histopathological studies of the skin in separate groups of hamsters 3 weeks after vaccination (Fig. 1). In skin sections of porphyrinogenic vaccinated animals, only uninfected macrophages were observed without inflammatory cell infiltrates (Fig. 1, A–B). In contrast, the control groups, i. e. DT−ALA and ST+ALA, produced lesions, which clearly resulted from inflammatory responses due to cell infiltrates, consisting mainly of lymphocytes, plasma cells and Leishmania-infected macrophages (Fig. 1 C–F). No infected cells were seen in histological sections of spleens, livers and lymphnodes from DT+ALA hamsters.. Cultures of tissues from the cutaneous sites of vaccination, their draining lymphnodes, spleens and livers yielded no promastigotes after incubation for 1 month at 26°C, providing further evidence for the absence of detectable parasites in these animals.

Figure 1. Histopathology of the skin of hamsters vaccinated with transgenic L. amazonensis.

Figure 1

Open in a new tab

Tissues were collected three weeks post-vaccination from hamsters immunized with DT+ALA (A–B), DT−ALA (C–D) and ST+ALA (E–F). Sections were processed and stained with H&E; micrographs taken under 40X and 100X objectives shown in the Left panel (A, C, E) and the right panel (B, D, F), respectively. Note: the normal microarchitecture of the skin (A) and the absence of amastigote-infected macrophages (B) in the porphyrinogenic DT+ALA vaccinated hamsters; inflammatory responses due to cell infiltration of the skin (C, E) and abundant vacuolated macrophages containing Leishmania-amastigotes (D, F circles and arrows) in non-porphyrinogenic DT−ALA and ST+ALA vaccinated hamsters.

Vaccination with porphyrinogenic L. amazonensis induced optimum protection against L. donovani challenges

The porphyrinogenic-mutant (DT+ALA) vaccinated hamsters were protected from the challenge infection of L. donovani, as indicated by their weight gain with time, like non-vaccinated and non-challenged group (Fig. 2A solid bar versus blank bar) in contrast to the significant weight loss (p<0.001), of all the control groups, i. e. infected, ALA, ST+ALA, DT−ALA (Bars in between the solid and the blank bars). Hepatosplenomegaly, normally associated with the challenge infection, was absent in the porphyrinogenic vaccinated group (Fig.2B and C, Solid bar). This phenotype was evident, albeit much less pronounced in the beginning, in the two groups vaccinated with nonporphyrinogenic controls, indicative of their ineffective protection (Fig. 2B–C, Stippled & Hatched bars). Parasite loads were positively correlated with splenomegaly and hepatomegaly observed among different groups: an increase from ~103 to >104 in all the groups, except the porphyrinogenic vaccinated groups (Fig. 2D Solid bar versus the rest), as seen in Geimsa-stained splenic smears, from day 45 to day 120 p. c. In this last group, parasite loads decreased from ~2 × 102 on day 45 to a negligible level (p<0.001) of <10 subsequently, rendering them difficult to discern by microscopy (not shown). Similarly, in liver and bone marrow, parasite loads sharply decreased after day 45 p.c. and parasites were essentially absent by day 180 p.c. in the same fully vaccinated group in contrast to all the control groups (Fig. 2E and F Solid bars versus the rest). Cultivation of the spleen, liver and lymphnode tissues from the fully vaccinated hamsters in vitro yielded no promastigotes after prolonged incubation for 3 weeks.

Figure 2. Photodynamic vaccination of hamsters with suicidal L. amazonensis protects them against visceral leishmaniasis.

Figure 2

Open in a new tab

Shown are body weights (A), organ weights (B, C) (gm) and parasite burdens in spleen (D), liver (E) and bone marrow (F) of vaccinated hamsters, i.e. DT+ALA, DT−ALA, ST+ALA and non-vaccinated controls, i.e. untreated/non-challenged (Normal), untreated/challenged (Infected) and ALA alone/challenged (ALA). Parasite loads were determined as the number of amastigotes/103 cell nuclei microscopically enumerated in Geimsa-stained tissue impression smears. Each bar represents pooled data (mean ± SD) from three independent experiments (10-15 hamsters per group). ***p<0.001 and **p<0.01 compared with respective normal (A–C) or infected (D–F) controls.

Porphyrinogenic-L.amazonensis (DT+ALA) vaccinated hamsters survived the challenges of L. donovani and remained healthy thereafter until the termination of the experiment 6 months p. c. In contrast, hamsters vaccinated with nonporphyrinogenic mutants, i. e. DT−ALA or ST+ALA survived for only 3-4 months, while all those untreated or treated with ALA alone died of kala-azar within ~2 months.

Immunization of hamsters with killed DT mutants under the same vaccination conditions gave only limited prophylactic efficacy. This was demonstrated in a separate set of experiments, in which 3 groups of hamsters at 5 males each were vaccinated for comparison with autoclaved DT, DT+ALA and DT−ALA, respectively. Evaluation of splenic amastigote loads 45 days p. c. showed parasite suppression of 95%, 43% and 31% for DT+ALA, DT−ALA and killed DT, respectively. Photodynamic vaccination with live DT+ALA was shown again to give the most complete protection that is unmatched by either live DT alone or killed DT. Since the killed mutants were least effective, they were not included for further investigation.

Porphyrinogenic vaccination stimulates Delayed-Type Hypersensitivity (DTH), mitogenic and Leishmania specific cellular responses

Porphyrinogenic and nonporphyrinogenic immunizations elicited different CMI, as determined by assessing the DTH and lymphoblast proliferation responses to specific and/or non-specific antigens in these hamsters after L. donovani challenges at different time periods. Porphyrinogenic vaccinated hamsters displayed significant DTH response, which increased progressively throughout the entire p. c. period (Fig. 3A, DT+ALA) and reached the levels that were significantly higher than those of the control groups (P<0.001) at all time points for the duration of the experiments for up to 180 days. The DTH response increased in the non-porphyric control groups (DT−ALA; ST+ALA), but this increase was rather modest.

Figure 3. Cellular and humoral immune responses of photodynamically vaccinated hamsters.

Figure 3

Open in a new tab

These were assessed at the same time points from the same groups of hamsters, as described in the legend to Fig. 2.

Shown are DTH response (mm) to SLD as footpad swelling at 24 hr (A) and lymphoproliferative response (SI) of lymphnode cells to Con A (B) and SLD (C). NO production (μg/ml) of macrophages measured in samples (see text) by the absorbance of the reaction products at 540 nm using Greiss reagent (D); Antileishmanial IgG levels (OD) (E) and its isotypes, i. e. IgG1 (F) and IgG2 (G), determined by ELISA. Each bar represents the pooled data (mean ± SD) of three independent experiments each with 10 to 15 hamsters. ***p<0.001 compared with respective normal group.

