Skip to main content
BioMed Research International logoLink to BioMed Research International
. 2016 Sep 28;2016:1289157. doi: 10.1155/2016/1289157

In Vitro and In Vivo Biofilm Characterization of Methicillin-Resistant Staphylococcus aureus from Patients Associated with Pharyngitis Infection

Shanmugaraj Gowrishankar 1, Arumugam Kamaladevi 1, Krishnaswamy Balamurugan 1, Shunmugiah Karutha Pandian 1,*
PMCID: PMC5059529  PMID: 27761465

Abstract

The present investigation was deliberately aimed at evaluating the biofilm-forming ability of 63 clinical MRSA isolates recovered from pharyngitis patients through different phenotypic assays. The molecular detection of adhesion (icaA/icaD/icaB/icaC), adhesins (fnbA/fnbB, clfA, and cna), staphylococcal accessory regulator (sarA), and α-toxin (hla) genes was done by employing polymerase chain reaction (PCR). Out of 63 isolates, 49 (77.8%) were found slime positive by the Congo red agar (CRA) method and 44 (69.8%) as biofilm positive by the quantitative microtitre plate assays. The results of MATH assay showed that most of the test pathogens are hydrophilic in nature. The molecular investigation of biofilm-associated genes revealed that 84.13% (n = 53) of isolates were found positive for icaADBC genes. The fnbA and fnbB genes were present in 49 (77.8%) and 51 (81%) MRSA isolates, respectively. In addition, 58.7% (n = 37), 73% (n = 46), and 69.8% (n = 44) of the isolates harboured the clfA, cna, and hla genes, respectively. Further, nearly 81% (n = 51) of the isolates were found positive for the gene sarA and all the ica negative isolates were also negative for the gene. Furthermore, the results of in vivo adherence assay unveiled the factual commonness in the in vitro adherence method.

1. Introduction

Globally, myriad of bacterial pathogens inhabiting the environment cause several acute and chronic infections to human through their ability to form dynamic, structurally complex, and multilayered cellular matrix, termed as biofilms [1]. The synthesis of such biofilms by pathogenic bacteria is therefore considered to be a major virulence factor, since the recalcitrant biofilms comprehensively safeguard the pathogens not only from host defence mechanism but also from the targeted action of therapeutic drugs [2]. Methicillin-resistant Staphylococcus aureus (MRSA) continues to be the most prominent biofilm-forming human pathogen causing both healthcare-related and community-acquired infections with a substantial increase in morbidity and mortality. Though S. aureus can be isolated from various niches of human body, where it exists harmlessly as a commensal, it can also be an opportunistic pathogen in causing diverse array of infections ranging from skin and soft tissue lesions to lethal infections such as osteomyelitis, endocarditis, pneumonia, and septicaemia [3]. This commensal microflora readily colonizes the anterior nares and approximately 30% of healthy people carry this bacterium in their anterior nares [4]. As the nasal and extranasal colonization find chief prominence in the pathogenesis of invasive MRSA infections [5], studies on this pathogen from human throat (a least considered carriage site than the nares) are of dire need.

Besides, S. aureus is also widely known for its remarkable ability to infect and damage the indwelling medical prosthetics and other implants usually catheters through the fabrication of biofilm architectures [6, 7]. Another impressive characteristic feature of S. aureus in imposing such adverse clinical complications is its metabolic adaptability that facilitates the pathogen to colonize and persist in diverse environmental conditions. A wide range of virulent factors including extracellular toxins and surface structures in S. aureus are influential in the induction and persistence of infectivity within the host [8]. Although the potentials of biofilm assemblage of MRSA isolated from various infection sites of human and even from animals have been well demonstrated, studies on MRSA isolated from human throat are still inadequate. Therefore, the current study was proposed to characterize the biofilm-forming ability among clinical isolates of MRSA recovered from throat swabs pharyngitis patients.

The ability to attach, adhere, and synthesize biofilms has enhanced the virulence in MRSA. The mechanism of biofilm formation in S. aureus involves three major stages: initial attachment, maturation of biofilms, and dispersion of bacterial cells [9]. In S. aureus biofilm formation, the foremost and fundamental step is initial attachment, that is, adhesion which is being accomplished by the expression of different Microbial Surface Components Recognizing Adhesive Matrix Molecules (MSCRAMMs). These MSCRAMMs have high ability to interact with the host extracellular matrix proteins such as elastin binding protein (ebpS), laminin binding protein (eno), collagen-binding protein (cna), fibronectin-binding proteins A and B (fnbA and fnbB), fibrinogen binding protein (fib), and clumping factors A and B (clfA and clfB) [10]. Earlier studies on the molecular aspects of growth phase and subsequent establishment of biofilms have shown that S. aureus initially adhere to each other and then widen to structurally dynamic and intensely intricate biofilm architectures during the later phases of adherence. The biosynthesis of polysaccharide intercellular adhesin (PIA), a polysaccharide compiled from β-1, 6- linked N-acetyl-d-glucosamines (PNAG), is the hallmark element in the development of actual mature biofilms resulting in notorious multilayered clustering matrix of cells (second stage). PIA is mediated by the intercellular adhesin (ica) locus, which comprises four core genes, namely, icaA, icaD, icaB, and icaC and a regulatory gene (icaR) [6, 11]. The increase in the production of N-acetylglucosaminyl transferase and slime is facilitated by the coexpression of icaA and icaD genes [12]. While the genes icaB and icaC encode for extracellular membrane proteins, wherein icaC is whispered to have a role as receptor for polysaccharides and the function of icaB gene still remains uncover [13]. The accessory gene regulator (agr) locus, a well-characterized two-component regulatory system, plays a critical role in the upregulation and downregulation of protease and exotoxins, respectively [14], reflecting the final dispersal stage. In spite of deeper understanding on the biofilm-forming ability of S. aureus, it is still essential to extend the research on recently emerging MRSA strains (believed to be evolving from several clonal lineages of methicillin-susceptible S. aureus (MSSA) strains) as an attempt to address the complexity of their biofilm formation.

As a response to the above facts, the present study for the first time was focused on assessing the biofilm-forming properties among MRSA isolated from throat swabs of patients associated with pharyngitis through different phenotypic assays like slime synthesis, in vitro biofilm formation, and microbial adhesion to hydrocarbons (MATH). Furthermore, polymerase chain reaction (PCR) was performed to detect the adhesion (icaA/icaD/icaB/icaC), several adhesins (fnbA/fnbB, clfA, and cna), staphylococcal accessory regulator (sarA), and α-toxin (hla) genes. Finally, the in vivo adherence of the phenotypically and genotypically categorized MRSA isolates was assessed using a tropical nematode, Caenorhabditis elegans, as an animal model.

2. Materials and Methods

2.1. Bacterial Strains and Culture Conditions

A total of 63 MRSA isolates recovered from GAS associated pharyngitis patients were taken for evaluation of phenotypic and genotypic biofilm characteristics in the current study. The molecular identification and characterization of the MRSA isolates have already been done and reported by the same authors [15]. The MRSA isolates were grown and maintained on Tryptic soy agar/broth (TSA/TSB).

