Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Nov 1.
Published in final edited form as: Dev Dyn. 2016 Aug 29;245(11):1066–1080. doi: 10.1002/dvdy.24437

Embryogenesis and early skeletogenesis in the Antarctic Bullhead notothen, Notothenia coriiceps

John H Postlethwait 1, Yi-lin Yan 1, Thomas Desvignes 1, Corey Allard 2, Tom Titus 1, Nathalie R Le François 2, H William Detrich III 2
PMCID: PMC5065385  NIHMSID: NIHMS809314  PMID: 27507212

Abstract

Background

Environmental temperature influences rates of embryonic development, but a detailed staging series for vertebrate embryos developing in the sub-zero cold of Antarctic waters is not yet available from fertilization to hatching. Given projected warming of the Southern Ocean, it is imperative to establish a baseline to evaluate potential effects of changing climate on fish developmental dynamics.

Results

We studied the Bullhead notothen (Notothenia coriiceps), a notothenioid fish inhabiting waters between −1.9 and +2 °C. In vitro fertilization produced embryos that progressed through cleavage, epiboly, gastrulation, segmentation, organogenesis, and hatching. We compared morphogenesis spatially and temporally to zebrafish and medaka. Experimental animals hatched after about six months to early larval stages. To help understand skeletogenesis, we analyzed late embryos for expression of sox9, and runx2, which regulate chondrogenesis, osteogenesis, and eye development. Results revealed that, despite its prolonged developmental time course, N. coriiceps embryos developed similarly to those of other teleosts with large yolk cells.

Conclusions

Our studies set the stage for future molecular analyses of development in these extremophile fish. Results provide a foundation for understanding the impact of ocean warming on embryonic development and larval recruitment of notothenioid fish, which are key factors in the marine trophic system.

Introduction

As temperature decreases, reaction rates slow, binding equilibria change, and diffusion slackens (Hochachka and Somero, 2002; Peck, 2016). These realities pose challenges to organismal development at low temperatures. Many ectothermic organisms, however, including Antarctic notothenioid fish, develop and thrive in the icy environment of the Southern Ocean (Cheng and Detrich, 2007). Although Antarctic organisms have evolved biochemical and physiological adaptations that compensate for their thermal challenges, we understand little about the molecular changes that maintain embryonic development at low temperatures. Furthermore, the paucity of information on notothenioid embryos leaves us poorly prepared to predict the impact of a warming Southern Ocean on recruitment of these fish to the Antarctic marine ecosystem.

Antarctic notothenioids are an endemic and cold-adapted fish fauna whose evolution was driven by the cooling of the Southern Ocean from about 15°C 25–40 million years ago to the current temperature of −1.9 to +2°C (DeWitt, 1971; Lawver LA et al., 1991; Lawver LA et al., 1992; Eastman, 1993; Eastman and Clarke, 1998; DeConto and Pollard, 2003; Scher and Martin, 2006). Several novel traits arose by mutation and natural selection during the 5–10 million years of isolation these animals experienced in their chronically icy environment. Prominent features include constitutive expression of protective antifreeze proteins (Chen et al., 1997; Cheng and Chen, 1999), modification of the microtubule cytoskeleton to function at low temperature (Detrich et al., 1989; Detrich et al., 2000; Redeker et al., 2004), and loss of an inducible heat shock protein response (Hofmann et al., 2000; Buckley et al., 2004; Detrich et al., 2012). In addition, the icefish clade of notothenioids lost hemoglobin expression (Cocca et al., 1995; Zhao et al., 1998; Near et al., 2006) and relinquished robustly mineralized skeletons (Albertson et al., 2009; Albertson et al., 2010; Eastman et al., 2014). These and other evolutionary changes, some of which involve gene loss, others of which may involve gene duplications (Chen et al., 2008; Coppe et al., 2012), and still others that likely derive from changes in gene expression, restrict notothenioids to a narrow thermal regime. Because some of these adaptive traits may be difficult to reverse, the survival of the stenothermal notothenioids in the coastal waters surrounding Antarctica is threatened by rapid ocean warming, currently estimated at about 1–2 °C per century (Gille, 2002; Somero, 2005; Clarke et al., 2007; Ducklow et al., 2007; Portner et al., 2007; Portner and Farrell, 2008; Patarnello et al., 2011).

An open question is the extent to which embryonic development might be sensitive to thermal perturbation. Under one view, functional specializations to millions of years of unchanging cold require a trade-off in tolerance to warmer temperatures (Portner et al., 2007). On the other hand, embryos might possess adaptive responses to environmental change that buffer thermal stress or provide alternative developmental patterns (Hamdoun and Epel, 2007). One hypothesis is that adaptive plasticity protects Antarctic Notothenioid embryos sufficient to maintain normal, but more rapid, development at temperatures that coincide with the upper incipient lethal temperatures of adults (Somero and DeVries, 1967). An alternative possibility, however, is that embryos are more sensitive to thermal change than are adults, so that above a temperature to which adults might acclimate, critical developmental processes in embryos might become decoupled, or fail entirely, resulting in aberrant embryogenesis (Flynn et al., 2015).

Even if development is morphologically and functionally normal at the temperatures that Antarctic fish are likely to experience in the next century or so, altered developmental rates might still pose a threat. Developmental rates in fish depend on temperature (Schirone and Gross, 1968; Scott and Johnston, 2012; Schnurr et al., 2014; Pype et al., 2015; Peck, 2016). The consequence of more rapid embryonic development with increasing temperature depends partially on how embryos control the time at which they hatch. Under one hypothesis, embryos developing in warmer water will develop more rapidly but then enter a developmental hiatus until their normal time of hatching, which might be dictated by the returning sun in the austral spring (White and Burren, 1992; Evans et al., 2005). Under this scenario, larvae would have regulatory mechanisms that synchronize their time of hatching to match the return of the sun, which accelerates growth of the phytoplankton that nourish zooplankton, which in turn supply food for fish larvae. Under an alternative hypothesis, however, notothenioid larvae would hatch as soon as they become mature, independent of time of year (Sapota, 1999). If this hypothesis is correct, then larvae would emerge prematurely, when prey is scarce; this outcome would likely be disastrous for the notothenioid fish of the Southern Ocean because larvae would starve. Our goal in this investigation is to describe in detail the embryonic development of a High Antarctic notothenioid, the Bullhead notothen (aka yellowbelly rockcod) Notothenia coriiceps, in its normal, historical temperature regime (−1.9 to +2 °C). This work thereby provides a baseline for assessing the effects of projected oceanic warming on embryogenesis and larval recruitment to adult populations.

N. coriiceps has a circum-Antarctic distribution and is one of the dominant inshore demersal fishes down to depths of about 450 meters in the waters of the Antarctic Peninsula (DeWitt, 1971; Gon and Heemstra, 1990). Fertilization occurs by broadcast spawning, and embryos inhabit the upper five meters of the water column as development proceeds over about seven months (spawning in May and June to hatching in December and January) (Sapota, 1999). N. coriiceps is currently the only notothenioid with an available sequenced genome (Shin et al., 2012; Shin et al., 2014). To initiate this project, we collected adult N. coriiceps off the Antarctic Peninsula, produced embryos by in vitro fertilization at Palmer Station, Antarctica, and transported embryos to the University of Oregon to monitor their development through hatching. Results revealed that N. coriiceps embryos develop in a manner similar in many ways to those of fish inhabiting more temperate climates, like zebrafish, and especially like medaka, and stickleback, but at much slower rates. Studies showed that N. coriiceps larvae hatched after consuming virtually all of their yolk, which raises concern over the timing of their hatching as Antarctic water temperature rises. In situ hybridization experiments on N. coriiceps embryos showed that key skeletal regulatory genes, including the cartilage regulators sox9a and sox9b and the osteoblast regulator runx2a, are expressed in a fashion similar to temperate model fish species. Finally, our results provide the critical foundation for comparing the mechanisms that regulate bone mineral density in robustly ossified notothenioids (e.g., N. coriiceps) vs. closely related Notothenioids that have osteopenic (low bone mineral density) skeletons (e.g., icefishes and some notothens) (Eastman and DeVries, 1982; Eastman, 1993; Eastman, 1997; Eastman and Sidell, 2002; Albertson et al., 2009; Near et al., 2009; Albertson et al., 2010; Eastman et al., 2014).

Results and Discussion

Gametes and in vitro fertilization

Despite the importance of notothenioid fishes to the trophic structure of the Southern Ocean, only incomplete descriptions of their gametes are available. To address this knowledge gap, we collected eggs and milt (Fig. 1A, B) from sexually mature N. coriiceps by stripping, the application of gentle pressure to their abdomens. Figure 1C shows that the heads of N. coriiceps sperm were pyramidal in shape, in contrast to the round or oval heads of sperm from zebrafish or medaka (Hong et al., 2004; Hagedorn et al., 2009). N. coriiceps sperm tails were attached eccentrically to the head and were about 22.3 μm ± 3.8 μm SD) long (N = 13). Many sperm tails possessed a cytoplasmic droplet (Fig. 1C, arrows) generally positioned approximately 23% (± 9%) of the length of the sperm tail away from the sperm head. Cytoplasmic droplets along sperm tails represent a portion of germ cell cytoplasm that adheres to the tail after most of the cytoplasm has been removed and phagocytozed by Sertoli cells (Cooper, 2005). When examined by thin-section electron microscopy, N. coriiceps sperm tails have been found to be conventional in structure, with a 9+2 microtubular axoneme, inner- and outer-arm dyneins, and radial spokes with no lateral fins (King et al., 1997; Falugi et al., 1999).

Figure 1.

Figure 1

Open in a new tab

Gametes of N. coriiceps. A. Eggs were softly squeezed from anaesthetized females. B. Sperm was gently pressed from anaesthetized males. C. Sperm tails, averaging 23μm long, often had a cytoplasmic droplet near the head (arrows). D. In unfertilized eggs (u), which were almost 5 mm in diameter, lipid droplets pressed near to the oocyte surface. In fertilized eggs (f), large lipid droplets disappeared before the first cleavage division. E. Clusters of lipid droplets in an unfertilized egg were rather regularly spaced.