In vitro stimulation of the lymphocytes with Concanavalin A (Con A) showed comparable proliferative response at high levels in all the groups when assayed before challenges (Fig. 3B, day 0). Con A induced lymphoproliferative response remained elevated in porphyrinogenic vaccinated animals as much as those of the normal hamsters throughout the entire p. c. period (Fig. 3B Normal and DT+ALA bars), but it decreased precipitously with time in all the other control groups (Bars between Normal and DT+ALA). In SLD specific re-stimulation assays, lymphoproliferative response was negative for all groups on pre-vaccination day 0 (Fig. 3C, Blank bars) and for the non-vaccinated control groups throughout the p.c. period (Normal, Infected and ALA). Cells from porphyrinogenic vaccinated hamsters produced significantly higher response (p<0.001), which reached almost to the maximum on day 45 post-vaccination and increased further thereafter (Fig. 3C, DT+ALA). In contrast, those from non-porphyrinogenic vaccinated hamsters registered only a slight increase of this response on day 45 post-vaccination, but declined almost to the baseline level thereafter on day 120 shortly before their death (ST+ALA and DT−ALA).

Lymphocyte-mediated activation of macrophages to produce NO for leishmanicidal activities was found to differ between control and experimental groups of hamsters. Macrophages isolated from naïve hamsters were exposed to the supernatants of SLD-stimulated lymphocytes from these animals. Porphyrinogenic vaccinated group was found to elicit significantly higher level (p<0.001) of NO, which increased with the p.c. periods up to day 180 (Fig. 3D DT+ALA). Non-porphyrinogenic controls (Fig. 3D ST+ALA, DT−ALA) elicited a modest increase of NO production, which was seen only on day 45 p.c. and declined gradually thereafter to the baseline levels, as observed in the other control groups (Normal, Infected control, ALA).

Porphyrinogenic vaccination alters Leishmania specific IgG and its isotypes

The serum levels of leishmanial antigen specific IgG and its isotypes (IgG1 & IgG2) from all groups were assessed by ELISA. The anti-Leishmania IgG and IgG1 were elevated progressively with time to a high level in all groups, except the porphyrinogenic, in which case they remained essentially the background levels of the non-immunized and unchallenged normal (Fig. 3 E–F). In contrast, the porphyrinogenic (DT+ALA) was the only group (Fig. 3G), which showed a significant elevation by 1- to 2-fold over the others (p<0.001) in the level of IgG2. As a measure of CMI, the elevation of IgG2 is consistent with the development of effective immune response.

Porphyrogenic vaccination of hamsters elicit cytokine transcript profiles of protective response

Impairment of CMI response during active VL is reflected by marked T cell anergy specific to Leishmania antigens [17, 18]. Since optimum protective efficacy was observed in porphyrinogenic vaccinated hamsters, the expression of Th1 and Th2 cytokines was evaluated only in this group for comparison with infected and normal control groups. A comparative RNA cytokine profile of splenocytes, analyzed on days 45, 60, 120 and 180 p.c. (Fig. 4), showed that among the three groups of hamsters, expression of IFN-γ and IL-12 transcripts was significantly higher in vaccinated group than infected groups (P<0.001) (Fig.4A). These and iNOS transcripts were all elevated by 3-4 folds after vaccination (Fig.4B). The expression levels of Th1 suppressive cytokines, i. e. TGF-β, IL-10 and IL-4 were upregulated in infected group, but not in porphyrinogenic vaccinated hamsters throughout the p. c. periods from days 45 to 180 (Fig.4B).

Figure 4. Th1/Th2 cytokine and iNOS mRNAs in protected porphyrogenic L. amazonensis vaccinated hamsters.

Figure 4

Open in a new tab

(A) Splenic iNOS and cytokine mRNA expression profile analysis of normal, infected and porphyrogenic vaccinated hamsters challenged with L. donovani (DD8). Spleens of hamsters were analysed on day 45, 60, 120 and 180 p.c. for RT-PCR. Experiments were carried out in triplicate for each of the three representative hamsters from individual experimental groups. (B) Densitometry analysis of the data in (A) showing the relative mean % change in iNOS and cytokine mRNA expression ± SD normalized against control (HGPRT). The differences between various groups are significant, as indicated (**p<0.01 and ***p<0.001 compared with respective infected control).

Adoptive transfer of T-cells from porphyrinogenic vaccinated group protects naïve hamsters against L. donovani challenges by generating specific-cell mediated immune response

Protection of hamsters against L. donovani challenges by porphyrinogenic vaccination (Fig. 1–2) was unequivocally confirmed by adoptive transfer of T-lymphocytes from immunized animals to naïve hamsters (Fig. 5 DT+ALA/R). The recipients of immune T-cells were observed to gain as much weight as the normal hamsters, both groups being 2-3 times heavier than the animals in the group, which received no T-cells, but challenged with L. donovani (Fig. 5A LD/R). In the protected group (DT+ALA/R), hepatosplenomegaly was totally absent throughout the entire p. c. period; parasite loads were significantly suppressed in all visceral organs from days 45 to 180, i. e. a decrease by >1 log in the spleen and to negligible levels in the liver and bone marrow. (Fig.5D–F). All the hamsters in this group survived and remained healthy for 1 year when the experiment was terminated. On the other hand, the animals receiving cells from non-vaccinated, but infected hamsters (LD/R) developed visceral disease and died of the challenging infection in ~2 months. Although some nonporphyrinogenic control groups were precluded from this study due to their death, the results obtained provide significant evidence, indicating that the protective immunity elicited by photodynamic vaccination is transferable and thus long lasting.

Figure 5. Protection of naïve hamsters by adoptive transfer of lymphnode cells from immunized animals.

Figure 5

Open in a new tab

Shown are body weights (A), organ weights (B, C) (gm) and parasite burdens in spleen (D), liver (E) and bone marrow (F) of the recipient hamsters, i.e. DT+ALA/R, LD/R, No/(−)R and normal animals determined on different p. c. days as shown. See text and the legend to Fig. 2 for the assessment of parasite burdens. Each bar represents pooled data (mean ± SD) from three independent experiments (10-15 hamsters per group). ***p<0.001 compared with respective normal (A–C) or infected control (D–F).

The transfer of protective immunity from vaccinated animals to the recipients was indicated by their cellular responses (Fig. 6 A–D, DT+ALA/R), which were significantly higher than those of the control groups (P<0.001), i. e. DTH, lymphoproliferative responses and NO production against SLD throughout the p. c. periods from day 0 to day 180.

Figure 6. Cellular and humoral immune responses of naïve hamsters after adoptive transfer of lymphnode cells from immunized animals.