2.2. Phenotypic Assessment of Slime Synthesizing S. aureus Strains Using CRA

The qualitative slime production was assessed on the basis of the colour of S. aureus colonies developed on Congo red agar (CRA) plate according to the criteria described previously [16]. Briefly, MRSA clinical isolates were inoculated onto the CRA medium composed of TSB (30 g/L), sucrose (36 g/L), agar powder (18 g/L), and Congo red dye (0.8 g/L) and then cultured for 24 h at 37°C under aerobic conditions. The reference strains MRSA ATCC 33591 (slime producer) and Staphylococcus epidermidis ATCC 12228 (non-slime producer) were used as positive and negative controls, respectively.

The results regarding slime production were interpreted as follows: strains producing intensive black, black, and reddish black colonies with a rough, dry, and crystalline consistency were considered to be normal slime producers, whereas red and Bordeaux red with smooth colonies were classified as nonslime producers as reported elsewhere [17].

2.3. In Vitro Adherence Assay on Polystyrene Microtitre Plate (MtP)

In vitro biofilm formation was spectroscopically quantified by performing polystyrene microtitre plate (MtP) assay, as described previously with slight modifications [21]. Briefly, the test MRSA isolates were inoculated in 2 mL of TSB supplemented with 0.25% glucose and incubated overnight in shaking incubator (80 rpm, orbital shaker; Scigenics Biotech, Orbitek LEBT, India) at 37°C. The overnight culture of the test pathogens (1%) was then used to inoculate 24-well polystyrene MtPs containing 1 mL of fresh TSB supplemented with 0.25% glucose. The plates were incubated for 24 h at 37°C. After incubation, the plates were carefully washed thrice with sterile phosphate buffered saline (7 mM Na2HPO4, 3 mM NaH2PO4, and 130 mM NaCl at pH 7.4) to remove nonadherent cells and were air-dried in an inverted position before being stained. Adherent cells were stained with 1 mL of 0.4% crystal violet solution (w/v) for 2 min and the excess of dye was poured off. The wells were washed with sterile distilled water and then allowed to air-dry. Finally 1 mL of absolute ethanol was added into each well before being read spectroscopically. The optical density of the adherent biofilm was determined at OD570 nm, using a Multimode Microplate Reader (SpectraMax M3, USA) where the 1 mL of absolute ethanol served as blank. The strain S. epidermidis ATCC 12228 was used as the negative control. The adherence ability of tested isolates was classified into four categories based on the obtained OD: strongly adherent (OD570 ≥ 3.0), moderately adherent (OD570 ≤ 1.5–2.0), weakly adherent (OD570 ≤ 0.5–1.0), and nonadherent (OD570 < OD570 of negative control).

2.4. Confocal Laser Scanning Microscopy (CLSM)

In order to visualize the diverse biofilm architecture (on the basis of biofilm-forming potential through phenotypic and genotypic assays) of the four categorized test pathogens GSA-140, GSA-21, GSA-142, and GSA-54, Confocal Laser Scanning Microscopy (CLSM) (model: LSM 710) (Carl Zeiss, Germany) analysis was employed [22].

CLSM analysis was performed for the biofilms formed by the pathogens on glass pieces. The analysis was initiated by dispensing 1% inoculum of overnight cultures grown in TSB supplemented with 0.25% glucose into 24-well MtP containing 1 mL of fresh TSB + 0.25% glucose medium. Plates were statically incubated at 37°C for 24 h. After incubation, the glass pieces were gently washed with PBS and strained with 0.1% acridine orange for 5 min at room temperature in the dark. The stained glass pieces were gently washed thrice with PBS, air-dried, and observed under CLSM. Zen 2009 image software was used for analysis of biofilm images, which allowed for collection of z-stacks three-dimensional (3D) reconstruction. Images were acquired from random positions of biofilms formed on the glass slides. COMSTAT software (kind gift from Dr. Claus Sternberg, DTU Systems Biology, Technical University of Denmark) was used for further analysis of the obtained CLSM images (biofilm stack), in which three different parameters such as an average and maximum thickness (μm) of the biofilms and the biovolume (μm3), which is the volume of bacteria per μm2 of glass surface used, were analysed [22].

2.5. MATH Assay

Cell surface hydrophobicity of the test pathogens was determined by using MATH (microbial adhesion to hydrocarbons) assay as an evaluation of their affinity towards the hydrophobic hydrocarbon (toluene) following the procedure described previously [23]. Briefly, 1 mL of test bacterial culture (OD530 nm = 1.0) (Abs1) was placed into glass tubes along with 100 μL of toluene. The mixtures were vigorously vortexed for 2 min and incubated for 10 min at room temperature to allow phase separation, and then the OD530 nm of the aqueous phase was recorded (Abs2). The percentage of hydrophobicity was calculated according to the following formula: % hydrophobicity = [1 − (Abs2/Abs1)] × 100.

2.6. Detection of icaA, icaD, icaB, icaC, fnbA, fnbB, clfA, cna, and hla Genes

The chromosomal DNA of 63 MRSA isolates was extracted using the procedure described previously with minor modification [24] (omission of mutanolysin and hyaluronidase enzymes). The PCR assay for the detection of icaA, icaD, icaB, icaC, sarA, fnbA, fnbB, clfA, cna, and hla genes was performed using the primers (forward and reverse) and their respective standardized annealing temperatures as mentioned in Table 1. An aliquot of 2 μL of DNA template (~10 ng) was added to 23 μL of PCR mixture containing 1 × PCR buffer [10 mM Tris–HCl (pH 8.8), 50 mM KCl], 0.2 mM dNTPs, 1.5 mM MgCl2, 50 pM primer, and 1 U Taq polymerase (MBI Fermentas, Germany). Amplified PCR products were analyzed by agarose gel stained with ethidium bromide (0.5 μg μL−1) and visualized under ultraviolet transillumination and documented using Gel Doc XR apparatus (Biorad, USA).

Table 1.

Sequences of oligonucleotide primers used for PCR amplification of biofilm-associated genes.

Gene Nucleotide sequence of primers (5′–3′). Annealing temperature Amplicon size (bp) References
Forward primer Reverse primer
icaA (intercellular adhesion gene) ACACTTGCTGGCGCAGTCAA TCTGGAACCAACATCCAACA 53°C 188 [17]
icaD (intercellular adhesion gene) ATGGTCAAGCCCAGACAGAG AGTATTTTCAATGTTTAAAGCA 53°C 198 [17]
icaB (intercellular adhesion gene) CCCAACGCTAAAATCATCGC ATTGGAGTTCGGAGTGACTGC 53°C 1080 [18]
icaC (intercellular adhesion gene) CATGAAAATATGGAGGGTGG TCAAACTGATTTCGCCCACCG 50°C 1000 [18]
fnbA (fibronectin-binding protein A) ATCAGCAGATGTAGCGGAAG TTTAGTACCGCTCGTTGTCC 55°C 198 [19]
fnbB (fibronectin-binding protein B) AAGAAGCACCGAAAACTGTG TCTCTGCAACTGCTGTAACG 55°C 198 [19]
clfA (clumping factor A) ATTGGCGTGGCTTCAGTGCT CGTTTCTTCCGTAGTTGCATTTG 55°C 292 [20]
cna (collagen-binding protein) AAAGCGTTGCCTAGTGGAGA AGTGCCTTCCCAAACCTTTT 55°C 192 [12]
sarA (staphylococcal accessory regulatory locus) CCCAGAAATACAATCACTGTG AGTGCCATTAGTGCAAAACC 53°C 720 [18]
hla (alpha toxin) CAACTGATAAAAAAGTAGGCTGGAAAGTGAT CTGGTGAAAACCCTGAAGATAATAGAG 50°C 200 [17]