N. coriiceps eggs in our clutches after ovulation in seawater had a diameter of 4.93 ± 0.09 mm (N = 14) (Fig. 1D), which is slightly larger than values reported previously (4.45 mm – 4.6 mm (Kellerman, 1991; Sapota, 1999) and substantially larger than the diameters of eggs from some other Antarctic and Sub-Antarctic notothenioids, such as Pleuragramma antarcticum (Antarctic silverfish, ~2.0 mm) (Shust et al., 1984; Hubold, 1990; Koch and Kellerman, 1991; Bottaro et al., 2009), Gymnodraco acuticeps (Naked dragonfish, ~3.4 mm) (Evans et al., 2005), Patagonotothen ramsayi (Patagonian rockcod (aka notothen), ~2.2 mm) (Arkhipkin et al., 2013), Cottoperca gobio (Channel bull blenny, 2.1–2.4 mm) (Arkhipkin et al., 2015), Chaenocephalus aceratus (blackfin icefish, 3.0 or 3.7 mm) (Militelli et al., 2015; Riginella et al., 2016), Champsocephalus gunnari (mackerel icefish, 1.65 or 3.2 or 3.7 mm) (Kock, 1981; Duhamel et al., 1993; Militelli et al., 2015), Pseudochaenichthyes georgianus (3.0 mm, (Militelli et al., 2015), and Dissostichus eleginoides (Patagonian toothfish, ~4.5 mm (Evseenko et al., 1995)).

Unfertilized N. coriiceps eggs contained substantial numbers of oil droplets located superficially beneath the plasma membrane (Fig. 1D). Droplets were organized into clusters of three to five larger droplets and several smaller “satellite” droplets (Fig. 1E). Clusters of oil droplets were not randomly distributed, but were nearly equally spaced in quasi-hexagonal packing (Fig. 1E). After fertilization, superficial oil droplets were no longer visible (Fig. 1D). Unfertilized eggs of medaka and stickleback also contain large oil droplets, but they are less regularly arranged; in medaka, they displace toward the vegetal pole and coalesce after fertilization (Chen et al., 2008), whereas in stickleback they are relatively larger and do not change dramatically in the zygote (Swarup, 1958).

N. coriiceps zygotes were translucent, buoyant, and floated independently of each other at the surface of seawater aquaria, as expected given their prevalence in neustonic collections from the Southern Ocean (North and White, 1987; Kellerman, 1991). In contrast, eggs and zygotes of the Blackfin icefish Chaenocephalus aceratus, the Naked dragonfish G. acuticeps, the Patagonian rockcod Patagonotothen ramsayi and several other species are negatively buoyant and are laid in circular mounds, shallow depressions, or on rocks on the ocean floor (Detrich HW et al., 2005; Evans et al., 2005; Kock et al., 2008; Jones and Near, 2012; Arkhipkin et al., 2013). Several species of Antarctic Notothenioids brood their offspring, while the Chionodraco hamatus male builds the nest using seasonally-modified, club-like anal fins and the female subsequently guards eggs in the nest (Ferrando et al., 2014) (see (Ferrando et al., 2014) for review).

Cleavage Stages

Several hours after fertilization, cytoplasm in the N. coriiceps zygote began to accumulate in a thin cap at the animal pole to form the first cell (Fig. 2A), which ultimately attained a diameter of about 0.64 mm. Pronounced elevation of the first cell above the yolk, which occurs in one-cell embryos of zebrafish, medaka, and stickleback (Swarup, 1958; Kimmel et al., 1995; Iwamatsu, 2004), did not occur in N. coriiceps zygotes. As in most fishes, reptiles, and birds (Gilbert, 2013), N. coriiceps zygotes showed meroblastic, discoidal cleavage (Fig. 2), forming a blastodisc on the yolk cell. Cleavage furrows between initial blastomeres failed to completely penetrate the yolk.

Figure 2.

Figure 2

Open in a new tab

Cleavage stages of N. coriiceps embryos, polar views. A. One cell stage, 0.25 dpf. B. 2 cell stage, 1.0 dpf. C. 4 cell, 1.33 dpf. D. 8 cell, 2 dpf. E. 16 cell, 2.5 dpf. F. 64 cell, 3.33 dpf. G. 256 cell, 3.75 dpf. H. 1K cell, 4.9 dpf. I. Rate of cleavage divisions, with inserts showing entire eggs of one- and two-cell embryos. Scale bar in A: 100μm.

By 24 hours post fertilization (hpf), the first cell had cleaved to yield two daughter cells separated by a birefringent cleavage furrow (Fig. 2B). The long axis of the two daughter cells measured 1.27 mm. By 36 hpf, the second cleavage had occurred at right angles to the first, resulting in four cells. As in the first cleavage, a birefringent cleavage furrow separated each pair of daughter cells (Fig. 2C). Cleavage furrows did not undercut any of the cells at this stage (Fig. 3A). The third cleavage (2 dpf) produced a flat, oval disc containing eight wedge-shaped cells (Fig. 2D); in contrast, the third cleavage in embryos of zebrafish, medaka, stickleback, and even the Sub-Antarctic notothenioid P. ramsayi, produces two rows of four roughly square cells (Swarup, 1958; Kimmel et al., 1995; Iwamatsu, 2004). The third cleavage furrows formed at approximately 45° angles with respect to the nearly perpendicular axes defined by the first two cleavage planes (Fig. 3B), thus differing from the perpendicular orientation of the third cleavage plane with respect to the second in zebrafish, medaka, and stickleback embryos.

Figure 3.

Figure 3

Open in a new tab

N. coriiceps cleavage stages. A. Four-cell embryo showing the edge of the embryonic cytoplasm and the location of the second cleavage plane. B. Late 4-cell embryo beginning the third cleavage division. C. Polar view of a 64-cell stage embryo showing cells of the upper tier; arrows indicate the borders of six upper level cells. D. Polar view focused on the lower tier of cells from a 64-cell embryo. E. Face view of a 64-cell embryo showing two tiers of cells. F. Face view of the same 64-cell embryo as in E, but focused on marginal cells. G. Face view of a 128-cell embryo showing the rounded nature of the marginal cells and three cell tiers. H. Face view of 256-cell embryo shows marginal cells beginning to flatten onto the yolk. I. Polar view of 512-cell stage embryo showing that the marginal cells have fused with the underlying yolk cell to form the yolk syncytial layer. J. Polar view of the edge of a 512-cell embryos showing the large nuclei (arrows) of marginal cells. Abbreviations: c, cytoplasm; cc, central cell; cf3, third cleavage furrow; cp1 and cp2, first and second cleavage planes; mc, marginal cell; pm, plasma membrane; s, intercellular space; y, yolk cell.

At 2.5 dpf (62 hpf), the fourth cleavage division produced two cleavage planes roughly parallel to the long axis of the oval 8-cell stage, yielding a 16-cell blastodisc with an outer ring of ten cells surrounding an inner group of two rows containing three cells each (Fig. 2E), similar to the naked dragonfish Gymnodraco acuticeps (Evans et al., 2005). In comparison, the 16-cell zebrafish embryo contains four parallel rows of four cells each, whereas medaka and stickleback embryos have an outer ring of 12 cells enclosing four inner cells (Swarup, 1958; Kimmel et al., 1995; Iwamatsu, 2004).

In polar view, 32-cell N. coriiceps embryos (2.9 dpf) retained a roughly circular shape with large, wedge-shaped marginal cells and smaller central cells (data not shown); in contrast, the zebrafish embryo shows a rectangular pattern with four rows of eight cells of equal size (Kimmel et al., 1995). The surface area of the 64-cell stage embryo (3.33 dpf) was about the same as the original 1-cell blastodisc. At the 64-cell stage (Fig. 2F), the outer rim of the N. coriiceps blastodisc contained 19 or 20 large marginal cells (N = 4) that formed clearly defined rounded, lateral borders with the yolk cell (Fig. 3C, F). The center of the 64-cell embryo possessed two cell layers: 1) an upper tier of small round cells (Fig. 3C, E), and 2) a lower layer of cells that was only partially separated from the yolk; substantial spaces usually separated neighboring cells of the lower tier (Fig. 3D, E). In zebrafish, some blastomeres similarly begin to cover others at the 64-cell stage, forming an embryo with two cellular layers (Kimmel et al., 1995).

In ‘face view’ (Kimmel et al., 1995) (side view), 128-cell embryos (3.5 dpf) had marginal cells that retained a rounded shape adjacent to the yolk and had three cell layers centrally (Fig. 3G). At the 256-cell stage, cells at the margin of the embryo began to flatten onto the yolk (Fig. 3H), and by the 512-cell stage (4.4 dpf), marginal cells had lost their rounded shape and had flattened on the yolk cell to form the yolk syncytial layer (Fig. 3I), as the embryo prepared for epiboly. The zebrafish embryo also forms its YSL at the 512-cell stage (Kimmel et al., 1995). Cells in the N. coriiceps YSL, like those in zebrafish (Twelves and Bachop, 1980; Kimmel et al., 1995), contained large, polyploid nuclei (Fig. 3J). Between the 256- and 1K- (approximately 1000) cell stage (4.9 dpf), the N. coriiceps blastodisc developed a hexagonal or octagonal profile as some cellular regions advanced further onto the yolk than others, producing corners (Fig. 2G–H).

The rate of cleavage of N. coriiceps embryos was slow, as expected given the low temperature of their habitat. Figure 2I plots the number of cleavage divisions vs. developmental time. The first cleavage division required about 24 hours, and the next eight divisions occurred at a regular rate of 0.45 days/division at −1°C, such that the 1K-cell stage appeared by 5 dpf. Naturally spawned ichthyoplankton samples netted from waters around Admiralty Bay, King George Island, and South Shetlands contained N. coriiceps embryos (2- and 4-cell embryos on 1 June 1990, 16-cell on 6 June, and 40% epiboly on 12 June) (Sapota, 1999), indicating that our in vitro fertilizations on 7 and 14 June coincided with breeding in the wild. Furthermore, the temporal sequence of naturally spawned embryo collections roughly conforms to our measurements of developmental rate in the laboratory (Figs. 2I, 4J). Eggs of Notothenia rossii cultured at about 3°C in the Kerguelen Islands reached the 8-cell stage of cleavage in two days (Camus and Duhamel, 1985). In contrast, Naked dragonfish G. acuticeps embryos developed even more slowly than those of N. coriiceps – the 64-cell stage was reached at 144 hpf (Evans et al., 2005) rather than the 80 hpf observed for N. coriiceps. The slow development of Antarctic notothenioid embryos is in striking contrast to embryonic developmental rates for model tropical fishes. For example, zebrafish embryos cultured at 28.5 °C reach the 1K-cell stage by 0.125 dpf (Kimmel et al., 1995), a cleavage rate 40X more rapid than observed for N. coriiceps at its habitat temperature.

Figure 4.