Figure 6

Open in a new tab

See text for DT+ALA/R, LD/R, No/(−)R and normal animals. See text and the legends to Fig. 3 for experimental conditions for DTH, NO, lymphoproliferative and antibody assessments. ***p<0.001 compared with respective normal group.

As expected, while the Leishmania-specific IgG and IgG1 were of the background levels in the DT+ALA/R group, its IgG2 level became increasingly elevated with the p. c. periods; the reverse was observed in all the control groups, e. g. LD/R (Fig.6 E–G). There was significant up-regulation of iNOS, IFN-γ and IL-12, concomitant with down-regulation of Th2 cytokines (IL-10, IL-4 and TGF-β) (P<0.001) in DT+ALA/R versus the infected control groups (Fig.7). All these findings corroborate our earlier results with porphyrinogenic vaccination (Fig. 4).

Figure 7. Th1/Th2 cytokine and iNOS mRNAs of hamsters adoptively transferred with lymphnode cells from porphyrogenic L. amazonensis vaccinated hamsters.

Figure 7

Open in a new tab

See legend to Fig. 5 for group designation. See text and the legend to Fig. 4 for experimental and other details. (A) Splenic iNOS and cytokine mRNA expression profiles; (B) Densitometric analyses of data in part A, as described in the legend to Fig. 4.

(**p<0.01 and ***p<0.001 compared with respective infected control).

Discussion

Mildly virulent Leishmania (from the lesions of diseased patients) have been used for centuries to vaccinate children (known as “leishmanization”) with proven effectiveness for immunoprophylaxis against human simple CL – a disease known to heal spontaneously, resulting in the development of life-long immunity [19]. “Leishmanization” becomes more feasible for consideration, with the advances in Leishmania molecular genetics to knockout virulence genes or to express transgenic suicidal genes [20–24]. In the present study, a transgenic mutant line of L. amazonensis was demonstrated to have the potential as a suicidal and thus safe vaccine candidate to facilitate antigen presentation, thereby enhancing the magnitude and quality of T-cell immune responses. A single subcutaneous injection of such a mutant was reported here to elicit a protective immune response of hamster against otherwise fatal challenges of L. donovani.

The doubly transgenic-Leishmania used become porphyric only when exposed to ALA [16] - a water soluble inexpensive metabolite which is in clinical use for photodynamic therapy against cancers [25], but not for vaccination using Leishmania in the manner as presented in this study. The closest is the bacterial mutants of Legionella whose DNA repair genes were obliterated, thereby rendering them sensitive to psoralin-dependent and UV-sensitive lysis [26]. The potential use of suicidal Leishmania for live-cell vaccination finds support from previous reports on the immunization of laboratory animals with drug or genetically attenuated mutants for avirulence [22, 27, 28]. A major difference of the present suicidal design from the previous ones is the use of two very different suicidal signals in our model, i.e. ALA and light. Both have long been used clinically for different purposes with excellent margin of safety and therapeutic values. The use of two different signals in combination, although laborious and cumbersome in practice, offers the modality of fine-tuning the strengths and timing to deliver adequate cytolysis of the live vaccines. This is further amenable to further regulation, if necessary, by application of an additional photosensitizer externally [29]. We have found no evidence for “escape” of the live mutants from the “treatment” for cytolysis by leaving the vaccination sites prematurely. This is further preventable in the future by using strictly cutanotropic Leishmania and/or by rendering them porphyric before injection. The suicidal design is thus particularly suitable for assessing challenging parasite “persistence” [27, 30, 31] versus inanimated vaccines, e.g. killed-microorganisms, peptide antigens and cDNAs [3, 32], which may be used in combination or separately for comparison in their ability to elicit memory T-cells for lasting immunity.

An 'ideal' anti-leishmanial vaccine is the one, which can be effective against both CL and VL, considering their co-endemicity in many places. Cross-species protection has been reported previously in experimental leishmaniasis [19, 33, 34]. Here, we demonstrated this for the first time that a suicidal mutant L. amazonensis induces cross-protective immune response against a virulent L. donovani challenge. This suicidal design for photodynamic vaccination makes it possible not only to elicit protective immunity against L. donovani but also to let the live vaccine undergo self-destruction. Although our results demonstrated the utility of the mutants for eliciting protection against leishmaniasis, they have the potential to serve more universally as a platform to receive add-on vaccines for immunization against other infectious and non-infectious diseases.

Another important feature of the suicidal vaccine is its excellent safety margin. No parasites were directly demonstrable by microscopic observations of relevant tissues and by their cultivation after “vaccination” for weeks, accounting apparently for the absence of inflammatory response and cutaneous lesion development at the injection sites, as noted during the subsequent observations for up to 180 days. The inoculated mutants were either lysed completely or reduced by the suicidal design to a number insufficient to produce lesions. Notably, the same mutants used as non-suicidal controls produced lesions of considerable size, i.e. up to ~0.7 cm in diameter.

All hamsters in the porphyrinogenic vaccination group remained viable and healthy, whereas those in the nonporphyrinogenic groups succumbed to kala-azar after challenges with L. donovani. Disease regression in porphyrinogenic vaccinated animals is correlated with the strong DTH response seen after challenging infection which was absent in unvaccinated and L. donovani infected hamsters. Effective immunity elicited in this vaccine model clearly results from the development of strong cell mediated immunological, cytokine responses [35–37]. Lymphocytes from porphyrinogenic vaccinated hamsters in response to SLD was found to mediate an increased production of NO by macrophages, that may further up-regulate their production of IFN-γ [38]. This is consistent with the critical role of NO-mediated macrophage effector mechanism, which is known to control parasite replication in this animal model [36]. The protection of hamsters by porphyrinogenic vaccination against L. donovani challenges is clearly associated predominantly with a Th1-cytokine response, as indicated by the up-regulation of iNOS, IFN-γ and IL-12, concomitant with the down-regulation of TGF-β, IL-4 and IL-10. The reverse is otherwise the case in L. donovani infection alone. This is expected, since it is known that IL-12 is a strong inducer of IFN-γ production and plays a major role in the development of the Th1 immune response to control the infection in experimental leishmaniasis [39, 40], whereas IL-10 and TGF-β antagonize Th1-cytokine synthesis and inhibit macrophage activation necessary for killing intracellular parasites [37, 41]. The significance of IL-10 in the pathogenesis of human VL is supported by the observations that it down-regulates parasite-specific T-cell responses [42] and inhibits NO production of human macrophages to kill L. infantum [43]. These observations corroborate our data presented here, indicating that the progressive disease in this kala-azar model is associated with a defect in the generation of NO.