2.7. In Vivo Adherence Assay Using C. elegans

A batch of three representative isolates was selected from each of the four categories (classified on the basis of phenotypic and genotypic characterization) for their in vivo adherence potential in C. elegans. The adherence assay was qualitatively examined by using CLSM as described earlier with slight modifications [25]. Briefly, twenty age-synchronized young adult hermaphrodite nematodes were transferred from a lawn of E. coli OP50 to the M9 buffer containing characterized MRSA isolates present in a sterile 24-well culture plate [20% inoculum (0.1 O.D of cells in 660 nm), i.e., 9 × 106 cells m/L of LB medium] and incubated for 24 h at 20°C. After incubation, the nematodes were thoroughly washed and anesthetised by using 0.1 mM sodium azide to avoid expulsion of bacteria from nematodes intestine. Finally, the nematodes were stained with 0.1% acridine orange and visualized under CLSM.

2.8. Colony Forming Unit (CFU) Assay

To further ascertain the CLSM results and to quantify the adherence inside the C. elegans, a CFU assay was performed as described previously [25]. Briefly, a batch of ten nematodes were infected with each group of MRSA isolates (n = 3) for 24 h and washed thrice with M9 buffer to remove the surface bacteria. The washed nematodes were then transferred to the 1.5 mL microcentrifuge tube and the final volume was made up to 400 μL with M9 buffer. Finally, 400 mg of silicon carbide particles (1.0 mm; Himedia, India) was added to each tube and vortexed at the maximum speed for 2 min. The resulting suspension was serially diluted and plated on Hicrome Aureus agar (Himedia, India) to determine the CFU.

3. Results

3.1. Phenotypic Characterization of S. aureus Slime Production on Congo Red Agar (CRA)

The phenotypic determination of slime producing ability in Congo red agar of all the test isolates is shown in Table 2. As it is perceptibly evident from Figures 1 and 2 and Table 2, the different isolates of MRSA were unwaveringly found to be slime producers to varying degrees. Out of 63 MRSA isolates, 18 (28.6%), 23 (36.5%), 8 (12.7%), and 14 (22.2%) were determined to be strong black, black, reddish black, and Bordeaux red colour colony producers, respectively. The reference strains MRSA ATCC 33591 (positive control) and S. epidermidis ATCC 12228 (negative control) produced typical black and pink colonies, respectively, after 48 h incubation (Figure 1).

Table 2.

Relationships among the presence of icaA, icaD, icaB, icaC, fnbA, fnbB, clfA, cna, hla, and sarA genes, slime production, adherence capacity on MtPs, and hydrophobicity index in 63 different clinical MRSA associated with GAS pharyngitis infection.

Strain ID Biofilm phenotype on CRA Slime synthesis In vitro adherence (MtP) assay Hydrophobicity index ± SD Presence of adhesion genes
Adherence OD570 nm ± SD ∗Adherence ability icaA icaB icaC icaD sarA cna clfA fnbA fnbB hla
GSA-83 Black Producer 1.42 ± 0.213 ++ 26.3 ± 0.325 + + + + + + + + + +

GSA-22 Black Producer 1.79 ± 0.659 ++ 32.3 ± 0.336 + + + + + + + + + +

GSA-32 Strong black Producer 3.23 ± 0.986 +++ 29.4 ± 0.962 + + + + + + + + + +

GSA-A21 Black Producer 1.53 ± 0.286 ++ 40.3 ± 0.560 + + + + + + − + − −

GSA-127 Black Producer 0.91 ± 0.632 + 32.9 ± 0.123 − − − − + − − − + +

GSA-74 Strong black Producer 3.21 ± 0.215 +++ 41.3 ± 0.963 + + + + + + − − − −

GSA-45 Strong black Producer 3.09 ± 0.0236 +++ 44.2 ± 0.023 + + + + + + + + + +

GSA-150 Reddish black Nonproducer 0.19 ± 1.023 − 15.3 ± 0.965 − − − − + − + + + +

GSA-99 Reddish black Nonproducer 1.32 ± 0.963 ++ 16.4 ± 0.189 + + + + − + − − + +

GSA-103 Bordeaux red Nonproducer 0.47 ± 0.451 − 21.6 ± 0.651 + + + + + + + + + +

GSA-89 Strong black Producer 3.41 ± 0.238 +++ 29.3 ± 0.359 + + + + + + + + + +

GSA-50 Black Producer 3.06 ± 0.896 +++ 31.2 ± 0.158 + + + + + + + + + +

GSA-A8 Strong black Producer 2.53 ± 1.639 ++ 27.9 ± 0.958 + + + + + − + + + +

GSA-44 Strong black Producer 3.86 ± 0.127 +++ 24.6 ± 0.756 + + + + + + + − − −

GSA-46 Bordeaux red Nonproducer 0.39 ± 0.986 − 24.3 ± 0.286 + + + + + + − + + +

GSA-48 Black Producer 1.06 ± 1.028 + 20.9 ± 0.396 + + + + + + − + + +

GSA-54 Bordeaux red Nonproducer 0.49 ± 0.966 − 14.5 ± 0.362 − − − − + − + − + +

GSA-395 Strong black Producer 3.23 ± 0.523 +++ 29.5 ± 0.396 + + + + + + + + + +

GSA-68 Strong black Producer 3.51 ± 0.889 +++ 32.6 ± 0.325 + + + + + + + + + +

GSA-94 Bordeaux red Nonproducer 0.42 ± 0.365 − 18.6 ± 0.176 − − − − − − − − − −

GSA-104 Black Producer 1.48 ± 0.632 ++ 30.9 ± 0.963 − − − − − + + − + +

GSA-140 Strong black Producer 3.52 ± 0.023 +++ 36.2 ± 0.990 + + + + + + − + − −

GSA-145 Strong black Producer 3.22 ± 0.965 +++ 28.9 ± 1.230 + + + + + + − + − −

GSA-142 Reddish black Nonproducer 0.96 ± 1.036 + 30.6 ± 0.968 − − − − + − − − − −

GSA-70 Bordeaux red Nonproducer 0.23 ± 0.396 − 13.6 ± 0.869 − − − − − − − + + +

GSA-126 Strong black Producer 3.62 ± 0.325 +++ 43.6 ± 0.310 + + + + + + + + + +

GSA-A4 Black Producer 2.57 ± 0.635 ++ 21.5 ± 0.256 + + + + + + + + + +

GSA-92 Reddish black Nonproducer 0.39 ± 0.961 − 12.9 ± 0.178 + + + + + − − + + +

GSA-365 Black Producer 1.98 ± 0.362 ++ 36.5 ± 0.986 + + + + + − + + + −

GSA-A12 Black Producer 1.59 ± 0.589 ++ 21.9 ± 0.936 + + + + + + + + + +

GSA-A18 Bordeaux red Nonproducer 1.09 ± 0.698 + 19.2 ± 0.129 + + + + + − − + + −

GSA-297 Black Producer 1.96 ± 0.129 ++ 29.9 ± 0.326 + + + + + + + + + +

GSA-134 Reddish black Nonproducer 3.12 ± 0.396 +++ 13.6 ± 0.349 + + + + + + − + + −