Figure 4

Open in a new tab

Epiboly. A. 11- dpf embryo, lateral view. B. 12- dpf embryo, lateral view. C. 12- dpf embryo, animal pole view. D. 15- dpf embryo showing the embryonic shield (embryonic axis). E. 16- dpf embryo, close-up of the germ ring. F. 18- dpf embryo, lateral view. G. 19- dpf embryo, lateral view. H. 20- dpf embryo, lateral view. I. 21- dpf embryo, vegetal pole view showing the yolk plug. J. Percent epiboly versus developmental time. The arrow in each panel indicates the extent of epiboly and the germ ring. Abbreviations: ea, embryonic axis; gr, germ ring; sh, embryonic shield; yp, yolk plug.

Epiboly and gastrulation

In the process of epiboly, a fish embryo’s blastoderm expands toward the vegetal pole until it engulfs the yolk cell while commencing gastrulation, which occurs by involution/ingression and by convergence-extension, forming the embryonic shield that gives rise to the early embryonic axis (Kimmel et al., 1995; Gilbert, 2013). In N. coriiceps embryos, epiboly began after the 1K-cell stage. At 7% epiboly (9 dpf), marginal cells began to spread over the yolk cell, and by 11 dpf the embryo reached 13% epiboly (Fig. 4A). At 15% epiboly (12 dpf), marginal embryonic cells formed the germ ring (Fig. 4B, C). The circumference of the YSL migrated ahead of the overlying marginal blastoderm cells as a thin, raised edge (arrows, Fig. 4). The embryonic shield appeared at 12 dpf, indicating that gastrulation had begun (Fig. 4C, D); zebrafish cultured at 28.5C reach the shield stage at 0.25 dpf (Kimmel et al., 1995) and stickleback grown at 18°–19°C reach shield stage at 1.1 dpf (Swarup, 1958). After 12 dpf, the rate of epiboly in N. coriiceps embryos accelerated (Fig. 4J), such that 39% epiboly was achieved at 15 dpf and 74% epiboly at 19 dpf (Fig. 4D–H). During this period, the embryonic axis elongated as the blastoderm margin approached the vegetal pole, and the axis was clearly visible in oblique view (Fig. 4F–H). By 20 dpf (91% epiboly), the germ ring formed an ellipsoid with the embryonic axis extending from one end of the ellipsoid’s major axis (Fig. 4H). At 21 dpf, epiboly was nearly complete, and a vegetal pole view showed that the yolk plug was ringed with vesicles (Fig. 4I). In contrast, zebrafish embryos arrive at the yolk-plug stage at 0.42 dpf (Kimmel et al., 1995) and stickleback embryos at 1.75 dpf (Swarup, 1958). To our knowledge, this is the first detailed description of epiboly for an Antarctic notothenioid.

Segmentation

During segmentation, vertebrate embryos elongate along their anterior-posterior axis, begin somitogenesis, and form organ primordia (Kimmel et al., 1995; Gilbert, 2013). Figures 4D–H show that the embryonic axis of N. coriiceps embryos extended towards the animal pole over a six-day period as the germ ring migrated towards the vegetal pole. Initially, the embryonic axis of 12-day embryos (15% epiboly) was visible as a thickening of the germ ring with isolated cells loosely associated at its edges (Fig. 5A, B). By 13 dpf, the axis had begun to elongate as cells of the central shield compacted into a tight, flat mass that was surrounded laterally and rostrally by a large number of individual cells (Fig. 5C). These early segmentation events of the N. coriiceps embryo are similar to those documented for other teleosts by cell marking and time-lapse video analyses (Warga and Kimmel, 1990).

Figure 5.

Figure 5

Open in a new tab

The embryonic axis and segmentation. A. Animal pole view of a 12- dpf N. coriiceps embryo showing the germ ring and the thickening of the embryonic axis. B, C. Higher magnification of 12- dpf (B) and 13- dpf (C) embryos showing individual cells densely packed along the axis but more loosely organized laterally and rostrally away from the germ ring. D–G. 21- dpf embryo with developing eye, four somites, and several vesicles near the future location of Kupffer’s vesicle. H–I. 23- dpf embryo. J–L. 25- dpf embryo. M. 26- dpf embryo. Abbreviations: br, brain; cns, central nervous system; e, eye; ea, embryonic axis; gr, germ ring; kv, Kupffer’s vesicle precursors and mature vesicle; m, mesoderm; no, notochord; nt, neural tube; op, otic placode; s, somites; s#, somite number.

N. coriiceps embryos began segmentation by 21 dpf, when four clearly delineated somites had formed (Fig. 5D, F). The 21-dpf embryo also possessed a rudimentary head with optic vesicles (Fig. 5D, E), and several small vesicles had begun to accumulate near the future site of Kupffer’s vesicle at the junction of the embryonic axis with the blastopore (Fig. 5D, G); Kupffer’s vesicle was not completed until 23 dpf. Zebrafish embryos at a comparable stage (5-somites, 11.7 hpf) have also formed optic vesicles and a single Kupffer’s vesicle (Kimmel et al., 1995). Between 21 and 26 dpf, N. coriiceps embryos displayed a beak-like protrusion (Fig. 5D, E, H, J, M) rostral to the central nervous system, a feature also seen in medaka, but not zebrafish, embryos (Iwamatsu, 2004). N. coriiceps embryos had developed nine somites by 23 dpf, 13 by 25 dpf, and 15 by 26 dpf (Fig. 5H–J, L, M). Patches of mesoderm rostral to the first somite were observed lateral to the axis in embryos 23 days or older (Fig. 5H, J, M). Lenses became visible in 25 dpf embryos (Fig. 5K). Rough sketches of some of these stages appear in (White et al., 1982).

When one clutch was 25 dpf and the other was 32 dpf, N. coriiceps embryos were shipped from Palmer Station to the University of Oregon. On arrival, seawater surrounding the embryos was frozen, but nearly all embryos survived. Adult levels of antifreeze proteins accumulate in some Antarctic notothenioid embryos and larvae, but not in others, which rely on underdeveloped gills and physical barriers, such as the chorion or integument to prevent freezing (Cziko et al., 2006). We do not yet know which strategy protected the N. coriiceps embryos in our experiments, although our RNA-seq analyses of N. coriiceps embryos identified sequences predicted to encode proteins (unpublished) similar to other notothenioid antifreeze glycoproteins (DeVries, 1988; DeVries and Cheng, 1992; Cziko et al., 2006) and similar sequences have been identified in adult N. coriiceps liver transcripts (Shin et al., 2012).

Sense organs developed similar to those in other fish embryos. At 35 dpf, N. coriiceps embryos possessed otic vesicles (Fig. 6A). By 61 dpf, embryos had formed 69 somites (Fig. 6B) and cephalic sense organs were well developed, including ears with otoliths and eyes with lenses (Fig. 6C). In zebrafish, otoliths first appear at 14 hpf (10-somites) and lenses appear at 19.5 hpf (21-somites) (Kimmel et al., 1995).

Figure 6.

Figure 6

Open in a new tab

35 and 61 dpf N. coriiceps embryos. A. 35 dpf embryo. B–E. 61 dpf embryos. B. Entire embryo. C. Head showing hatching gland cells, eyes, and ears. D. Close-up showing hatching gland cells extending over the head. D. Heart and limb buds. Abbreviations: aer, apical epidermal ridge; br, brain; df, dorsal fin; e, eye; fb, fin bud; he, heart; hg, hatching gland cells; l, lens; no, notochord; ol, otoliths; ov, otic vesicle; pc, pigmented cells; r, retina; vf, ventral fin.

The hatching gland of N. coriiceps embryos contained large cells present at the surface of the yolk cell in front of the embryo and over the posterior portion of the eyes (Fig. 6C, D). In zebrafish, the hatching gland first appears at 25 hpf as a confined, chevron-shaped organ on the yolk sac near the pericardium just in front of and ventral to the embryo’s head (Kimmel et al., 1995); it does not extend up over the head as it does in N. coriiceps. In 61 dpf N. coriiceps embryos, pectoral fin buds had formed with a clearly defined apical epidermal ridge (Fig. 6E). Pigmented cells began to accumulate caudal and medial to the eyes (Fig. 6C), as in P. antarcticum (Vacchi et al., 2004; Bottaro et al., 2009). The heart and its valves had also formed in 61-dpf N. coriiceps embryos (Fig. 6E) as in late P. antarcticum embryos (Bottaro et al., 2009). For the first time, we document the heartbeat of Antarctic embryos, once every four seconds in Movie S1 in Supplementary Materials. The temperature of the embryo gradually raised from the culture conditions of −1C to about 5C during filming, so the rate in normal conditions is likely much slower.

Late embryos and hatchlings

By five months post-fertilization (132 dpf), embryos had reached 12 mm in length and possessed a prominent dorsomedial fin (Fig. 7A). This remarkable dorsomedial fin extended from an origin at the midline just dorsal to the upper lip, extended along the midline dorsal to the eyes, continued over the head and trunk, and fused with the caudal fin. A dorsal fin originating this far rostrally has not been described, even for N. coriiceps, (Kellermann, 1989; Kellerman, 1990; North and Kellermann, 1990; Evans et al., 2005), although a sketch shows it in a 134 dpf N. coriiceps embryo (White et al., 1982). Prominent dorsal fins are visible in photographs of hatched larvae of the sub-Antarctic notothenioid P. ramseyi (Arkhipkin et al., 2013) and other Notothenioids, but do not show a dorsal fin originating so far dorsally (Kellermann, 1989; Kellerman, 1990). At five months, the otic vesicle had formed two of the three otoliths found in adult notothenioids (Motta et al., 2009) and melanocytes had accumulated as a dorsal cap over the brain and along the junction of the yolk cell with the body wall. By 132 dpf, the heart had developed and was already pumping red blood cells (Fig. 7A insert), demonstrating that erythropoiesis was well under way in this red-blooded notothenioid fish. Despite our finding of erythrocytes in N. coriiceps embryos, reports suggest that embryonic erythrocytes in N. coriiceps do not have hemoglobin, although larvae do (White et al., 1982). RNA-seq experiments in progress will reveal the timing of expression of erythropoietic genes in this species. In zebrafish, erythrocytes containing embryonic hemoglobin begin circulating at 1 dpf (e.g., (Jing and Zon, 2011)).

Figure 7.

Figure 7

Open in a new tab

Late embryos and hatchlings. A. Five month (132 dpf) larva, showing the dorsal fin with an anterior origin just dorsal to the mouth (arrowhead). Insert in A: heart with blood cells. B. Hatchling, six months post-fertilization (166 dpf). C. Larva at 132 dpf. Abbreviations: bc, blood cells; cf, caudal fin; df, dorsal fin; e, eye; h, heart; m, melanocytes; ov, otic vesicle; pf, pectoral fin bud; vf, ventral fin; y, yolk; ys, yolk sac; arrows indicate margins of the dorsal and ventral median fins.