Apart from diminished cellular responses, VL is associated with the production of high levels of antibodies, which have been observed prior to detection of parasite specific T-cell response [44]. Unlike mice where IL-4 and IL-12 direct IgG subclass switching of IgG1 and IgG2a, respectively, such distinct IgG classes remain obscure in hamsters [45, 46]. It is believed that hamster IgG1 and IgG2 correspond to mouse IgG1 and IgG2a/IgG2b, respectively. It has been well-established that IgG and IgG1 antibodies increase in titre with the L. donovani loads [47]. The virtual absence of these antibodies is thus consistent with the decreasing parasite loads seen in porphyrinogenic vaccinated group. The significant increase in the IgG2 levels only in porphyrinogenic vaccinated animals is indicative of enhanced CMI.

Protective immunity can be passively transferred to naive recipients with T-cell enriched preparations from donor animals that have resolved infection [48]. Evidence obtained in human and in experimental murine leishmaniasis indicates that the healing of cutaneous lesions is associated with the development of specific T-cell dependent cellular response [49, 50], the role of which has been further established by experiments showing that resistance to infection was achieved by the transfer of syngeneic immune T-lymphocytes [51]. Adoptive-transfer of the splenocytes from immunized animals has been shown previously to achieve a certain level of protection against L. donovani infection [52–54]. Successful protection was achieved in the present study by a single-intravenous administration of T-cells from porphyrinogenic vaccinated hamsters, conferring an effective control of infection on hamsters against L. donovani challenges, as indicated both at the level of restricting parasite loads and induction of protective cellular responses. In animals of the DT+ALA/R group, indeed, the virtual absence of parasites on day 180 p.c. is accompanied by a strong induction of favorable immune parameters, i. e. antigen-specific T-cell proliferation, production of NO, increased mRNA expression of iNOS, IL-12, IFN-γ, robust DTH responses and low antibody titers. Clearly, donor T-cells are skewed toward a protective Th1-type response, indicative of durable immunity. Interestingly, the overall protective and immunological profiles are more pronounced in DT+ALA/R group than the porphyrinogenic vaccinated ones. Thus, passive transfer of immunity in the absence of parasites may favor the development of central memory T-cells for long-lasting protection.

Evidence presented in this study clearly indicates that the porphyrinogenically lysed L. amazonensis after delivery in vivo is protective against experimental VL. Worthy of emphasis are two major findings. Firstly, porphyrinogenic L. amazonensis appears to be a promising live candidate vector for development of an effective vaccine against Leishmania infections. Secondly, transfer of T-cells from effectively immunized animals alone, in the absence of parasites, to the naïve animals protects the latter with robust and lasting immunity, suggestive of the development of central memory T-cells. It will be highly advantageous to obtain such lasting immunity against VL by using porphyrinogenic mutants from strictly cutaneous Leishmania, as their residence in the skin makes them readily accessible to suicidal induction.

The work presented offers a new avenue for photodynamic immuno-prophylaxis and -therapy of other infectious diseases [16]. Further studies may be envisaged to simplify the applications, for example, by one-time administration of the mutants followed by inducing their porphyria using commercially available ALA ointment and photolysis with bandaged LED (heatless light emitting diodes).

Materials & Methods

Animal

Laboratory bred male golden hamsters (Mesocricetus auratus, 45–50 gm) from the Institute's animal facility were used as the experimental host. They were housed in climatically controlled room and fed with standard rodent food pellet (Lipton India Ltd, Bombay) and water ad libitum. The usage of the animals was approved by the institute's animal ethical committee.

Parasites

Leishmania donovani

Wild type (MHOM/IN/80/DD8) has been maintained by amastigote to amastigote serial passages every ~2 months in hamsters. The parasites were isolated and purified from the spleen of infected hamsters for challenging infection.

For the preparation of SLD, promastigotes were grown in L-15 medium (Sigma, USA) for 3-4 days and processed as before [55]. The protein content of the SLD was estimated [56] and stored at -70°C.

Leishmania amazonensis mutants

The construction, selection and maintenance of L. amazonensis nonporphyrinogenic-single transfectants (ST) and porphyrinogenic-double transfectants (DT), used for vaccination, were described elsewhere [16]. Briefly, Wild type L. amazonensis (LV78) promastigotes (clone 12–1) were grown at 25 °C in Medium 199 HEPES-buffered to pH 7.4 and supplemented with 10% heat-inactivated fetal bovine serum. Transfectants were grown under similar conditions with different concentrations of selective pressures, i.e. G418 and/or tunicamycin at 100 ug/ml and/or 20 ug/ml, respectively. Cultures were grown for 1-cycle in drug-free medium before use. These mutants (109 cells/ml) were also heat-killed by autoclaving for 15 minutes and used in a separate set of experiments for comparison of their prophylactic potentials with porphyrinogenic and non-porphyrinogenic cells.

Vaccination with transgenic-L. amazonensis in hamsters

In three separate experiments, hamsters were vaccinated on the back on shaved areas to facilitate their exposure to white light illumination from the top after ALA treatment (20 μl of 100 mM ALA in Hank's Balanced Salt Solution, pH 7.4) to induce specific uroporphyria of intracellular transgenic Leishmania. A total of 90 hamsters were divided into six groups at 10-15 per group. Hamsters of the main experimental group or porphyrinogenic vaccinated group (DT+ALA) were each vaccinated first with DT and then administered with ALA 2-3 days later. The hamsters of second group (DT-ALA) were vaccinated with DT without ALA and those of the third group were given ST (single-transfectants) and ALA (ST+ALA) similarly as described for the first group. The hamsters of the fourth group were treated with ALA alone and those of the fifth were kept as unvaccinated control. All animals in above-mentioned 5 groups were challenged with L. donovani amastigotes as described [38]. The sixth and the last group comprised of unvaccinated and unchallenged control animals. The second and third groups were designated as the nonporphyrinogenic control groups. The experimental schedules for vaccination are given in Table-1.

Table-1.

Experimental schedules for vaccination

Step Day (p.v./p.c.) Group Treatment
1 0 1–3 Intradermal inoculation of a shaved area (~2 cm2) on the back of the animals, with porphyrinogenic DT, non-porphyrinogenic ST and heat-killed DT (1.0–1.5 × 107 cells/100 μl each), respectively.
4–6 No vaccination controls
2 4–8 p.v. 1, 3 & 4 ALA administration 4 times daily to the vaccination site of each animal for “induction of porphyria” with 20 μl of 100 mM ALA in HBSS, pH 7.4.
2, 5 & 6 No ALA treatment
3 8–12 p.v. 1–6 Illumination of caged animals for ~8 hrs daily × 5 days under white light [Four fluorescent bulbs of 100 W (Phillips) + two florescent tube lights of 40 W] placed 2 ft above the cages, thereby maintaining a constant temperature of 26–27°C.
4 26 p.v. 1–5 Challenge intracardially with 107 DD8 strain of L. donovani amastigotes/animal.
6 No challenge
5 0, 45, 60, 120 & 180 p.c. 1–6 Examination of 2–3 hamsters for pathological, parasitological and immunological evaluation.
Open in a new tab

p.v., post-vaccination; p.c., post-challenge.