GSA-75 Black Producer 1.79 ± 0.326 ++ 30.1 ± 0.559 + + + + + + + + + +

GSA-88 Strong black Nonproducer 3.09 ± 0.856 +++ 24.3 ± 0.552 + + + + + + + + + +

GSA-71 Black Producer 3.85 ± 0.785 +++ 22.3 ± 0.639 + + + + + + + + + +

GSA-A25 Black Producer 0.85 ± 0.759 + 26.8 ± 1.36 + + + + + − + + + +

GSA-79 Bordeaux red Nonproducer 0.21 ± 0.856 − 14.9 ± 0.759 − − − − − + − + + −

GSA-52 Black Producer 3.52 ± 0.996 +++ 23.6 ± 0.529 + + + + + + + − − +

GSA-91 Bordeaux red Nonproducer 0.86 ± 1.236 + 15.9 ± 0.169 + + + + + − + + + +

GSA-84 Strong black Producer 3.11 ± 1.036 +++ 40.1 ± 0.629 + + + + + + − + + +

GSA-53 Bordeaux red Nonproducer 0.36 ± 0.845 − 19.1 ± 0.785 + + + + + − + + + +

GSA-137 Black Producer 1.56 ± 0.965 ++ 22.6 ± 0.396 + + + + + + − + + +

GSA-A20 Strong black Producer 3.51 ± 0.515 +++ 42 ± 0.968 + + + + + + − + + +

GSA-291 Black Producer 1.63 ± 0.689 ++ 26.9 ± 0.236 + + + + + + − + + +

GSA-98 Black Producer 1.79 ± 0.632 ++ 22.6 ± 0.756 + + + + + + − + + +

GSA-73 Strong black Producer 3.24 ± 0.325 +++ 36.2 ± 0.688 + + + + + + − + + +

GSA-A16 Black Producer 2.06 ± 0.963 ++ 32.8 ± 0.895 + + + + − + + + + +

GSA-131 Bordeaux red Nonproducer 1.08 ± 0.896 + 16.3 ± 0.955 + + + + + − − + + −

GSA-410 Strong black Producer 3.69 ± 0.563 +++ 36.8 ± 0.269 + + + + + + + + + +

GSA-377 Bordeaux red Nonproducer 0.27 ± 1.342 − 17.2 ± 0.745 + + + + + + + + + −

GSA-A1 Black Producer 3.04 ± 0.506 +++ 21.1 ± 0.986 + + + + + + + − − +

GSA-A6 Bordeaux red Nonproducer 0.79 ± 0.966 + 13.9 ± 0.156 + + + + + + + + + −

GSA-A9 Strong black Nonproducer 2.89 ± 0.796 ++ 24.3 ± 0.969 + + + + + + + + + +

GSA-A17 Black Producer 1.85 ± 0.235 +++ 19.9 ± 0.589 + + + + + + + + + +

GSA-28 Bordeaux red Nonproducer 1.25 ± 0.168 + 19.2 ± 0.129 + + + + + + + − + −

GSA-51 Black Producer 2.57 ± 0.234 ++ 21.3 ± 0.345 + + + + + + − + + +

GSA-58 Reddish black Nonproducer 0.55 ± 0.996 + 18.2 ± 0.569 + + + + + + + + + −

GSA-63 Reddish black Nonproducer 1.43 ± 0.351 ++ 11.9 ± 0.266 − − − − − − − − − −

GSA-81 Reddish black Nonproducer 0.98 ± 0.029 + 19.1 ± 0.192 + + + + − − − − − +

GSA-86 Bordeaux red Nonproducer 0.49 ± 0.259 − 16.2 ± 0.367 − − − − − − + − − −

GSA-97 Strong black Nonproducer 3.39 ± 0.125 +++ 23.9 ± 0.121 + + + + + + + + + +

GSA-102 Black Producer 1.08 ± 0.985 + 24.5 ± 0.276 + + + + + + − + + −

∗: Indicating the varied adhering ability of isolates on polystyrene surface, where +++ represents highly adherent (OD570 values of >3.0), ++ represents strongly adherent (OD570 values of >2.0), + represents moderately adherent (OD570 values of >1.0–2.0) and − represents weakly adherent (OD570 values of >0.5–1.0).

Figure 1.

Figure 1

Colony morphologies of reference Staphylococcus aureus strains MRSA ATCC 33591 (positive control) and S. epidermidis ATCC 12228 (negative control) revealing strong black (upper sector) and pink (lower sector) coloured colonies on Congo red agar medium, respectively.

Figure 2.

Figure 2

Congo red agar test showing four different slime producing patterns of clinical MRSA isolates: (a) slime positive bacteria with dark shiny black colonies (upper sector); (b) black colonies (bottom sector); (c) weak black colonies (right sector); and (d) slime negative bacteria showing pink coloured colonies (left sector).

3.2. MATH Assay

The affinity of MRSA isolates towards toluene (nonpolar solvent) was unveiled by MATH assay and the results are summarized in Table 2. From the obtained results, it was found that the majority of the tested MRSA isolates (87.3%) exhibited a hydrophilic character, whereas eight MRSA isolates (12.7%) displayed a relative hydrophobic character.

3.3. In Vitro Adherence Assay on Polystyrene Microtitre Plate (MtP)

The quantitative MtP method is the most extensively used gold standard technique for the detection of biofilm formation [26]. Table 2 and Figure 3(a) clearly show that all the MRSA isolates tested were found to be adherent at varying levels on 24-well polystyrene MtPs. Among 63 isolates studied, 21 (33.3%) isolates were highly adherent with OD570 values of >3, 5 isolates (7.9%) were strongly adherent with OD570 values of >2.0, 19 isolates (30.1%) were moderately adherent with OD570 values of >1–2.0, and 18 (28.6%) isolates were weakly adherent with OD570 values of <0.5–1. The MRSA ATCC 33591 strain was found to be strongly adherent with an OD570 value >2.0, while the S. epidermidis ATCC 12228 strain was negatively adherent (OD570 < 0.5).

Figure 3.

Figure 3

Total biofilm formation of different clinical MRSA isolates. (a) The bacterial cells were grown in 24-well Mtps containing TSB supplemented with 0.25% glucose. The cells that adhered to the plate surface after washing with phosphate buffer were visualized by crystal violet staining. The isolates were considered as highly adherent (a1), strongly adherent (a2), moderately adherent (a3), and nonadherent (a4) based upon their absorbance at 570 nm as measured by spectrophotometer. (b) Confocal laser scanning micrographs revealing variable degrees of biofilm production by clinical MRSA isolates on glass surface: (b1) highly adherent; (b2) strongly adherent; (b3) moderately adherent; and (b4) nonadherent isolates. (c) COMSTAT analysis of the obtained CLSM images.