In our experiments, larvae began hatching approximately six months after fertilization. This timing is about the same as reported for the hatching of N. coriiceps in the wild near King George Island (seven months (Sapota, 1999)), and five months at Signy Island (White et al., 1982) with hatching in December and late November, respectively. For comparison, the Sub-Antarctic Patagonian rockcod Patagonotothen ramsayi, when cultured at its habitat temperature of 5–6°C, hatches in just 24 days (Arkhipkin et al., 2013). The first recorded natural mating of Antarctic fish in the Northern Hemisphere involved a pair of Chionodraco hamatus (hooknose icefish, see (Desvignes et al., 2016) for etymology) that had been cultured for three years at −1°C in an Italian aquarium; mating occurred in February and hatching in late June, about 19 weeks after fertilization (Ferrando et al., 2014). In the Ross Sea, Pleuragramma antarcticum appears to hatch in November, about four months after fertilization (Vacchi et al., 2012). For the naked dragonfish Gymnodraco acuticeps, egg incubation takes ten months, and animals hatch in September, shortly after the sun clears the horizon (Evans et al., 2005). The icefish Chionobathyscus dewitti appear to hatch in September or October (Koch et al., 2006) and the spiny icefish Chaenodraco wilsoni in August or early September (Kock et al., 2008). Although information is scarce, for several species of notothenioids, hatching appears to occur as the Sun returns in the Spring, spurring the growth of phytoplankton and hence a bloom of zooplankton on which fish larvae depend for food.

Hatchling length (Fig. 7B) averaged 14 mm. Hatchlings possessed a tall dorsomedial fin that was as high as the body was deep, even over the eyes (arrows, Fig. 7B). Similarly, the ventral fin of N. coriiceps larvae formed a deep keel that extended from just behind the yolk and was continuous with the caudal fin (Fig. 7B) similar to other notothenioids (Kellermann, 1989; Kellerman, 1990; North and Kellermann, 1990; Evans et al., 2005). These large fins would be available to catch water currents and thus contribute to the dispersal of these planktonic larvae, facilitate the species’ circum-Antarctic distribution, and promote gene flow (Kellerman, 1991).

The dorsal head and trunk of hatchlings were covered by melanocytes, whereas the lateral and ventral portions of the animals lacked pigmented cells (Fig. 7B, C). This decoration is consistent with dorsal and ventral camouflage that would render hatchlings difficult to discern from above or below. The dentary bone extended in front of the rest of the face to create an underbite and the tip of this projection contained a few melanocytes (Fig. 7B, C). In hatchlings, the yolk sac of N. coriiceps larvae remained large but contained little yolk (Fig. 7B, C, and sketch in (White et al., 1982)), as noted for N. rossii, as well (Camus and Duhamel, 1985). In contrast, comparably staged zebrafish larvae retain substantial yolk that gradually regresses as the animal consumes yolk over several days. If notothen larvae in the wild hatch in the yolk-poor condition we observed, their survival would depend on immediate success in hunting prey. If the warming of the Southern Ocean around the Antarctic Peninsula, which has warmed about 1C in 50 years (Meredith and King, 2005; Ducklow et al., 2007), accelerates the hatching of notothenioid embryos, they are likely to hatch at a time of year before the day length has increased sufficiently to accelerate the growth of the phytoplankton that feeds the zooplankton on which these larvae depend.

Skeletogenesis in N. coriiceps larvae

The benthic Bullhead notothen possesses heavily mineralized bones, while pelagic and benthopelagic icefish have osteopenic skeletons (Eastman et al., 2014). To investigate skeletogenesis in N. coriiceps, we stained hatchlings with Alcian for cartilage and with Alizarin for mineralized bone. In the craniofacial skeleton, the first signs of cartilage formation appeared in the otic vesicle at 70 dpf (Fig. 8A). By 90 dpf, the main skeletal elements of the cranium had formed, including the trabeculae, Meckel’s cartilage, palatoquadrate, hyosymplectic, ceratohyal, and the first three ceratobranchials (Fig. 8B). The fourth ceratobranchial had formed by 100 dpf and the fifth by 110 dpf (Fig. 8C). In zebrafish, the opercle, ceratobranchial-5 (which bears the pharyngeal teeth), the parasphenoid, and a branchiostegal ray are the first craniofacial skeletal elements to ossify (Cubbage and Mabee, 1996). The trabeculae of N. coriiceps larvae had fused and the ethmoid plate had formed by 110 dpf (Fig. 8C). By 128 dpf, the maxilla, dentary, and pharyngeal teeth had begun to mineralize (Fig. 8D–F). The neurocranium and otic capsule were complete by 128 dpf (Fig. 8E). At 141 dpf, the opercle had formed and the marginal elements of the cranium were evident. By 174 dpf, the cranium and third brachiostegal ray had begun to mineralize (Fig. 8G–I).

Figure 8.

Figure 8

Open in a new tab

Skeletal development. A. 70 dpf. B. 90 dpf. C, 110 dpf. D–F, 128 dpf. G–J, 174 dpf. Scale Bar is 1mm. Abbreviations: bb, basibranchial; bh, basihyal; bsr, branchiostegal ray; cb, ceratobranchial; eh, ceratohyal; cl, cleithrum; d, dentary; e, eye; ed, endochondral disk; ep, ethmoid plate; h, hypural; ha, haemal arch; hb, hypobranchial; hs, hyosymplectic: i h, interhyal; m, Meckel’s cartilage; mdz, matrix decomposition zone; mx, maxilla; na, neural arch; not, notochord; oc, otic capsule; op, opercle; ph, parhypural; pq, palatoquadrate; ps, parasphenoid; ra, rays; sco, scapulocoracoid; te, pharyngeal teeth; tr, trabecula.

In the pectoral appendage, the cleithrum and endoskeletal disc were apparent by 90 dpf (Fig. 8B), and the scapulocoracoid and endoskeletal disc had separated by 110 dpf (Fig. 8C). As in zebrafish (Cubbage and Mabee, 1996), the cleithrum was the first pectoral element to mineralize, starting by 110 dpf (Fig. 8C). By 128 dpf, the zone of matrix decomposition in the middle of the endoskeletal disc had appeared (Fig. 8D) and eight or nine fin rays were mineralizing by 174 dpf (Fig. 8I). The tall dorsal fin did not appear to possess ossified supporting skeletal rays, although its margin stained positive for Alcian (Fig. 8J).

In the axial skeleton, hemal spines had developed by 124 dpf (data not shown) and progressed to become hemal arches while the neural spines formed by 174 dpf (Fig. 8J). Hemal and neural spines started to form near the middle of the body and development progressed rostrally and caudally simultaneously rather than arising in an anterior-posterior pattern. In zebrafish, neural arches 6–7 form first, and most of the rest develop nearly simultaneously (Bird and Mabee, 2003). In the caudal axial skeleton, hypural-1 was present by 141 dpf and by 174 dpf, it had fused with hypural-2; parhypural1 was also visible by 174 dpf (Fig. 8J). The axial skeleton was sufficient to support active swimming in the subcarangiform mode as the wave appeared to originate near the caudal end of the yolk and increase in amplitude toward the caudal fin (see Supplementary Movie S2). Larvae tended to prefer the upper centimeter or so of the tank, as would be expected if N. coriiceps were phototactic like G. acuticeps larvae (Evans et al., 2005).

Skeletal gene expression

Transcription factors program skeletal development. Sox9 regulates chondrocyte development and Runx2 controls both chondrocyte hypertrophy and osteoblast differentiation (Otto et al., 1997; Eames et al., 2004; Akiyama, 2008). To investigate gene expression in N. coriiceps embryos, we cloned Sox9 and Runx2 orthologs from cDNAs, cut sections of 4-mpf embryos, and on sequential sections, performed in situ hybridization for sox9a and sox9b (the two fish orthologs of tetrapod Sox9 gene) and runx2b, the Runx2 ortholog expressed in the osteoblasts of most teleosts (Wagner et al., 2003; Flores et al., 2004; Yan et al., 2005; Flores et al., 2006).

Results from single-color in situ hybridization analyses showed that 4 mpf N. coriiceps embryos expressed sox9 genes in a pattern broadly similar to those in other teleosts. In the sensory nervous system (Fig. 9A), N. coriiceps embryos expressed sox9a in the inner nuclear layer and outer nuclear layer of the retina and in the auditory capsule and in sensory elements of the otic vesicle as in zebrafish (Yan et al., 2002). In the central nervous system, embryos expressed sox9a in the ventricular zone of the brain (Fig. 9A). In the pharyngeal skeleton, N. coriiceps embryos expressed sox9a in both the chondrocytes and perichondrium (Fig. 9D). In contrast to sox9a, sox9b transcripts of N. coriiceps embryos appeared in the inner, but not the outer, nuclear layer of the retina, weakly in the otic vesicle, and in a more restricted region in the ventricular zone of the brain (Fig. 9B). In addition, while N. coriiceps embryos expressed sox9b in the chondrocytes of the pharyngeal skeleton, they did not express sox9b in the perichondrium (Fig. 9E), consistent with the pattern in zebrafish and stickleback (Yan et al., 2002; Cresko et al., 2003; Yan et al., 2005). Expression of the ‘master osteoblast organizer’ runx2b (Eames et al., 2004; Schroeder et al., 2005) appeared in the perichondrium of the N. coriiceps pharyngeal skeleton (Fig. 9C, F) as in other teleosts (Flores et al., 2004; Flores et al., 2006).

Figure 9.

Figure 9

Open in a new tab

Expression of skeletal regulator genes in N. coriiceps.

A–F. Single color in situ hybridization experiments on sections of 125 dpf N. coriiceps craniofacial cartilages probed for sox9a (A, D), sox9b (B, E), and runx2b (C, F). G–I. Confocal images of two color fluorescent in situ hybridization experiments on horizontal sections of N. coriiceps embryos at 125 dpf probed with sox9a DIG probe (G), sox9b fluorescent probe (H), and the merged image of sox9a and sox9b expression (I). Abbreviations: ac, auditory capsule; bp, bipolar cell; ch, ceratohyal; cn, chondrocyte; cmz, ciliary marginal zone of the retina; fb, forebrain; inl, inner nuclear layer of the retina, onl, outer nuclear layer of the retina; ov, otic vesicle; pa, pharyngeal arches; pc, perichondrium; pe, pigmented epithelium; pq, palatoquadrate; vz, ventricular zone of the brain.