For histological studies, five hamsters were “vaccinated” as described for the 1st group and sacrificed three weeks after the vaccination, the skin tissues at the site of injection, draining lymphnodes and spleens were removed for histology sections and assessed microscopically after staining with H & E.

Peritoneal exudates, lymphnodes, spleens and blood were collected from the hamsters of all groups sacrificed at different time points as mentioned in Table-1 to obtain cells and sera for evaluation of cellular and antibody responses. The criterion for prophylactic efficacy included the assessment of parasite loads as the number of amastigotes/103 splenic cell nuclei in Geimsa-stained touch-blots of spleens, livers and bone marrows. The percentage inhibition (PI) was assessed as described elsewhere [38]. Various tissues were also incubated in vitro in NNN tubes with RPMI-1640 as an overlay to assess the presence or absence of viable amastigotes therein based on their conversion into promastigotes.

Adoptive transfer of T-cell immunity from porphyrinogenic vaccinated hamsters

For this experiment, a total of 40–60 hamsters at 10-15 per group were used. The experimental groups were categorized as follows: DT+ALA/R (animals receiving lymphocytes from porphyrinogenic vaccinated group sacrificed on day 180 p.c.); LD/R (animals receiving lymphocytes from non-vaccinated but L. donovani challenged group); No/(−)R (Naïve animals receiving no lymphocytes). Lymphocytes used were isolated from lymphnodes (inguinal and mesenteric) of porphyrinogenic vaccinated (DT+ALA) and/or L. donovani challenged animals (on day 180 p.c.), and the isolated cells (107/100 μl) were suspended in complete RPMI-medium [38]. Hamsters were injected with 107 lymphocytes/animal intracardially and were challenged 21 days later with L. donovani (DD8) amastigotes (107 per animal), except the normal group, which received neither lymphocytes nor L. donovani challenges. Progression of disease and immunological responses were monitored periodically up to 180 days p.c. when the experiment was terminated.

Post challenge survival assessments

Animals of both the experimental and control groups were given proper care and observed for their survival which lasted for more than 12 months p.c. Survival of individual hamsters was recorded and mean survival period was calculated.

Lymphoproliferative assays

Lymphnodes of hamsters were excised aseptically and processed for the isolation of lymphocytes [38]. The lymphocyte were suspended to 106/ml and cultured at 105 cells/well in 96 well flat bottom tissue culture plates (Nunc, Denmark). 100 μl of Con A (10 μg/ml; Sigma) or SLD (10 μg proteins/ml) were added to each well in triplicate. Wells without stimulants served as negative controls. Cultures were incubated at 37°C in a CO2 incubator for 3 days in case of mitogen and for 5 days in case of SLD antigens. Eighteen hours prior to termination of culture, 0.5 μCi of [3H] thymidine (BARC, India) was added to each well and then cells were harvested on glass fibre mats (Whatman); radioactivity counted in a liquid scintillation counter. Results were expressed as stimulation index (SI) which was calculated as mean counts per minute (cpm) of stimulated culture/mean cpm of unstimulated control. SI values of more than 2.5 were considered as positive response.

Nitric oxide (NO) assays

The presence of NO was assessed in the culture supernatants of peritoneal macrophages from naïve hamsters after exposure to the supernatants of stimulated lymphocyte's cultures by using Griess-reagent [57]. Isolated peritoneal macrophages [55] were suspended in culture medium for plating at 106 cells/well and exposed to the supernatants of above-described stimulated lymphocyte's culture supernatants from all the study groups. The supernatants (100 μl) collected from macrophage cultures 24 hrs after incubation were each mixed with an equal volume of Griess-reagent (Sigma, USA) and left for 10 min at room temperature. The absorbance of the reaction products was measured at 540 nm in an ELISA reader [57].

Measurements of delayed type hypersensitivity (DTH)

DTH was performed by injecting intradermally 50 μg/50 μl of SLD in PBS into one footpad and PBS alone into the other footpad of each of the vaccinated and unvaccinated controls. The response was evaluated 24 hr later by measuring the difference in footpad swelling between the two with and without SLD for each animal [45].

RT-PCR of mRNAs for cytokines and inducible NO synthase (iNOS)

RT-PCR was performed to assess the expression of mRNAs for various cytokines and iNOS in splenic cells. Splenic tissues were taken from each of the 3 individual animals randomly chosen from different groups. Total RNAs were isolated using Tri-reagent (Sigma, USA) on days 45, 60, 120 and 180 p.c., and quantified by using Gene-quant [BioRad]. The primer sequences of cytokine and iNOS primers used to amplify their respective cDNA were as described [37] (Table: 2). House keeping HGPRT was used as a control.

Table-2.

Primer sequences for RT-PCR amplification of hamster transcripts

Transcript of Primer sequence (Forward/Reverse) Expected Size (bp)
HGPRT 5' ATCACATTATGGCCCTCTGTG 3' 125
*5' CTGATAAAATCTACAGTYATGG 3'
iNOS 5' GCAGAATGTGACCATCATGG 3' 198
5' CTCGAYCTGGTAGTAGTAGAA 3'
IFN-γ 5' GGATATCTGGAGGAACTGGC 3' 309
5' CGACTCCTTTTCCGCTTCCT 3'
IL-12 5' GTACACCTGYCACAAAGGAG 3' 430
5' GATGTCCCTGATGAAGAAGC 3'
TGF-β 5' CCCTGGAYACCAACTATTGC 3' 310
5' ATGTTGGACARCTGCTCCAC 3'
IL-4 *5' CATTGCATYGTTAGCRTCTC 3' 463
5' TTCCAGGAAGTCTTTCAGTG 3'
IL-10 5' ACAATAACTGCACCCACTTC 3' 432
5' AGGCTTCTATGCAGTTGATG 3'
Open in a new tab
*

Sequences with base degeneracy (Y= C and T; R= A and G).

One μg of total RNA was used for the synthesis of cDNA using first strand cDNA synthesis kit (Fermentas). 0.5 μg of cDNA was amplified by PCR under the following condition: Initial denaturation at 95°C for 2 min followed by 40 cycles, each consisting of denaturation at 95°C for 30 sec, annealing at 55°C for 40 sec and extension at 72°C for 40 sec per cycle. The final extension step was carried out at 72°C for 10 min. RT-PCR products were quantitatively assessed by densitometry of ethidium bromide-stained bands using the software AlphaImager™2200 (Alfainnotech).The mean percentage expression values were presented as the intensities of PCR products relative to those of their corresponding HGPRT.