3.4. Distribution of Adhesion and Biofilm Loci

As the prime intention of the present study is the genotypic characterization of biofilm responsible genes, PCR assay was employed to detect icaA, icaD, icaB, icaC, fnbA, fnbB, clfA, cna, hla, and sarA genes among test MRSA strains. The distributions of these genes in 63 MRSA isolates are summarized in Table 2. As can be seen in Table 2, the majority of MRSA isolates [84.13% (n = 53)] were found to be positive for icaADBC genes. The prevalence of sarA, fnbA, fnbB, clfA, cna, and hla genes was unswervingly found to be 81, 84.1, 81, 58.7, 90.5, and 70%, respectively (Figure 4). Using the obtained biofilm responsible gene patterns of 63 MRSA isolates, a dendrogram was generated resulting in 5 clusters, namely, A, B, B1, C, and C1 (Figure 5). The data revealed that most of the strongly and moderately adherent isolates were under clusters B and B1 and around 95% of highly adherent isolates were harboured in cluster A, whereas clusters C and C1 showed the predominance of weak and few moderately adherent isolates.

Figure 4.

Figure 4

PCR amplification for the detection of genes responsible for biofilm formation in clinical MRSA isolates. Lane 1, 100 bp ladder (MBI Fermentas); lane 1–10, PCR amplicons of icaA, icaD, icaB, icaC, fnbA, fnbB, clfA, cna, hla, and sarA genes amplified from the clinical MRSA isolate GSA-32.

Figure 5.

Figure 5

Dendrogram based on the amplification pattern of biofilm responsible genes, demonstrating the genotypic relatedness among the 63 MRSA isolates recovered from GAS pharyngitis patients. Scale represents the distance coefficient.

3.5. In Vivo Adherence and Colonization of MRSA Isolates in C. elegans

In order to study the bioadherence property of four phenotypically and genotypically categorized MRSA isolates (highly, strongly, moderately, and weakly adherent isolates), an in vivo assay was performed using C. elegans. For examining the adherence potential of the MRSA isolates, the pathogen-exposed nematodes were examined by CLSM using Zen software. The fluorescence intensity found in the nematodes indicated the density of bacterial load inside the C. elegans. As anticipated, the highly and strongly adherent groups showed more intense fluorescence compared to the moderately and weakly adherent groups which showed moderate and very low fluorescence intensities, respectively (Figure 6). Furthermore, the level of CFU in pathogen-exposed nematodes was increased (152 ± 17.8  ×  104) in highly adherent groups (P ≤ 0.05), modest (32 ± 4.6  ×  104) in strongly adherent groups (P ≤ 0.05), and decreased in moderately (28 ± 2.6  ×  102) and weakly adherent (21 ± 3  ×  102) groups, respectively (Figure 7).

Figure 6.

Figure 6

In vivo adherence and colonization of C. elegans infected with MRSA clinical isolates. Qualitative analysis of colonization in C. elegans infected with S. aureus clinical isolates using Confocal Laser Scanning Microscopy.

Figure 7.

Figure 7

Presence of MRSA inside the C. elegans. Quantitative analysis of bacterial load inside the C. elegans exposed with MRSA clinical isolates.

4. Discussion

Beyond being a commensal microflora, S. aureus primarily colonizes the anterior nares of human population. In addition, 30% (approximately) of healthy individuals are recognized as the carriers of this bacterium [4]. Though a few reports from the past have depicted that the human throat is less well studied site of carriage than the nares, apart from some isolations accounted, the scientific data obtained during 1940s have reported the throat colonization rate to be 4–63% [27]. Further persistent surveillance studies have reconfirmed the observation that MRSA in throat may be selectively colonized and escape from routine screening process in the infection control programs [28, 29]. Despite the fact that S. aureus was incredibly recurrent in causing varied range of human infections (aforementioned), the role of S. aureus in causing pharyngitis infection is also becoming noticeable but found less often when compared to the GAS pharyngitis infections [15, 30].

Though plethora of research findings have broadened our knowledge on the biofilm attributes of S. aureus, particularly MRSA emerging from various infection sites of human, it was necessarily important to widen our studies on the biofilm characterization of MRSA strains from new sites of infection as well. In our previous study, we demonstrated the possible role of MRSA on its own or in association with GAS in pharyngitis infection [15]. We extend the present study by performing the in vitro and in vivo biofilm characterization of the MRSA strains (n = 63), owing to the fact that the biofilm formation and adhesive ability are the prime virulence traits in S. aureus. The current study is the first of its kind to evaluate the biofilm-forming abilities among MRSA isolates recovered from new infection site, that is, throats of pharyngitis patients, which possibly would contribute towards the understanding of infection process. Researchers from the past have demonstrated the significance of MtP, CRA, and/or PCR techniques for the determination of critical virulence factors, particularly the ability of biofilm formation in Staphylococcus species [16, 31, 32].

Following the same paradigm, we also assessed 63 MRSA strains for their biofilm-forming capabilities employing three in vitro screening procedures (the MtP method, the CRA test, and the PCR technique). It has been well known that S. aureus can adhere and build biofilms on the medical implants and/or indwelling medical devices that can be attributed to a characteristic feature known as slime production [33]. This study utilized Congo red agar assay to determine the efficiency of test pathogens for their slime production, considering their high virulence and extreme potency in imposing severe postsurgical infections. Out of 63 MRSA strains tested, 49 (77.8%) were found to exhibit a positive phenotype for slime production by developing strong black or reddish black colonies on CRA plates. This result is in consonance with the previous reports by Kouidhi et al. [17], Arciola et al. [34], and Ammendolia et al. [35], wherein 50, 60.8, and 88.9% of S. aureus were found to be positive for slime production, respectively.

Cell surface hydrophobicity (CSH) plays a crucial role in the adherence of staphylococci to the host cells [17, 21]. Several reports from the recent past have reiterated this fact by observing that while there was a decrease in biofilm formation of S. aureus, similarly there was also a significant decrease in its cell surface charges like hydrophobicity during the treatment of any antibiofilm or sub-MICs of antibiotic agents [17, 22]. Here, we have determined the hydrophobic index of 63 MRSA isolates by performing MATH assay using toluene. The results summarized in Table 2 indicate that the surface affinity of S. aureus towards toluene was low signifying the hydrophilic nature of 87.3% (n = 54) of MRSA isolates subjected for this study. However, 12.7% (n = 8) of the isolates showed hydrophobicity and have also exhibited a strong biofilm formation on polystyrene MtPs, suggesting the possible interaction between the hydrophobic cells and substrate. The result of this assay is in agreement with the previous reports by Kouidhi et al. [17] and Hamadi et al. [36] portraying the hydrophilic nature of S. aureus surface.

Regardless of the actuality that several methods have been described so far to evaluate the accumulation and biofilm formation, MtP-based method was highly employed in most of the studies [37, 38]. The data of quantitative biofilm formation assay using MtPs showed 21 isolates as highly adherent (OD570 > 3), 5 isolates as strongly adherent (OD570 > 2.0 but <3), 19 isolates as low grade adherent (OD570 > 2), and remaining 18 as nonadherent (OD570 < 1). The result of this assay was validated by the confocal scanning micrographs (Figure 3(b)) followed by the COMSTAT analysis (Figure 3(c)) of the acquired images for single representative isolate from each of the four categories.