Double fluorescent in situ hybridization studies on 4 mpf N. coriiceps embryos confirmed different expression patterns of the two N. coriiceps sox9 ohnologs (Fig. 9G–I). The merging of the two patterns clearly showed sox9b expression in the ciliary marginal zone and the bipolar cells of the retina and sox9a expression in the pigmented epithelium and both the inner and outer nuclear layers of the retina (Fig. 9I). These results are consistent with expression and functional analyses showing that Sox9 plays a role in the retina in mouse and zebrafish (Poche et al., 2008; Yokoi et al., 2009). These analyses on the robustly mineralized skeleton of N. coriiceps provide a standard of comparison for the analysis of skeletal regulatory genes in osteopenic icefish such as Chaenocephalus aceratus (Balushkin, 1984; Voskoboynikova, 1993; Voskoboynikova, 1994; Voskoboynikova et al., 1994; Eastman, 1997; Albertson et al., 2010).

Conclusions

The analysis of Notothenia coriiceps embryos documented here provides the basis for understanding disruptions to embryonic development that may occur as the Southern Ocean warms by an estimated 1–2°C per century (Gille, 2002; Somero, 2005; Clarke et al., 2007; Ducklow et al., 2007; Portner et al., 2007; Portner and Farrell, 2008). Having evolved in stable and cold thermal conditions for over 10 million years (Kennett, 1977), Antarctic notothenioids appear to have lost the inducible heat shock response (Hofmann et al., 2000; Buckley et al., 2004), although hundreds of genes, including those involved in the evolutionarily conserved cellular stress response, change in activity under heat stress (Buckley and Somero, 2009). The effects of rising temperatures on the rates and morphologies of embryonic development in notothenioids, however, are as yet unknown, although experiments in progress, in comparison with the data presented here, should help to resolve this issue. The demonstration (Peck, 2016) that developmental rates in Antarctic invertebrates are not only retarded, but are slowed far below the normal effects of dropping temperature on embryonic development, suggests that special mechanisms are required for Antarctic embryos to develop, and although we do not yet know what those mechanisms are, they may be especially sensitive to rising temperatures.

The observation that N. coriiceps embryos in our experiments hatched with large but largely empty yolk sacs suggests that these larvae may require access to their algal food items immediately after hatching (Iken et al., 1997). In nature, N. coriiceps embryos are found until the third week in December, after which larvae appear (Sapota, 1999), suggesting that embryonic development is coordinated with the return of the Sun in the austral Spring, which provides a bloom of phytoplankton. Our observations support the conclusion (Sapota, 1999) that N. coriiceps embryos hatch at maturation rather than by delaying hatching as in some notothenioids (White and Burren, 1992; Evans et al., 2005). Thus, if rising temperature significantly accelerates the development of N. coriiceps embryos, hatching may occur before the availability of adequate supplies of food, which is determined by day length. These considerations suggest that populations of this dominant inshore demersal fish of the Antarctic Peninsula (DeWitt, 1971; Fischer and Hureau, 1985; Iken et al., 1997) may be in substantial danger as the temperature of the Southern Ocean rises.

Experimental Procedures

Animals, gametes, and fertilization

Adult Notothenia coriiceps were collected by bottom trawls or by baited fish traps deployed from the ARSV Laurence M. Gould southwest of Low Island [Antarctic Specially Protected Area (ASPA) 152, Western Bransfield Strait; latitudes 63°15′S – 63°30′S, longitudes 62°00′W – 62°45′W, bounded on northeast by the shoreline of Low Island)] or west of Brabant Island (ASPA 153, Eastern Dallmann Bay; latitudes 63°53′S – 64°20′S and longitudes 62°16′W – 62°45′W, bounded on the east by the shoreline of Brabant Island) in the Palmer Archipelago in May, 2008. Fish were transported alive to Palmer Station, Antarctica, where they were maintained in seawater aquaria at −1.5 to 0 °C.

To collect gametes, fertile adults were anesthetized with MS222, and two clutches of eggs and sperm (milt) were obtained by gentle massaging of the abdomens of females and males, one clutch made on June 7 and the other on June 14. Approximately 3,000 eggs from a single female were mixed with sperm from a single male in a four-liter beaker and seawater was immediately added to activate sperm. Two successful fertilizations (>99% elevation of fertilization membranes) were obtained, and embryos were incubated at −1 to 0 °C in flow-through seawater aquaria for 25 (clutch 1) or 32 days (clutch 2) at Palmer Station and then were transported to aquatic facilities at the University of Oregon (Eugene, OR, USA).

During transport, embryos were initially maintained at 0°C in 50 mL polypropylene screw cap tubes (10 embryos per 30 mL seawater) for five days on the ARSV Laurence M. Gould. Upon arrival in Punta Arenas, Chile, tubes were packed in shipping boxes containing Johnny Plastic-Ice™ X-Cold Bricks™ (Pelton Shepherd, Stockton, CA USA); equal numbers of bricks at +4°C and −20°C were used. Boxes were taken as carry-on luggage in a 36-h trip to the University of Oregon. Seawater within the 50-mL tubes was frozen solid upon arrival. After a slow thaw at 0°C, embryos were recovered alive and were subsequently cultured at −1 °C to +1°C in artificial seawater (Instant Ocean) in five gallon aquaria with constant stirring and aeration. For observation and experimentation, embryos (≥ 3) were euthanized daily with MS222 at Palmer Station, and after transfer to the University of Oregon, at approximately monthly intervals (25, 61, 92, 115, 132, and 166 days). The University of Oregon IACUC approved the animal care protocol under which this research was conducted.

Histology, in situ hybridization, skeletal staining, and microscopy

During development, micrographs of embryos were recorded by use of compound microscopes in brightfield and differential-interference-contrast mode. In situ hybridization of antisense RNAs to histological sections was performed as described (Rodriguez-Mari et al., 2005). Double-target fluorescent in situ hybridizations were performed as published (Yan et al., 2011), and specimens were visualized by confocal microscopy (Leica SD6000 spinning disk confocal microscope). Skeletal tissues were stained for cartilage and for bone using Alcian Blue and Alizarin Red, respectively (Walker and Kimmel, 2007).

Gene cloning

Skeletal genes from N. coriiceps were cloned from a cDNA library constructed using total RNA isolated from adult pharyngeal arches using TRI-reagent (Molecular Research Center, cat. #TR118). cDNA was synthesized with oligo-dT primers (Invitrogen Cat.#18418-020) and SuperScript III reverse transcriptase (Invitrogen cat# 18080-044) and used as template for subsequent PCR. From the cDNA library, we amplified cDNA clones for sox9a, sox9b, and runx2b using non-redundant primers designed directly from the sequences of the orthologous stickleback genes (Gasterosteus aculeatus genome available in Ensembl; http://uswest.ensembl.org/Gasterosteus_aculeatus/Info/Index): sox9a, sox9aF1 = GACGCCCCGAGCCCGAGCAT and sox9aR1 = AGGGCCTGGGGAGTTGGGTGTAGA (expected cDNA fragment of 1699 base pairs (bp); sox9b, sox9bF1 = GAGATGCGGTGTCCCAGGTGTTGA and sox9bR1 = GCGCCGCCTTGGTGATCTGAATA (1038-bp fragment); and runx2b, runx2b+1 = CAGCGCGAGTCGGAGGTTCAG and runx2b = CGGAGGTCGTTGAAGCGCG (1460-bp fragment). Fragments were cloned into the pCR4-TOPO vector (Invitrogen CAT# 45-0030), and the clones were amplified by PCR using m13-forward and m13-reverse primers. Amplification products served as templates for synthesizing antisense probes using T3 RNA polymerase for sox9a and runx2b and T7 RNA polymerase for sox9b.

Supplementary Material

Movie Legend
Supp MovieS1

Supplementary Movie S1. Heart beat in a 61 dpf N. coriiceps embryo. The heart beat eight times in 32 seconds in this video. The temperature of the embryo gradually raised from the culture conditions of −1C to about 5C in the filming of the embryo so the rate in normal conditions is likely much slower.

Download video file (8.5MB, mov)
Supp MovieS2

Supplementary Movie S2. Swimming of a newly hatched N. coriiceps larva.

Download video file (12.8MB, mov)
Supp Table S1

Supplementary Table 1. Developmental staging series for bullhead Notothen Notothenia coriiceps.

Key findings.

We followed in detail, from fertilization until hatching, the developmental progression of Bullhead notothen (Notothenia coriiceps), a benthic red-blooded notothenioid fish inhabiting the icy waters of Antarctica, including the Antarctic Peninsula, the most rapidly warming part of the globe.

Despite developing below the freezing point of fresh water, notothen embryos progressed with morphologies similar to other well studied fish embryos, but at a much slower rate.

In situ hybridization experiments on the robustly mineralized skeletons of notothen embryos showed that genes encoding the key skeletogenesis regulatory factors Sox9 and Runx2 were expressed in a fashion similar to orthologs in other well mineralized fish, providing a baseline for investigation of Antarctic icefish with osteopenic skeletons.

Results provide a schedule of normal embryonic development essential for evaluating the effects of the warming of the Southern Ocean on long-term survivability of Antarctic fish.

Acknowledgments

Grant sponsors:

NIH grant R01AG031922 from the National Institute on Aging

NIH grant R01OD011116 from the Office of the Director

NSF grants ANT-0944517, PLR-1247510, PLR-1444167, and PLR-1543383 from the Office/Division of Polar Programs

We gratefully acknowledge the logistic support provided to our Antarctic field research program by the staff of the Division of Polar Programs of the National Science Foundation, by the personnel of Raytheon Polar Services Company, and by the captains and crews of the ARSV Laurence M. Gould, both at Palmer Station and on the seas of the Palmer Archipelago. We thank Amanda Rapp for animal care and Ruth BreMiller for help with histology at the University of Oregon This work was supported by NIH grant R01AG031922 from the National Institute on Aging (J.H.P., H.W.D.), NIH grant R01OD011116 from the Office of the Director, and by NSF grants ANT-0944517, PLR-1247510 and PLR-1444167 from the Office/Division of Polar Programs (H.W.D.) and PLR-1543383 (J.H.P., H.W.D).

Contributor Information

John H. Postlethwait, Email: jpostle@uoneuro.uoregon.edu.

Yi-lin Yan, Email: yan@uoneuro.uoregon.edu.

Thomas Desvignes, Email: desvignes@uoneuro.uoregon.edu.

Corey Allard, Email: Corey.A.Allard.GR@Dartmouth.edu.

Tom Titus, Email: titus@uoregon.edu.

Nathalie R. Le François, Email: NLe_Francois@ville.montreal.qc.ca.