Determination of Leishmania-specific antileishmanial antibody levels

The levels of antileishmanial antibodies- IgG and its isotypes- IgG1 and IgG2 in sera samples from hamsters of different groups were measured as described [58]. The 96-well ELISA plates (Nunc) were coated in each well with SLD (2 μg/ml in PBS) overnight at 4°C and blocked with 1% BSA at room temperature for 1 h. The optimum dilution of sera was standardized at 1:200 for IgG, and 1:100 for IgG1 and IgG2 respectively for 2 h at room temperature. HRP conjugated goat anti-hamster IgG (H+L) (Serotec, USA) and biotin-conjugated mouse anti-Armenian and anti-Syrian hamster IgG1 (for IgG1) (BD, Pharmingen) as well as mouse anti-Syrian hamster IgG2 (BD, Pharmingen) was added for 1 h at room temperature. IgG1 and IgG2 plates were further incubated with sterptavidin-conjugated peroxidase (Sigma) for 1 h. Finally plates were developed using O-phenylene diamine dihydrochloride as the substrate (Sigma) and the reaction products read at 492 nm in an ELISA reader (BioTek, USA).

Statistical analysis

Results were expressed as mean±SD. The results (pooled data of 3 independent experiments) were analyzed by One-Way ANOVA test and comparisons with control data were made with Dunnett's post test using Graph Pad Prism software program. The upper level of significance was chosen as P<0.001.

Acknowledgements

We expressed our sincere gratitude to the Director CDRI for his keen interest and for providing facilities for the experiments. Financial support for senior research fellowship to SK and MS from CSIR, New Delhi and technical support of S M Verma, division of Toxicology are gratefully acknowledged. This has CDRI communication no 7449. Supported in part by USA-NIH AI-68835 to KPC.

Footnotes

Conflict of interest: The CDRI authors declare no financial or commercial conflict of interest.