Further, the involvement of biofilms in clinical infections has received increasing interest due to the characterization of genes involved in biofilm formation [13]. Multitude of reports has demonstrated the significance of surface components in the biofilm formation of S. aureus such as the product of icaADBC operon, which encodes proteins for the synthesis of polysaccharide, poly-N-acetyl β-1-6-glucosamine (PNAG) [6, 39]. In addition, few extracellular proteins as well as cell-bound adhesins (also called MSCRAMMs) are considered essential for the pathogenicity of S. aureus. Consequently, the MRSA isolates were subjected to genotypic detection of icaA, icaD, icaB, and icaC genes and certain adhesin genes like clfA, cna, fnbA, and fnbB through PCR. The data of PCR analysis revealed that, except the 10 MRSA isolates, the remaining 53 MRSA isolates (84.13%) were found to harbour icaADBC genes. Our results were in total agreement with the recent studies stipulating that the percentage of S. aureus exhibiting icaADBC genotype was 100 [13]. Our findings were collinear with the observations by Atshan et al. [13] and Arciola et al. [12] as there was no difference in the prevalence of icaADBC genes in S. aureus with high and low virulence; however the only variation is found to be in the phenotypic characterization.

Conversely, adhesion to host cells requires genes like fnb (A and B), clfA, and cna that encode MSCRAMMs unlike the other factors involved in the adhesion to abiotic surfaces. Fibronectin-binding proteins (FnbA and FnbB) are large adhesins that may also function as invasins to modulate the adhesion and internalization of the organisms by different host cells. In addition, it has also been reported that fibronectin-binding facilitates the primary adherence and intercellular accumulation in biofilm assemblies [40]. In the present study, the distribution of fnbA and fnbB genes has been observed as 77.8% (n = 49) and 81% (n = 51), respectively, and around 73% (n = 46) of the MRSA isolates harboured both fnbA and fnbB genes (Table 2). A clinical study by Heilmann in 2011 [41] suggested that S. aureus strains associated with invasive disease were more likely to encode both fnbA and fnbB genes. Clumping factor (Clf) A and ClfB encoded by the genes clfA and clfB are the most important proteins for the binding of S. aureus to fibrinogen and fibrin; hence a mutant allele of clfA gene failed to clump and thus poorly adheres. In the present study, the clfA gene was present in 37 (58.7%) isolates, which was on a par with the previous report by Kohn et al. [42] suggesting that 89% of the test isolates are clfA positive. As aforementioned, collagen-binding proteins play an important role in the adhesion and pathogenesis of S. aureus [43]. In the current study, the presence of cna gene was found in 46 (73%) isolates, which was in agreement with other studies that reported the prevalence of cna gene as 46% [1] and 52% [44] in the isolates chosen for their study. However this is highly contrary with a report by Monecke et al. [45] suggesting that cna (collagen adhesin) was detected only in some clonal complexes. Staphylococcal alpha-hemolysin is one of the pore-forming toxins encoded by the gene hla which plays a major role in the biofilm formation and appears to be primarily required for cell-to-cell interactions. Therefore, a mutant allele of hla can initially aid in colonizing a substratum; however, it could not organize into multicellular macrocolonies. The PCR assay for the detection of hla gene revealed that 69.8% of (n = 44) MRSA strains were positive.

During the process of pathogenesis the chronological expression of several virulence determinants in S. aureus has been shown to be under the control of certain genetic loci, namely, agr (accessory gene regulator) and sarA (staphylococcal accessory regulator) [45]. In the midst, sarA is a chief global regulator that is essential for biofilm formation of MRSA and MSSA in both in vitro and in vivo conditions [46]. Since there has been a mounting evidence to suggest sarA as the positive regulator of PNAG-dependent biofilm formation in S. aureus [47, 48], in the present study the prevalence of sarA gene in MRSA isolates was assayed using PCR. The results revealed that the MRSA isolates harbouring the icaADBC genes were also positive for sarA gene, whereas the isolates with icaADBC negative genotypes were found negative for sarA, which is in corroboration with the findings from previous studies [47, 48]. The presence of sarA in 90.5% of MRSA strains from pharyngitis patients evidently implies the biofilm-associated pathogenic potential.

Furthermore, bearing in mind that in vivo adherence assay would be a better approach to comparatively assess the adhering ability of MRSA isolates with that of the phenotypic assays, three representative isolates from each of the four categories including highly, strongly, moderately, and weakly adherent groups were selected on the basis of their phenotypic and genotypic characteristics. The colonization by MRSA clinical isolates in C. elegans was localized using CLSM. The adherence of the pathogen in the host cell may possibly lead to the colonization of the pathogen in the host. As expected, the nematodes infected with highly adherent group showed an extensive intestinal colonization (Figure 6). On the other hand, the strongly adherent group exhibited more intense florescence compared to that of moderately and weakly adherent groups, which displayed very minimal fluorescence intensity. This was further authenticated with the results of CFU assay and therefore it is highly pertinent to state that the outcome of in vivo adherence assay clearly portrayed the factual frequency in the results obtained from in vitro adherence methods.

5. Conclusion

The data of the current study demonstrated the presence of ica genes, several adhesin genes, and the consequent phenotypic ability to form biofilm by most MRSA isolates. This biofilm-forming potential of MRSA isolates recovered from patients infected with pharyngitis in succession may facilitate and/or aggravate the infection, as such recalcitrant biofilms are 1000-fold more resistant to antibiotics and immune defence which may subsequently alleviate the pathogen to become multidrug resistant or may cause let-down in antibiotic therapy. In addition, the in vivo result suggests its good correlation with the findings of quantitative MtP method. Collectively, the outcome of the present study delineates, for the first time, the phenotypic (both in vivo and in vitro) as well as genotypic biofilm characterization of MRSA isolates recovered from GAS associated pharyngitis, which in turn ameliorates our perception and understanding of the pathogenesis and also its possible impact of causing throat infections.

Acknowledgments

The authors thankfully acknowledge the Department of Biotechnology, Government of India, for providing Bioinformatics Infrastructure Facility (Grant no. BT/BI/25/012/2012 (BIF)). The instrumentation facility provided by Department of Science and Technology, Government of India, through PURSE [Grant no. SR/S9Z- 415 23/2010/42(G)] and FIST (Grant no. SR-FST/LSI-087/2008) and University Grants Commission, New Delhi, through SAP-DRS1 [Grant no. F.3-28/2011(SAP-II)] is gratefully acknowledged. The authors also acknowledge Dr. Claus Sternberg, DTU Systems Biology, Technical University of Denmark, for providing the COMSTAT software.

Competing Interests

All authors declare that they have no competing financial/commercial interests.