H. William Detrich, III, Email: w.detrich@neu.edu.

References

  1. Akiyama H. Control of chondrogenesis by the transcription factor Sox9. Mod Rheumatol. 2008;18:213–219. doi: 10.1007/s10165-008-0048-x. [DOI] [PubMed] [Google Scholar]
  2. Albertson RC, Cresko W, Detrich HW, 3rd, Postlethwait JH. Evolutionary mutant models for human disease. Trends Genet. 2009;25:74–81. doi: 10.1016/j.tig.2008.11.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Albertson RC, Yan YL, Titus TA, Pisano E, Vacchi M, Yelick PC, Detrich HW, 3rd, Postlethwait JH. Molecular pedomorphism underlies craniofacial skeletal evolution in Antarctic notothenioid fishes. BMC Evol Biol. 2010;10:4. doi: 10.1186/1471-2148-10-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Arkhipkin A, Boucher E, Howes PN. Spawning and early ontogenesis in channel bull blenny Cottoperca gobio (Notothenioidei, Perciformes) caught off the Falkland Islands and maintained in captivity. Polar Biol. 2015;38:251–259. [Google Scholar]
  5. Arkhipkin A, Jurgens E, Howes PN. Spawning, egg development and early ontogenesis in rock cod Patagonotothen ramsayi (Regan, 1913) caught on the Patagonian Shelf and maintained in captivity. Polar Biol. 2013;36:1195–1204. [Google Scholar]
  6. Balushkin AV. Morphological bases of the systematics and phylogeny of the Nototheniid fishes. Rotterdam: A.A. Balkema; 1984. [Google Scholar]
  7. Bird NC, Mabee PM. Developmental morphology of the axial skeleton of the zebrafish, Danio rerio (Ostariophysi: Cyprinidae) Dev Dyn. 2003;228:337–357. doi: 10.1002/dvdy.10387. [DOI] [PubMed] [Google Scholar]
  8. Bottaro M, Oliveri D, Ghigliotti L, Pisano E, Ferrando S, Vacchi M. Born among the ice: first morphological observations on two developmental stages of the Antarctic silverfish Pleuragramma antarcticum, a key species of the Southern Ocean. Rev Fish Biol Fisheries. 2009;19:249–259. [Google Scholar]
  9. Buckley BA, Place SP, Hofmann GE. Regulation of heat shock genes in isolated hepatocytes from an Antarctic Wsh, Trematomus bernacchii. J Exp Biol. 2004;207:3649–3656. doi: 10.1242/jeb.01219. [DOI] [PubMed] [Google Scholar]
  10. Buckley BA, Somero GN. cDNA microarray analysis reveals the capacity of the cold-adapted Antarctic fsh Trematomus bernacchii to alter gene expression in response to heat stress. Polar Biol. 2009;32:403–415. [Google Scholar]
  11. Camus P, Duhamel G. Ponte et developpement cmbryonnaire de Nororhenla ross// rossii (Richardson, 1844) Notothcniidae des lies Kerguelen. Cybium. 1985;9 [Google Scholar]
  12. Chen L, DeVries AL, Cheng CH. Evolution of antifreeze glycoprotein gene from a trypsinogen gene in Antarctic notothenioid fish. Proc Natl Acad Sci U S A. 1997;94:3811–3816. doi: 10.1073/pnas.94.8.3811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chen Z, Cheng CH, Zhang J, Cao L, Chen L, Zhou L, Jin Y, Ye H, Deng C, Dai Z, Xu Q, Hu P, Sun S, Shen Y. Transcriptomic and genomic evolution under constant cold in Antarctic notothenioid fish. Proc Natl Acad Sci U S A. 2008;105:12944–12949. doi: 10.1073/pnas.0802432105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cheng CH, Chen L. Evolution of an antifreeze glycoprotein. Nature. 1999;401:443–444. doi: 10.1038/46721. [DOI] [PubMed] [Google Scholar]
  15. Cheng CH, Detrich HW., 3rd Molecular ecophysiology of Antarctic notothenioid fishes. Philos Trans R Soc Lond B Biol Sci. 2007;362:2215–2232. doi: 10.1098/rstb.2006.1946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Clarke A, Murphy EJ, Meredith MP, King JC, Peck LS, Barnes DK, Smith RC. Climate change and the marine ecosystem of the western Antarctic Peninsula. Philos Trans R Soc Lond B Biol Sci. 2007;362:149–166. doi: 10.1098/rstb.2006.1958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Cocca E, Ratnayake-Lecamwasam M, Parker SK, Camardella L, Ciaramella M, di Prisco G, Detrich HW., 3rd Genomic remnants of alpha-globin genes in the hemoglobinless antarctic icefishes. Proc Natl Acad Sci U S A. 1995;92:1817–1821. doi: 10.1073/pnas.92.6.1817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Cooper TG. Cytoplasmic droplets: the good, the bad or just confusing? Hum Reprod. 2005;20:9–11. doi: 10.1093/humrep/deh555. [DOI] [PubMed] [Google Scholar]
  19. Coppe A, Agostini C, Marino RAM, Zane L, Bargelloni L, Bortoluzzi S, Patarnello T. Genome Evolution in the Cold: Antarctic Icefish Muscle Transcriptome Reveals Selective Duplications Increasing Mitochondrial Function. Genome Biology and Evolution. 2012 doi: 10.1093/gbe/evs108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Cresko WA, Yan YL, Baltrus DA, Amores A, Singer A, Rodriguez-Mari A, Postlethwait JH. Genome duplication, subfunction partitioning, and lineage divergence: Sox9 in stickleback and zebrafish. Dev Dyn. 2003;228:480–489. doi: 10.1002/dvdy.10424. [DOI] [PubMed] [Google Scholar]
  21. Cubbage CC, Mabee PM. Development of the cranium and paired fins in the zebrafish, Danio rerio (Ostariophysi, cyprinidae) J Morphol. 1996;229:121–160. doi: 10.1002/(SICI)1097-4687(199608)229:2<121::AID-JMOR1>3.0.CO;2-4. [DOI] [PubMed] [Google Scholar]
  22. Cziko PA, Evans CW, Cheng CH, DeVries AL. Freezing resistance of antifreeze-deficient larval Antarctic fish. J Exp Biol. 2006;209:407–420. doi: 10.1242/jeb.02008. [DOI] [PubMed] [Google Scholar]
  23. DeConto RM, Pollard D. Rapid Cenozoic glaciation of Antarctica induced by declining atmospheric CO2. Nature. 2003;421:245–249. doi: 10.1038/nature01290. [DOI] [PubMed] [Google Scholar]
  24. Desvignes T, Detrich HW, 3rd, Postlethwait JH. Genomic conservation of erythropoietic microRNAs (erythromiRs) in white-blooded Antarctic icefish. Mar Genomics. 2016 doi: 10.1016/j.margen.2016.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Detrich HW, 3rd, Johnson KA, Marchese-Ragona SP. Polymerization of Antarctic fish tubulins at low temperatures: energetic aspects. Biochemistry. 1989;28:10085–10093. doi: 10.1021/bi00452a031. [DOI] [PubMed] [Google Scholar]
  26. Detrich HW, 3rd, Parker SK, Williams RC, Jr, Nogales E, Downing KH. Cold adaptation of microtubule assembly and dynamics. Structural interpretation of primary sequence changes present in the alpha- and beta-tubulins of Antarctic fishes. J Biol Chem. 2000;275:37038–37047. doi: 10.1074/jbc.M005699200. [DOI] [PubMed] [Google Scholar]
  27. Detrich HWI, Jones CD, Kim S, North AW, Thurber AMV. Nesting behavior of the icefish Chaenocephalus aceratus at Bouvetøya Island, Southern Ocean. Polar Biol. 2005;28:828–832. [Google Scholar]
  28. Detrich HW, III, Buckley B, Doolittle D, Jones C, Lockhart S. Sub-Antarctic and high Antarctic notothenioid fishes: ecology and adaptational biology revealed by the ICEFISH 2004 cruise of the RVIB Nathaniel B. Palmer. Oceanography. 2012;25:184–187. [Google Scholar]
  29. DeVries AL. The role of antifreeze glycopeptides and peptides in the freezing avoidance of Antarctic fishes. Comp Biochem Physiol. 1988;90B:611–621. [Google Scholar]
  30. DeVries AL, Cheng C-HC. The role of antifreeze glycopeptides and peptides in the survival of cold-water fishes. In: Somero GN, Osmond CB, Bolis CL, editors. Water and Life. Berlin, New York: Springer-Verlag; 1992. pp. 301–315. [Google Scholar]
  31. DeWitt HH. Coastal and deep water benthic fishes of the Antarctic. Antarct Map Fol Ser Amer Geogr Soc. 1971;15:1–10. [Google Scholar]
  32. Ducklow HW, Baker K, Martinson DG, Quetin LB, Ross RM, Smith RC, Stammerjohn SE, Vernet M, Fraser W. Marine pelagic ecosystems: the west Antarctic Peninsula. Philos Trans R Soc Lond B Biol Sci. 2007;362:67–94. doi: 10.1098/rstb.2006.1955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Duhamel G, Kock KH, Balguerias E, Hureau JC. Reproduction in fish of the Weddell Sea Polar Biol. 1993;13:193–200. [Google Scholar]
  34. Eames BF, Sharpe PT, Helms JA. Hierarchy revealed in the specification of three skeletal fates by Sox9 and Runx2. Dev Biol. 2004;274:188–200. doi: 10.1016/j.ydbio.2004.07.006. [DOI] [PubMed] [Google Scholar]
  35. Eastman J, Clarke A. A comparison of adaptive radiations of Antarctic fish with those of sub-Antarctic fish. In: di Prisco G, Pisano E, Clarke A, editors. Fishes of Antarctic: A Biological Overview. Milano: Springer-Verlag; 1998. pp. 3–26. [Google Scholar]
  36. Eastman J, Sidell B. Measurements of buoyancy for some Antarctic notothenioid fishes from the South Shetland Islands. Polar Biology. 2002;25:753–760. [Google Scholar]
  37. Eastman JT. Antarctic Fish Biology: Evolution in a Unique Environment. San Diego: Academic Press; 1993. p. 322. [Google Scholar]
  38. Eastman JT. Phyletic divergence and specialization for pelagic life in the Antarctic notothenioid fish Pleuragramma antarcticum. Comparative Biochemistry and Physiology. 1997;118A:1095–1101. [Google Scholar]
  39. Eastman JT, DeVries AL. Buoyancy Studies of Notothenioid Fishes in McMurdo Sound, Antarctica. Copeia. 1982;2:385–393. [Google Scholar]
  40. Eastman JT, Witmer LM, Ridgely RC, Kuhn KL. Divergence in skeletal mass and bone morphology in antarctic notothenioid fishes. J Morphol. 2014;275:NA. doi: 10.1002/jmor.20308. [DOI] [PubMed] [Google Scholar]