References

  • 1.Desjeux P. Leishmaniasis: current situation and new perspectives. Comp Immunol Microbiol Infect Dis. 2004;27:305–318. doi: 10.1016/j.cimid.2004.03.004. [DOI] [PubMed] [Google Scholar]
  • 2.Alvar J, Aparicio P, Aseffa A, Den Boer M, Canavate C, Dedet JP, Gradoni L, Ter Horst R, Lopez-Velez R, Moreno J. The relationship between leishmaniasis and AIDS: the second 10 years. Clin Microbiol Rev. 2008;21:334–359. doi: 10.1128/CMR.00061-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Handman E. Leishmaniasis: current status of vaccine development. Clin Microbiol Rev. 2001;14:229–243. doi: 10.1128/CMR.14.2.229-243.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sundar S. Drug resistance in Indian visceral leishmaniasis. Trop Med Int Health. 2001;6:849–854. doi: 10.1046/j.1365-3156.2001.00778.x. [DOI] [PubMed] [Google Scholar]
  • 5.Reed SG, Scott P. T-cell and cytokine responses in leishmaniasis. Curr Opin Immunol. 1993;5:524–531. doi: 10.1016/0952-7915(93)90033-o. [DOI] [PubMed] [Google Scholar]
  • 6.Melby PC, Tryon VV, Chandrasekar B, Freeman GL. Cloning of Syrian hamster (Mesocricetus auratus) cytokine cDNAs and analysis of cytokine mRNA expression in experimental visceral leishmaniasis. Infect Immun. 1998;66:2135–2142. doi: 10.1128/iai.66.5.2135-2142.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Garg R, Dube A. Animal models for vaccine studies for visceral leishmaniasis. Indian J Med Res. 2006;123:439–454. [PubMed] [Google Scholar]
  • 8.Greenblatt CL. The present and future of vaccination for cutaneous leishmaniasis. Prog Clin Biol Res. 1980;47:259–285. [PubMed] [Google Scholar]
  • 9.Breton M, Tremblay MJ, Ouellette M, Papadopoulou B. Live nonpathogenic parasitic vector as a candidate vaccine against visceral leishmaniasis. Infect Immun. 2005;73:6372–6382. doi: 10.1128/IAI.73.10.6372-6382.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.WHO/TDR . TDR News. 75 Sep, 2005. Coming Back: WHO/TDR initiative to support live attenuated vaccines. [Google Scholar]
  • 11.Bretscher PA, Menon JN, Ogunremi O. Towards a strategy of universally efficacious vaccination against pathogens uniquely susceptible to cell-mediated attack. J Biotechnol. 1996;44:1–4. doi: 10.1016/0168-1656(95)00100-X. [DOI] [PubMed] [Google Scholar]
  • 12.Daneshvar H, Coombs GH, Hagan P, Phillips RS. Leishmania mexicana and Leishmania major: attenuation of wild-type parasites and vaccination with the attenuated lines. J Infect Dis. 2003;187:1662–1668. doi: 10.1086/374783. [DOI] [PubMed] [Google Scholar]
  • 13.Dumas C, Muyombwe A, Roy G, Matte C, Ouellette M, Olivier M, Papadopoulou B. Recombinant Leishmania major secreting biologically active granulocyte-macrophage colony-stimulating factor survives poorly in macrophages in vitro and delays disease development in mice. Infect Immun. 2003;71:6499–6509. doi: 10.1128/IAI.71.11.6499-6509.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Muyombwe A, Olivier M, Harvie P, Bergeron MG, Ouellette M, Papadopoulou B. Protection against Leishmania major challenge infection in mice vaccinated with live recombinant parasites expressing a cytotoxic gene. J Infect Dis. 1998;177:188–195. doi: 10.1086/513821. [DOI] [PubMed] [Google Scholar]
  • 15.Mendez S, Tabbara K, Belkaid Y, Bertholet S, Verthelyi D, Klinman D, Seder RA, Sacks DL. Coinjection with CpG-containing immunostimulatory oligodeoxynucleotides reduces the pathogenicity of a live vaccine against cutaneous Leishmaniasis but maintains its potency and durability. Infect Immun. 2003;71:5121–5129. doi: 10.1128/IAI.71.9.5121-5129.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sah JF, Ito H, Kolli BK, Peterson DA, Sassa S, Chang KP. Genetic rescue of Leishmania deficiency in porphyrin biosynthesis creates mutants suitable for analysis of cellular events in uroporphyria and for photodynamic therapy. J Biol Chem. 2002;277:14902–14909. doi: 10.1074/jbc.M200107200. [DOI] [PubMed] [Google Scholar]
  • 17.Haldar JP, Ghose S, Saha KC, Ghose AC. Cell-mediated immune response in Indian kala-azar and post-kala-azar dermal leishmaniasis. Infect Immun. 1983;42:702–707. doi: 10.1128/iai.42.2.702-707.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gifawesen C, Farrell JP. Comparison of T-cell responses in self-limiting versus progressive visceral Leishmania donovani infections in golden hamsters. Infect Immun. 1989;57:3091–3096. doi: 10.1128/iai.57.10.3091-3096.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kedzierski L, Zhu Y, Handman E. Leishmania vaccines: progress and problems. Parasitology. 2006;133(Suppl):S87–112. doi: 10.1017/S0031182006001831. [DOI] [PubMed] [Google Scholar]
  • 20.Titus RG, Gueiros-Filho FJ, de Freitas LA, Beverley SM. Development of a safe live Leishmania vaccine line by gene replacement. Proc Natl Acad Sci U S A. 1995;92:10267–10271. doi: 10.1073/pnas.92.22.10267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Alexander B, Lozano C, Barker DC, McCann SH, Adler GH. Detection of Leishmania (Viannia) braziliensis complex in wild mammals from Colombian coffee plantations by PCR and DNA hybridization. Acta Trop. 1998;69:41–50. doi: 10.1016/s0001-706x(97)00114-9. [DOI] [PubMed] [Google Scholar]
  • 22.Papadopoulou B, Roy G, Breton M, Kundig C, Dumas C, Fillion I, Singh AK, Olivier M, Ouellette M. Reduced infectivity of a Leishmania donovani biopterin transporter genetic mutant and its use as an attenuated strain for vaccination. Infect Immun. 2002;70:62–68. doi: 10.1128/IAI.70.1.62-68.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Spath GF, Garraway LA, Turco SJ, Beverley SM. The role(s) of lipophosphoglycan (LPG) in the establishment of Leishmania major infections in mammalian hosts. Proc Natl Acad Sci U S A. 2003;100:9536–9541. doi: 10.1073/pnas.1530604100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Spath GF, Lye LF, Segawa H, Sacks DL, Turco SJ, Beverley SM. Persistence without pathology in phosphoglycan-deficient Leishmania major. Science. 2003;301:1241–1243. doi: 10.1126/science.1087499. [DOI] [PubMed] [Google Scholar]
  • 25.Kelty CJ, Brown NJ, Reed MW, Ackroyd R. The use of 5-aminolaevulinic acid as a photosensitiser in photodynamic therapy and photodiagnosis. Photochem Photobiol Sci. 2002;1:158–168. doi: 10.1039/b201027p. [DOI] [PubMed] [Google Scholar]
  • 26.Brockstedt DG, Bahjat KS, Giedlin MA, Liu W, Leong M, Luckett W, Gao Y, Schnupf P, Kapadia D, Castro G, Lim JY, Sampson-Johannes A, Herskovits AA, Stassinopoulos A, Bouwer HG, Hearst JE, Portnoy DA, Cook DN, Dubensky TW., Jr. Killed but metabolically active microbes: a new vaccine paradigm for eliciting effector T-cell responses and protective immunity. Nat Med. 2005;11:853–860. doi: 10.1038/nm1276. [DOI] [PubMed] [Google Scholar]
  • 27.Uzonna JE, Spath GF, Beverley SM, Scott P. Vaccination with phosphoglycan-deficient Leishmania major protects highly susceptible mice from virulent challenge without inducing a strong Th1 response. J Immunol. 2004;172:3793–3797. doi: 10.4049/jimmunol.172.6.3793. [DOI] [PubMed] [Google Scholar]
  • 28.Selvapandiyan A, Duncan R, Debrabant A, Lee N, Sreenivas G, Salotra P, Nakhasi HL. Genetically modified live attenuated parasites as vaccines for leishmaniasis. Indian J Med Res. 2006;123:455–466. [PubMed] [Google Scholar]
  • 29.Dutta S, Ray D, Kolli BK, Chang KP. Photodynamic sensitization of Leishmania amazonensis in both extracellular and intracellular stages with aluminum phthalocyanine chloride for photolysis in vitro. Antimicrob Agents Chemother. 2005;49:4474–4484. doi: 10.1128/AAC.49.11.4474-4484.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Scott P. Immunologic memory in cutaneous leishmaniasis. Cell Microbiol. 2005;7:1707–1713. doi: 10.1111/j.1462-5822.2005.00626.x. [DOI] [PubMed] [Google Scholar]
  • 31.Tabbara KS, Peters NC, Afrin F, Mendez S, Bertholet S, Belkaid Y, Sacks DL. Conditions influencing the efficacy of vaccination with live organisms against Leishmania major infection. Infect Immun. 2005;73:4714–4722. doi: 10.1128/IAI.73.8.4714-4722.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Coler RN, Reed SG. Second-generation vaccines against leishmaniasis. Trends Parasitol. 2005;21:244–249. doi: 10.1016/j.pt.2005.03.006. [DOI] [PubMed] [Google Scholar]
  • 33.Dube A, Sharma P, Srivastava JK, Misra A, Naik S, Katiyar JC. Vaccination of langur monkeys (Presbytis entellus) against Leishmania donovani with autoclaved L. major plus BCG. Parasitology. 1998;116(Pt 3):219–221. doi: 10.1017/s0031182097002175. [DOI] [PubMed] [Google Scholar]
  • 34.Misra A, Dube A, Srivastava B, Sharma P, Srivastava JK, Katiyar JC, Naik S. Successful vaccination against Leishmania donovani infection in Indian langur using alum-precipitated autoclaved Leishmania major with BCG. Vaccine. 2001;19:3485–3492. doi: 10.1016/s0264-410x(01)00058-5. [DOI] [PubMed] [Google Scholar]
  • 35.Howard JG, Liew FY. Mechanisms of acquired immunity in leishmaniasis. Philos Trans R Soc Lond B Biol Sci. 1984;307:87–98. doi: 10.1098/rstb.1984.0111. [DOI] [PubMed] [Google Scholar]
  • 36.Armijos RX, Weigel MM, Calvopina M, Hidalgo A, Cevallos W, Correa J. Safety, immunogenecity, and efficacy of an autoclaved Leishmania amazonensis vaccine plus BCG adjuvant against New World cutaneous leishmaniasis. Vaccine. 2004;22:1320–1326. doi: 10.1016/j.vaccine.2003.06.002. [DOI] [PubMed] [Google Scholar]
  • 37.Melby PC, Chandrasekar B, Zhao W, Coe JE. The hamster as a model of human visceral leishmaniasis: progressive disease and impaired generation of nitric oxide in the face of a prominent Th1-like cytokine response. J Immunol. 2001;166:1912–1920. doi: 10.4049/jimmunol.166.3.1912. [DOI] [PubMed] [Google Scholar]
  • 38.Garg R, Gupta SK, Tripathi P, Hajela K, Sundar S, Naik S, Dube A. Leishmania donovani: identification of stimulatory soluble antigenic proteins using cured human and hamster lymphocytes for their prophylactic potential against visceral leishmaniasis. Vaccine. 2006;24:2900–2909. doi: 10.1016/j.vaccine.2005.12.053. [DOI] [PubMed] [Google Scholar]
  • 39.Scharton-Kersten T, Scott P. The role of the innate immune response in Th1 cell development following Leishmania major infection. J Leukoc Biol. 1995;57:515–522. doi: 10.1002/jlb.57.4.515. [DOI] [PubMed] [Google Scholar]
  • 40.Trinchieri G. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 1995;13:251. doi: 10.1146/annurev.iy.13.040195.001343. [DOI] [PubMed] [Google Scholar]
  • 41.Kenney RT, Sacks DL, Gam AA, Murray HW, Sundar S. Splenic cytokine responses in Indian kala-azar before and after treatment. J Infect Dis. 1998;177:815–818. doi: 10.1086/517817. [DOI] [PubMed] [Google Scholar]
  • 42.Ghalib HW, Piuvezam MR, Skeiky YA, Siddig M, Hashim FA, el-Hassan AM, Russo DM, Reed SG. Interleukin 10 production correlates with pathology in human Leishmania donovani infections. J Clin Invest. 1993;92:324–329. doi: 10.1172/JCI116570. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Vouldoukis I, Becherel PA, Riveros-Moreno V, Arock M, da Silva O, Debre P, Mazier D, Mossalayi MD. Interleukin-10 and interleukin-4 inhibit intracellular killing of Leishmania infantum and Leishmania major by human macrophages by decreasing nitric oxide generation. Eur J Immunol. 1997;27:860–865. doi: 10.1002/eji.1830270409. [DOI] [PubMed] [Google Scholar]
  • 44.Ghose AC, Haldar JP, Pal SC, Mishra BP, Mishra KK. Serological investigations on Indian kala-azar. Clin Exp Immunol. 1980;40:318–326. [PMC free article] [PubMed] [Google Scholar]
  • 45.Bhowmick S, Ravindran R, Ali N. Leishmanial antigens in liposomes promote protective immunity and provide immunotherapy against visceral leishmaniasis via polarized Th1 response. Vaccine. 2007;25:6544–6556. doi: 10.1016/j.vaccine.2007.05.042. [DOI] [PubMed] [Google Scholar]
  • 46.Rodrigues V, Junior, Da Silva JS, Campos-Neto A. Selective inability of spleen antigen presenting cells from Leishmania donovani infected hamsters to mediate specific T cell proliferation to parasite antigens. Parasite Immunol. 1992;14:49–58. doi: 10.1111/j.1365-3024.1992.tb00005.x. [DOI] [PubMed] [Google Scholar]
  • 47.Basu R, Bhaumik S, Basu JM, Naskar K, De T, Roy S. Kinetoplastid membrane protein-11 DNA vaccination induces complete protection against both pentavalent antimonial-sensitive and -resistant strains of Leishmania donovani that correlates with inducible nitric oxide synthase activity and IL-4 generation: evidence for mixed Th1- and Th2-like responses in visceral leishmaniasis. J Immunol. 2005;174:7160–7171. doi: 10.4049/jimmunol.174.11.7160. [DOI] [PubMed] [Google Scholar]
  • 48.Rezai HR, Farrell J, Soulsby EL. Immunological responses of L. donovani infection in mice and significance of T cell in resistance to experimental leishmaniasis. Clin Exp Immunol. 1980;40:508–514. [PMC free article] [PubMed] [Google Scholar]
  • 49.Convit J. Leishmaniasis: Immunological and clinical aspects and vaccines in Venezuela. Clin Dermatol. 1996;14:479–487. doi: 10.1016/0738-081x(96)00042-9. [DOI] [PubMed] [Google Scholar]
  • 50.Howard JG, Hale C, Chan-Liew WL. Immunological regulation of experimental cutaneous leishmaniasis. 1. Immunogenetic aspects of susceptibility to Leishmania tropica in mice. Parasite Immunol. 1980;2:303–314. doi: 10.1111/j.1365-3024.1980.tb00061.x. [DOI] [PubMed] [Google Scholar]
  • 51.Scott P, Natovitz P, Coffman RL, Pearce E, Sher A. Immunoregulation of cutaneous leishmaniasis. T cell lines that transfer protective immunity or exacerbation belong to different T helper subsets and respond to distinct parasite antigens. J Exp Med. 1988;168:1675–1684. doi: 10.1084/jem.168.5.1675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Jarecki-Black JC, Glassman AB, James ER. Adoptive transfer of vaccine-induced resistance to Leishmania donovani. Am J Trop Med Hyg. 1985;34:1095–1097. doi: 10.4269/ajtmh.1985.34.1095. [DOI] [PubMed] [Google Scholar]
  • 53.Ulczak OM, Ghadirian E, Skamene E, Blackwell JM, Kongshavn PA. Characterization of protective T cells in the acquired response to Leishmania donovani in genetically determined cure (H-2b) and noncure (H-2d) mouse strains. Infect Immun. 1989;57:2892–2899. doi: 10.1128/iai.57.9.2892-2899.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Polley R, Stager S, Prickett S, Maroof A, Zubairi S, Smith DF, Kaye PM. Adoptive immunotherapy against experimental visceral leishmaniasis with CD8+ T cells requires the presence of cognate antigen. Infect Immun. 2006;74:773–776. doi: 10.1128/IAI.74.1.773-776.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Garg R, Gupta SK, Tripathi P, Naik S, Sundar S, Dube A. Immunostimulatory cellular responses of cured Leishmania-infected patients and hamsters against the integral membrane proteins and non-membranous soluble proteins of a recent clinical isolate of Leishmania donovani. Clin Exp Immunol. 2005;140:149–156. doi: 10.1111/j.1365-2249.2005.02745.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275. [PubMed] [Google Scholar]
  • 57.Ding AH, Nathan CF, Stuehr DJ. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophages. Comparison of activating cytokines and evidence for independent production. J Immunol. 1988;141:2407–2412. [PubMed] [Google Scholar]
  • 58.Voller A, Bidwell DE, Bartlett A. The enzyme linked immunosorbent assay (ELISA): a guide with abstracts of microplate application. Fileroline Press; Guernsey Ci: 1979. [Google Scholar]

RESOURCES