References

  • 1.Tsuneda S., Aikawa H., Hayashi H., Yuasa A., Hirata A. Extracellular polymeric substances responsible for bacterial adhesion onto solid surface. FEMS Microbiology Letters. 2003;223(2):287–292. doi: 10.1016/S0378-1097(03)00399-9. [DOI] [PubMed] [Google Scholar]
  • 2.Hoyle B. D., Costerton J. W. Bacterial resistance to antibiotics: the role of biofilms. Progress in Drug Research. 1991;37:91–105. doi: 10.1007/978-3-0348-7139-6_2. [DOI] [PubMed] [Google Scholar]
  • 3.Lowy F. D. Staphylococcus aureus infections. The New England Journal of Medicine. 1998;339(8):520–532. doi: 10.1056/nejm199808203390806. [DOI] [PubMed] [Google Scholar]
  • 4.Kluytmans J. A., Wertheim H. F. Nasal carriage of Staphylococcus aureus and prevention of nosocomial infections. Infection. 2005;33(1):3–8. doi: 10.1007/s15010-005-4012-9. [DOI] [PubMed] [Google Scholar]
  • 5.Kluytmans J., Van Belkum A., Verbrugh H. Nasal carriage of Staphylococcus aureus: epidemiology, underlying mechanisms, and associated risks. Clinical Microbiology Reviews. 1997;10(3):505–520. doi: 10.1128/cmr.10.3.505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Cramton S. E., Gerke C., Schnell N. F., Nichols W. W., Götz F. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infection and Immunity. 1999;67(10):5427–5433. doi: 10.1128/iai.67.10.5427-5433.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Fowler V. G., Jr., Fey P. D., Reller L. B., Chamis A. L., Corey G. R., Rupp M. E. The intercellular adhesin locus ica is present in clinical isolates of Staphylococcus aureus from bacteremic patients with infected and uninfected prosthetic joints. Medical Microbiology and Immunology. 2001;189(3):127–131. doi: 10.1007/s430-001-8018-5. [DOI] [PubMed] [Google Scholar]
  • 8.Foster T. J., Höök M. Surface protein adhesins of Staphylococcus aureus . Trends in Microbiology. 1998;6(12):484–488. doi: 10.1016/s0966-842x(98)01400-0. [DOI] [PubMed] [Google Scholar]
  • 9.Otto M. Staphylococcal biofilms. Current Topics in Microbiology and Immunology. 2008;322:207–228. doi: 10.1007/978-3-540-75418-3_10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Seo Y.-S., Lee D. Y., Rayamahji N., Kang M. L., Yoo H. S. Biofilm-forming associated genotypic and phenotypic characteristics of Staphylococcus spp. isolated from animals and air. Research in Veterinary Science. 2008;85(3):433–438. doi: 10.1016/j.rvsc.2008.01.005. [DOI] [PubMed] [Google Scholar]
  • 11.McKenney D., Hübner J., Muller E., Wang Y., Goldmann D. A., Pier G. B. The ica locus of Staphylococcus epidermidis encodes production of the capsular polysaccharide/adhesin. Infection and Immunity. 1998;66(10):4711–4720. doi: 10.1128/iai.66.10.4711-4720.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Arciola C. R., Campoccia D., Gamberini S., Baldassarri L., Montanaro L. Prevalence of cna, fnbA and fnbB adhesin genes among Staphylococcus aureus isolates from orthopedic infections associated to different types of implant. FEMS Microbiology Letters. 2005;246(1):81–86. doi: 10.1016/j.femsle.2005.03.035. [DOI] [PubMed] [Google Scholar]
  • 13.Atshan S. S., Nor Shamsudin M., Sekawi Z., et al. Prevalence of adhesion and regulation of biofilm-related genes in different clones of Staphylococcus aureus . Journal of Biomedicine and Biotechnology. 2012;2012:10. doi: 10.1155/2012/976972.976972 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Boles B. R., Horswill A. R. agr-mediated dispersal of Staphylococcus aureus biofilms. PLoS Pathogens. 2008;4(4) doi: 10.1371/journal.ppat.1000052.e1000052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gowrishankar S., Thenmozhi R., Balaji K., Pandian S. K. Emergence of methicillin-resistant, vancomycin-intermediate Staphylococcus aureus among patients associated with group A Streptococcal pharyngitis infection in southern India. Infection, Genetics and Evolution. 2013;14(1):383–389. doi: 10.1016/j.meegid.2013.01.002. [DOI] [PubMed] [Google Scholar]
  • 16.Freeman D. J., Falkiner F. R., Keane C. T. New method for detecting slime production by coagulase negative staphylococci. Journal of Clinical Pathology. 1989;42(8):872–874. doi: 10.1136/jcp.42.8.872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kouidhi B., Zmantar T., Hentati H., Bakhrouf A. Cell surface hydrophobicity, biofilm formation, adhesives properties and molecular detection of adhesins genes in Staphylococcus aureus associated to dental caries. Microbial Pathogenesis. 2010;49(1-2):14–22. doi: 10.1016/j.micpath.2010.03.007. [DOI] [PubMed] [Google Scholar]
  • 18.Kim J.-H., Kim C.-H., Hacker J., Ziebuhr W., Lee B. K., Cho S.-H. Molecular characterization of regulatory genes associated with biofilm variation in a Staphylococcus aureus strain. Journal of Microbiology and Biotechnology. 2008;18(1):28–34. [PubMed] [Google Scholar]
  • 19.Abraham N. M., Jefferson K. K. A low molecular weight component of serum inhibits biofilm formation in Staphylococcus aureus . Microbial Pathogenesis. 2010;49(6):388–391. doi: 10.1016/j.micpath.2010.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Tristan A., Ying L., Bes M., Etienne J., Vandenesch F., Lina G. Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infections. Journal of Clinical Microbiology. 2003;41(9):4465–4467. doi: 10.1128/jcm.41.9.4465-4467.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gowrishankar S., Mosioma N. D., Pandian S. K. Coral-associated bacteria as a promising antibiofilm agent against methicillin-resistant and -susceptible Staphylococcus aureus biofilms. Evidence-Based Complementary and Alternative Medicine. 2012;2012:16. doi: 10.1155/2012/862374.862374 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Gowrishankar S., Kamaladevi A., Ayyanar K. S., Balamurugan K., Pandian S. K. Bacillus amyloliquefaciens-secreted cyclic dipeptide—cyclo(l-leucyl-l-prolyl) inhibits biofilm and virulence production in methicillin-resistant Staphylococcus aureus . RSC Advances. 2015;5(116):95788–95804. doi: 10.1039/c5ra11641d. [DOI] [Google Scholar]
  • 23.Courtney H. S., Ofek I., Penfound T., et al. Relationship between expression of the family of M proteins and lipoteichoic acid to hydrophobicity and biofilm formation in Streptococcus pyogenes . PLoS ONE. 2009;4(1) doi: 10.1371/journal.pone.0004166.e4166 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Schlegel L., Grimont F., Grimont P. A. D., Bouvet A. Identification of major streptococcal species by rrn-amplified ribosomal DNA restriction analysis. Journal of Clinical Microbiology. 2003;41(2):657–666. doi: 10.1128/jcm.41.2.657-666.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kamaladevi A., Balamurugan K. Role of PMK-1/p38 MAPK defense in Caenorhabditis elegans against Klebsiella pneumoniae infection during host-pathogen interaction. Pathogens and Disease. 2015;73(5) doi: 10.1093/femspd/ftv021. [DOI] [PubMed] [Google Scholar]