  41. Evans CW, Cziko P, Cheng CHC, De Vries AL. Spawning behaviour and early development in the naked dragonfish Gymnodraco acuticeps. Antarctic Science. 2005;17:319– 327. [Google Scholar]
  42. Evseenko SA, Kock K-H, Nevinsky MM. Early life history of the Patagonian toothfish, Dissostichus eleginoides Smitt, 1898 in the Atlantic sector of the Southern Ocean. Antarctic Science. 1995;7:221–226. [Google Scholar]
  43. Falugi C, Baccetti B, Renieri T, Moretti E, Angelini C, Campanella C, Pisano E, Piomboni P. Ultrastructural analysis of the spermatozoa of three Antarctic fish species. j SUBMlCROSC C’rTOL PATHOL. 1999;31:197–202. [Google Scholar]
  44. Ferrando S, Castellano L, Gallus L, Ghigliotti L, Masini MA, Pisano E, Vacchi M. A Demonstration of Nesting in Two Antarctic Icefish (Genus Chionodraco) Using a Fin Dimorphism Analysis and Ex Situ Videos. PLoS One. 2014;9:e90512. doi: 10.1371/journal.pone.0090512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Fischer W, Hureau J-C. Southern Ocean (Fishing area 48, 58 and 88) (CCAMLR Convention Area) Rome: Commission for the Conservation of Antarctic Marine Living Resources; 1985. FAO Special Identification Sheets For Fishery Purposes. [Google Scholar]
  46. Flores MV, Lam EY, Crosier P, Crosier K. A hierarchy of Runx transcription factors modulate the onset of chondrogenesis in craniofacial endochondral bones in zebrafish. Dev Dyn. 2006;235:3166–3176. doi: 10.1002/dvdy.20957. [DOI] [PubMed] [Google Scholar]
  47. Flores MV, Tsang VW, Hu W, Kalev-Zylinska M, Postlethwait J, Crosier P, Crosier K, Fisher S. Duplicate zebrafish runx2 orthologues are expressed in developing skeletal elements. Gene Expr Patterns. 2004;4:573–581. doi: 10.1016/j.modgep.2004.01.016. [DOI] [PubMed] [Google Scholar]
  48. Flynn EE, Bjelde BE, Miller NA, Todgham AE. Ocean acidification exerts negative effects during warming conditions in a developing Antarctic fish. Conserv Physiol. 2015;3:cov033. doi: 10.1093/conphys/cov033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Gilbert S. Developmental Biology. Sunderland, MA: Sinauer Associates; 2013. p. 725. [Google Scholar]
  50. Gille ST. Warming of the Southern Ocean since the 1950s. Science. 2002;295:1275–1277. doi: 10.1126/science.1065863. [DOI] [PubMed] [Google Scholar]
  51. Gon O, Heemstra P. Fishes of the Southern Ocean. Grahamstown: J.L.B. Smith Institute of Ichthyology; 1990. p. 462. [Google Scholar]
  52. Hagedorn M, Ricker J, McCarthy M, Meyers SA, Tiersch TR, Varga ZM, Kleinhans FW. Biophysics of zebrafish (Danio rerio) sperm. Cryobiology. 2009;58:12–19. doi: 10.1016/j.cryobiol.2008.09.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Hamdoun A, Epel D. Embryo stability and vulnerability in an always changing world. Proc Natl Acad Sci U S A. 2007;104:1745–1750. doi: 10.1073/pnas.0610108104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Hochachka P, Somero G. Biochemical adaptation: mechanism and process in physiological evolution. New York: Oxford University Press; 2002. [Google Scholar]
  55. Hofmann GE, Buckley BA, Airaksinen S, Keen JE, Somero GN. Heat shock protein expression is absent in the Antarctic Wsh, Trematomus bernacchii (Family Nototheniidae) J Exp Biol. 2000;203:2331–2339. doi: 10.1242/jeb.203.15.2331. [DOI] [PubMed] [Google Scholar]
  56. Hong Y, Liu T, Zhao H, Xu H, Wang W, Liu R, Chen T, Deng J, Gui J. Establishment of a normal medakafish spermatogonial cell line capable of sperm production in vitro. Proc Natl Acad Sci U S A. 2004;101:8011–8016. doi: 10.1073/pnas.0308668101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Hubold G. Seasonal patterns of ichthyplankton distribution and abundance in the Southern Weddell Sea. In: KERRY KHG, editor. Antarctic ecosystems: ecological change and conservation. Berlin: Springer; 1990. pp. 149–158. [Google Scholar]
  58. Iken K, Barbera-Oro ER, Quartino ML, Casaux RJ, Brey T. Grazing by the Antarctic fish Notofhenia coriiceps: evidence for selective feeding on macroalgae. Antarctic Science. 1997;9:386–391. [Google Scholar]
  59. Iwamatsu T. Stages of normal development in the medaka Oryzias latipes. Mech Dev. 2004;121:605–618. doi: 10.1016/j.mod.2004.03.012. [DOI] [PubMed] [Google Scholar]
  60. Jing L, Zon LI. Zebrafish as a model for normal and malignant hematopoiesis. Dis Model Mech. 2011;4:433–438. doi: 10.1242/dmm.006791. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Jones CD, Near TJ. The reproductive behaviour of Pogonophryne scotti confirms widespread egg-guarding parental care among Antarctic notothenioids. J Fish Biol. 2012;80:2629–2635. doi: 10.1111/j.1095-8649.2012.03282.x. [DOI] [PubMed] [Google Scholar]
  62. Kellerman A. Catalogue of early life stages of Antarctic notothenioid fishes. Berichte zur Polarforschung. 1990;67:45–136. [Google Scholar]
  63. Kellerman A. Egg and larval drift of the Antarctic fish Notothenia croiiceps. Cybium. 1991;15:199–210. [Google Scholar]
  64. Kellermann A. Identification Key and Catalogue of Larval Antarctic Fishes. Biological Investigations of Marine Antarctic Systems and Stocks (Biomass) 1989;10:22–29. [Google Scholar]
  65. Kennett JP. Cenozoic evolution of Antarctic glaciation, the circum-Antarctic Ocean, and their impact on global paleooceanography. J Geophys Res. 1977;82:3843–3860. [Google Scholar]
  66. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. Stages of embryonic development of the zebrafish. Dev Dyn. 1995;203:253–310. doi: 10.1002/aja.1002030302. [DOI] [PubMed] [Google Scholar]
  67. King SM, Marchese-Ragona SP, Parker SK, Detrich HW., 3rd Inner and outer arm axonemal dyneins from the Antarctic rockcod Notothenia coriiceps. Biochemistry. 1997;36:1306–1314. doi: 10.1021/bi962229q. [DOI] [PubMed] [Google Scholar]
  68. Koch K-H, Pshenichnov LK, DeVries AL. Evidence for egg brooding and parental care in icefish and other notothenioids in the Southern Ocean. Antarctic Science. 2006;18:223–227. [Google Scholar]
  69. Koch KH, Kellerman A. Reproduction in Antarctic notothenioid fish. Antarctic Science. 1991;3:125–150. [Google Scholar]
  70. Kock KE, Pshenichnov LK, Jones CD, Groger J, Riehl R. The biology of the spiny icefish Chaenodraco wilsoni Regan, 1914. Polar Biol. 2008;31:381–393. [Google Scholar]
  71. Kock KH. Fischereibiologische Untersuchungen an drei antarktischen Fischarten: Champsocephalus gunnari (Lonnberg, 1905), Chaenocephalus aceratus (Lonnberg, 1906) and Pseudochaenichthys georgianus (Norman, 1937) (Notothenioidei, Channichthyidae) Mitteilungen aus dem Institut fuer Seefischerei Hamburg. 1981;32:1–226. [Google Scholar]
  72. Lawver LA, Gahagan L, Coffin M. The development of paleoseaways around Antarctica. In: Kennett J, Warnke D, editors. The Antarctic Paleoenvironment: A Perspective on Global Change. Washington, DC: American Geophysical Union; 1992. pp. 7–30. [Google Scholar]
  73. Lawver LA, Royer J-Y, Sandwell D, Scotese C. Evolution of the Antarctic continental margins. In: Thomson M, Crame J, Thomson J, editors. Geological Evolution of Antarctica. Cambridge: Cambridge University Press; 1991. pp. 533–539. [Google Scholar]
  74. Meredith M, King J. Rapid climate change in the ocean west of the Antarctic Peninsula during the second half of the 20th century. GEOPHYSICAL RESEARCH LETTERS. 2005;32:L19604. [Google Scholar]
  75. Militelli MI, Macchi GJ, Rodrigues KA. Maturity and fecundity of Champsocephalus gunnari, Chaenocephalus aceratus and Pseudochaenichthys georgianus in South Georgia and Shag Rocks Islands. Polar Science. 2015;9:258–266. [Google Scholar]
  76. Motta CM, Avallone B, Balassone G, Balsamo G, Fascio U, Simoniello P, Tammaro S, Marmo F. Morphological and biochemical analyses of otoliths of the ice-fish Chionodraco hamatus confirm a common origin with red-blooded species. J Anat. 2009;214:153–162. doi: 10.1111/j.1469-7580.2008.01003.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  77. Near TJ, Jones CD, Eastman JT. Geographic intraspecific variation in buoyancy within Antarctic notothenioid fishes. Antarctic Science. 2009;21:123–129. [Google Scholar]
  78. Near TJ, Parker SK, Detrich HW., 3rd A genomic fossil reveals key steps in hemoglobin loss by the antarctic icefishes. Mol Biol Evol. 2006;23:2008–2016. doi: 10.1093/molbev/msl071. [DOI] [PubMed] [Google Scholar]
  79. North AW, Kellermann A. Key to the early stages of Antarctic fishes. Berichte zur Polarforsch. 1990;67:1–44. [Google Scholar]
  80. North AW, White MG. Reproductive strategies of Antarctic fish. In: Kullander SO, Fernholm B, editors. Vth Congress of European Ichthyologists; Stockholm. Stockholm: Swedish Museum of Natural History; 1987. pp. 381–390. [Google Scholar]
  81. Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, Stamp GW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell. 1997;89:765–771. doi: 10.1016/s0092-8674(00)80259-7. [DOI] [PubMed] [Google Scholar]
  82. Patarnello T, Verde C, di Prisco G, Bargelloni L, Zane L. How will fish that evolved at constant sub-zero temperatures cope with global warming? Notothenioids as a case study. Bioessays. 2011;33:260–268. doi: 10.1002/bies.201000124. [DOI] [PubMed] [Google Scholar]
  83. Peck LS. A Cold Limit to Adaptation in the Sea. Trends Ecol Evol. 2016;31:13–26. doi: 10.1016/j.tree.2015.09.014. [DOI] [PubMed] [Google Scholar]
  84. Poche RA, Furuta Y, Chaboissier MC, Schedl A, Behringer RR. Sox9 is expressed in mouse multipotent retinal progenitor cells and functions in Muller glial cell development. J Comp Neurol. 2008;510:237–250. doi: 10.1002/cne.21746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  85. Portner HO, Farrell AP. Ecology. Physiology and climate change Science. 2008;322:690–692. doi: 10.1126/science.1163156. [DOI] [PubMed] [Google Scholar]
  86. Portner HO, Peck L, Somero G. Thermal limits and adaptation in marine Antarctic ectotherms: an integrative view. Philos Trans R Soc Lond B Biol Sci. 2007;362:2233–2258. doi: 10.1098/rstb.2006.1947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Pype C, Verbueken E, Saad MA, Casteleyn CR, Van Ginneken CJ, Knapen D, Van Cruchten SJ. Incubation at 32.5 degrees C and above causes malformations in the zebrafish embryo. Reprod Toxicol. 2015;56:56–63. doi: 10.1016/j.reprotox.2015.05.006. [DOI] [PubMed] [Google Scholar]
  88. Redeker V, Frankfurter A, Parker SK, Rossier J, Detrich HW., 3rd Posttranslational modification of brain tubulins from the Antarctic fish Notothenia coriiceps: reduced C-terminal glutamylation correlates with efficient microtubule assembly at low temperature. Biochemistry. 2004;43:12265–12274. doi: 10.1021/bi049070z. [DOI] [PubMed] [Google Scholar]
  89. Riginella E, Mazzoldi C, Ashford J, Jones CD, Morgan C, La Mesa M. Life history strategies of the Scotia Sea icefish, Chaenocephalus aceratus, along the Southern Scotia Ridge. Polar Biol. 2016;39:497–509. [Google Scholar]
  90. Rodriguez-Mari A, Yan YL, Bremiller RA, Wilson C, Canestro C, Postlethwait JH. Characterization and expression pattern of zebrafish Anti-Mullerian hormone (Amh) relative to sox9a, sox9b, and cyp19a1a, during gonad development. Gene Expr Patterns. 2005;5:655–667. doi: 10.1016/j.modgep.2005.02.008. [DOI] [PubMed] [Google Scholar]
  91. Sapota MR. Gonad development and embryogenesis of Notothenia coriiceps from South Shetlands, Antarctica. Polar Biology. 1999;22:164–168. [Google Scholar]
  92. Scher HD, Martin EE. Timing and climatic consequences of the opening of Drake Passage. Science. 2006;312:428–430. doi: 10.1126/science.1120044. [DOI] [PubMed] [Google Scholar]
  93. Schirone R, Gross L. Effect of temperature on early embryological development of zebrafish Brachydanio rerio. J Exp Zool. 1968;169:43–52. [Google Scholar]
  94. Schnurr ME, Yin Y, Scott GR. Temperature during embryonic development has persistent effects on metabolic enzymes in the muscle of zebrafish. J Exp Biol. 2014;217:1370–1380. doi: 10.1242/jeb.094037. [DOI] [PubMed] [Google Scholar]
  95. Schroeder TM, Jensen ED, Westendorf JJ. Runx2: a master organizer of gene transcription in developing and maturing osteoblasts. Birth Defects Res C Embryo Today. 2005;75:213–225. doi: 10.1002/bdrc.20043. [DOI] [PubMed] [Google Scholar]
  96. Scott GR, Johnston IA. Temperature during embryonic development has persistent effects on thermal acclimation capacity in zebrafish. Proc Natl Acad Sci U S A. 2012;109:14247–14252. doi: 10.1073/pnas.1205012109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Shin SC, Ahn do H, Kim SJ, Pyo CW, Lee H, Kim MK, Lee J, Lee JE, Detrich HW, Postlethwait JH, Edwards D, Lee SG, Lee JH, Park H. The genome sequence of the Antarctic bullhead notothen reveals evolutionary adaptations to a cold environment. Genome Biol. 2014;15:468. doi: 10.1186/s13059-014-0468-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Shin SC, Kim SJ, Lee JK, Ahn do H, Kim MG, Lee H, Lee J, Kim BK, Park H. Transcriptomics and comparative analysis of three antarctic notothenioid fishes. PLoS One. 2012;7:e43762. doi: 10.1371/journal.pone.0043762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Shust KV, Parfenovich SS, Gerasimchuk VV. Antarctic silverfish (Pleuragramma antarcticum Boulenger) distribution in relation to oceanological conditions of habitation and biological peculiarities. Geographical Issues, Oceans and Life. 1984;125:193–198. [Google Scholar]
  100. Somero GN. Linking biogeography to physiology: Evolutionary and acclimatory adjustments of thermal limits. Front Zool. 2005;2:1. doi: 10.1186/1742-9994-2-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  101. Somero GN, DeVries AL. Temperature tolerance of some Antarctic fishes. Science. 1967;156:257–258. doi: 10.1126/science.156.3772.257. [DOI] [PubMed] [Google Scholar]
  102. Swarup H. Stages in the development of the stickleback Gasterosteus aculeatus (L) J Embryol Exp Morphol. 1958;6:373–383. [PubMed] [Google Scholar]
  103. Twelves EL, Bachop WE. Giant nuclei in the yolk sac syncytium of the Antarctic teleost Nororhenia coriiceps neglecta. Copeia. 1980;1980(4):909–911. [Google Scholar]
  104. Vacchi M, DeVries AL, Evans CW, Bottaro M, Ghigliotti L, Cutroneo L, Pisano E. A nursery area for the Antarctic silverfish Pleuragramma antarcticum at Terra Nova Bay (Ross Sea): first estimate of distribution and abundance of eggs and larvae under the seasonal sea-ice. Polar Biol. 2012;35:1573–1585. [Google Scholar]
  105. Vacchi M, La Mesa M, Dalu M, MacDonald J. Early life stages in the life cycle of Antarctic silverfish, Pleuragramma antarcticum in Terra Nova Bay, Ross Sea. Antarct Sci. 2004;16:299–305. [Google Scholar]
  106. Voskoboynikova OS. Evolution of the visceral skeleton and phylogeny of the Nototheniidae. J Ichthyol. 1993;33:23–47. [Google Scholar]
  107. Voskoboynikova OS. Rates of individual development of the bony skeleton of eleven species of the family Nototheniidae. J Ichthyol. 1994;34:108–120. [Google Scholar]
  108. Voskoboynikova OS, Tereshchuk OY, Kellermann A. Osteological development of the Antarctic silverfish Pleuragramma antarcticum (Nototheniidae) Cymbium. 1994;18:251–271. [Google Scholar]
  109. Wagner TU, Renn J, Riemensperger T, Volff JN, Koster RW, Goerlich R, Schartl M, Winkler C. The teleost fish medaka (Oryzias latipes) as genetic model to study gravity dependent bone homeostasis in vivo. Adv Space Res. 2003;32:1459–1465. doi: 10.1016/S0273-1177(03)90381-4. [DOI] [PubMed] [Google Scholar]
  110. Walker MB, Kimmel CB. A two-color acid-free cartilage and bone stain for zebrafish larvae. Biotech Histochem. 2007;82:23–28. doi: 10.1080/10520290701333558. [DOI] [PubMed] [Google Scholar]
  111. Warga RM, Kimmel CB. Cell movements during epiboly and gastrulation in zebrafish. Development. 1990;108:569–580. doi: 10.1242/dev.108.4.569. [DOI] [PubMed] [Google Scholar]
  112. White MG, Burren PJ. Reproduction and larval growth of Harpagifer antarcticus Nybelin (Pisces, Notothenoidei) Antarct Sci. 1992;4 [Google Scholar]
  113. White MG, North AW, Twelves EL, Jones S. Early development of Notothenia neglecta from the Scotia Sea, Antarctica. Cybiurn. 1982;6:43–51. [Google Scholar]
  114. Yan Y-L, Talbot JC, Bremiller RA. Tyr-Fluor/Cy3/Cy5 Triple Fluorescent in situ Protocol on Cryostat Sections of Zebrafish 2011 [Google Scholar]
  115. Yan YL, Miller CT, Nissen RM, Singer A, Liu D, Kirn A, Draper B, Willoughby J, Morcos PA, Amsterdam A, Chung BC, Westerfield M, Haffter P, Hopkins N, Kimmel C, Postlethwait JH. A zebrafish sox9 gene required for cartilage morphogenesis. Development. 2002;129:5065–5079. doi: 10.1242/dev.129.21.5065. [DOI] [PubMed] [Google Scholar]
  116. Yan YL, Willoughby J, Liu D, Crump JG, Wilson C, Miller CT, Singer A, Kimmel C, Westerfield M, Postlethwait JH. A pair of Sox: distinct and overlapping functions of zebrafish sox9 co-orthologs in craniofacial and pectoral fin development. Development. 2005;132:1069–1083. doi: 10.1242/dev.01674. [DOI] [PubMed] [Google Scholar]
  117. Yokoi H, Yan YL, Miller MR, BreMiller RA, Catchen JM, Johnson EA, Postlethwait JH. Expression profiling of zebrafish sox9 mutants reveals that Sox9 is required for retinal differentiation. Dev Biol. 2009;329:1–15. doi: 10.1016/j.ydbio.2009.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  118. Zhao Y, Ratnayake-Lecamwasam M, Parker SK, Cocca E, Camardella L, di Prisco G, Detrich HW., 3rd The major adult alpha-globin gene of antarctic teleosts and its remnants in the hemoglobinless icefishes. Calibration of the mutational clock for nuclear genes. J Biol Chem. 1998;273:14745–14752. doi: 10.1074/jbc.273.24.14745. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Movie Legend
NIHMS809314-supplement-Movie_Legend.docx (10.2KB, docx)
Supp MovieS1

Supplementary Movie S1. Heart beat in a 61 dpf N. coriiceps embryo. The heart beat eight times in 32 seconds in this video. The temperature of the embryo gradually raised from the culture conditions of −1C to about 5C in the filming of the embryo so the rate in normal conditions is likely much slower.

Download video file (8.5MB, mov)
Supp MovieS2

Supplementary Movie S2. Swimming of a newly hatched N. coriiceps larva.

Download video file (12.8MB, mov)
Supp Table S1

Supplementary Table 1. Developmental staging series for bullhead Notothen Notothenia coriiceps.

NIHMS809314-supplement-Supp_Table_S1.docx (15.6KB, docx)

RESOURCES