  • 26.Christensen G. D., Simpson W. A., Younger J. J., et al. Adherence of coagulase-negative staphylococci to plastic tissue culture plates: a quantitative model for the adherence of staphylococci to medical devices. Journal of Clinical Microbiology. 1985;22(6):996–1006. doi: 10.1128/jcm.22.6.996-1006.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Mertz D., Frei R., Jaussi B., et al. Throat swabs are necessary to reliably detect carriers of Staphylococcus aureus . Clinical Infectious Diseases. 2007;45(4):475–477. doi: 10.1086/520016. [DOI] [PubMed] [Google Scholar]
  • 28.Mertz D., Frei R., Periat N., et al. Exclusive Staphylococcus aureus throat carriage: at-risk populations. Archives of Internal Medicine. 2009;169:172–178. doi: 10.1001/archinternmed.2008.536. [DOI] [PubMed] [Google Scholar]
  • 29.Hamdan-Partida A., Sainz-Espuñes T., Bustos-Martínez J. Characterization and persistence of Staphylococcus aureus strains isolated from the anterior nares and throats of healthy carriers in a Mexican community. Journal of Clinical Microbiology. 2010;48(5):1701–1705. doi: 10.1128/jcm.01929-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Richmond C. E., Beyer M. W., Ferozan B. A., Zipp C. Infectious mononucleosis with Staphylococcus aureus pharyngitis co-infection. Osteopathic Family Physician. 2010;2(1):14–17. doi: 10.1016/j.osfp.2009.10.001. [DOI] [Google Scholar]
  • 31.Bozkurt H., Kurtoglu M. G., Bayram Y., Keşli R., Berktaş M. Correlation of slime production investigated via three different methods in coagulase-negative staphylococci with crystal violet reaction and antimicrobial resistance. Journal of International Medical Research. 2009;37(1):121–128. doi: 10.1177/147323000903700114. [DOI] [PubMed] [Google Scholar]
  • 32.El-Mahallawy H. A., Loutfy S. A., El-Wakil M., Abd El-Al A. K., Morcos H. Clinical implications of icaA and icaD genes in coagulase negative Staphylococci and Staphylococcus aureus bacteremia in febrile neutropenic pediatric cancer patients. Pediatric Blood & Cancer. 2009;52(7):824–828. doi: 10.1002/pbc.21964. [DOI] [PubMed] [Google Scholar]
  • 33.Knobloch J. K.-M., Bartscht K., Sabottke A., Rohde H., Feucht H.-H., Mack D. Biofilm formation by Staphylococcus epidermidis depends on functional RsbU, an activator of the sigB operon: differential activation mechanisms due to ethanol and salt stress. Journal of Bacteriology. 2001;183(8):2624–2633. doi: 10.1128/jb.183.8.2624-2633.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Arciola C. R., Campoccia D., Gamberini S., Cervellati M., Donati E., Montanaro L. Detection of slime production by means of an optimised Congo red agar plate test based on a colourimetric scale in Staphylococcus epidermidis clinical isolates genotyped for ica locus. Biomaterials. 2002;23(21):4233–4239. doi: 10.1016/s0142-9612(02)00171-0. [DOI] [PubMed] [Google Scholar]
  • 35.Ammendolia M. G., Di Rosa R., Montanaro L., Arciola C. R., Baldassarri L. Slime production and expression of the slime-associated antigen by staphylococcal clinical isolates. Journal of Clinical Microbiology. 1999;37(10):3235–3238. doi: 10.1128/jcm.37.10.3235-3238.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Hamadi F., Latrache H., Mabrrouki M., et al. Effect of pH on distribution and adhesion of Staphylococcus aureus to glass. Journal of Adhesion Science and Technology. 2005;19(1):73–85. doi: 10.1163/1568561053066891. [DOI] [Google Scholar]
  • 37.Cha J.-O., Park Y.-K., Lee Y. S., Chung G. T. In vitro biofilm formation and bactericidal activities of methicillin-resistant Staphylococcus aureus clones prevalent in Korea. Diagnostic Microbiology and Infectious Disease. 2011;70(1):112–118. doi: 10.1016/j.diagmicrobio.2010.11.018. [DOI] [PubMed] [Google Scholar]
  • 38.Kawamura H., Nishi J., Imuta N., et al. Quantitative analysis of biofilm formation of methicillin-resistant Staphylococcus aureus (MRSA) strains from patients with orthopaedic device-related infections. FEMS Immunology and Medical Microbiology. 2011;63(1):10–15. doi: 10.1111/j.1574-695x.2011.00821.x. [DOI] [PubMed] [Google Scholar]
  • 39.Maira-Litrán T., Kropec A., Abeygunawardana C., et al. Immunochemical properties of the Staphylococcal poly-N-acetylglucosamine surface polysaccharide. Infection and Immunity. 2002;70(8):4433–4440. doi: 10.1128/iai.70.8.4433-4440.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.O'Neill E., Pozzi C., Houston P., et al. A novel Staphylococcus aureus biofilm phenotype mediated by the fibronectin-binding proteins, FnBPA and FnBPB. Journal of Bacteriology. 2008;190(11):3835–3850. doi: 10.1128/jb.00167-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Heilmann C. Adhesion mechanisms of staphylococci. In: Linke D., Goldman A., editors. Bacterial Adhesion: Chemistry, Biology and Physics. Vol. 715. Berlin, Germany: Springer; 2011. pp. 105–123. (Advances in Experimental Medicine and Biology). [DOI] [PubMed] [Google Scholar]
  • 42.Kohn W. G., Harte J. A., Malvitz D. M., Collins A. S., Cleveland J. L., Eklund K. J. Guidelines for infection control in dental health care settings—2003. The Journal of the American Dental Association. 2004;135(1):33–47. doi: 10.14219/jada.archive.2004.0019. [DOI] [PubMed] [Google Scholar]
  • 43.Elasri M. O., Thomas J. R., Skinner R. A., et al. Staphylococcus aureus collagen adhesin contributes to the pathogenesis of osteomyelitis. Bone. 2002;30(1):275–280. doi: 10.1016/s8756-3282(01)00632-9. [DOI] [PubMed] [Google Scholar]
  • 44.Peacock S. J., Foster T. J., Cameron B. J., Berendt A. R. Bacterial fibronectin-binding proteins and endothelial cell surface fibronectin mediate adherence of Staphylococcus aureus to resting human endothelial cells. Microbiology. 1999;145(12):3477–3486. doi: 10.1099/00221287-145-12-3477. [DOI] [PubMed] [Google Scholar]
  • 45.Monecke S., Luedicke C., Slickers P., Ehricht R. Molecular epidemiology of Staphylococcus aureus in asymptomatic carriers. European Journal of Clinical Microbiology α Infectious Diseases. 2009;28(9):1159–1165. doi: 10.1007/s10096-009-0752-2. [DOI] [PubMed] [Google Scholar]
  • 46.Trotonda M. P., Manna A. C., Cheung A. L., Lasa I., Penadés J. R. SarA positively controls Bap-dependent biofilm formation in Staphylococcus aureus . Journal of Bacteriology. 2005;187(16):5790–5798. doi: 10.1128/jb.187.16.5790-5798.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Valle J., Toledo-Arana A., Berasain C., et al. SarA and not sigmaB is essential for biofilm development by Staphylococcus aureus . Molecular Microbiology. 2003;48(4):1075–1087. doi: 10.1046/j.1365-2958.2003.03493.x. [DOI] [PubMed] [Google Scholar]
  • 48.Beenken K. E., Blevins J. S., Smeltzer M. S. Mutation of sarA in Staphylococcus aureus limits biofilm formation. Infection and Immunity. 2003;71(7):4206–4211. doi: 10.1128/iai.71.7.4206-4211.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES