Skip to main content
G3: Genes | Genomes | Genetics logoLink to G3: Genes | Genomes | Genetics
. 2016 Aug 11;6(10):3229–3239. doi: 10.1534/g3.116.034231

Ctr9, a Key Component of the Paf1 Complex, Affects Proliferation and Terminal Differentiation in the Developing Drosophila Nervous System

Shahrzad Bahrampour 1, Stefan Thor 1,1
PMCID: PMC5068944  PMID: 27520958

Abstract

The Paf1 protein complex (Paf1C) is increasingly recognized as a highly conserved and broadly utilized regulator of a variety of transcriptional processes. These include the promotion of H3K4 and H3K36 trimethylation, H2BK123 ubiquitination, RNA Pol II transcriptional termination, and also RNA-mediated gene silencing. Paf1C contains five canonical protein components, including Paf1 and Ctr9, which are critical for overall complex integrity, as well as Rtf1, Leo1, and Cdc73/Parafibromin(Hrpt2)/Hyrax. In spite of a growing appreciation for the importance of Paf1C from yeast and mammalian studies, there has only been limited work in Drosophila. Here, we provide the first detailed phenotypic study of Ctr9 function in Drosophila. We found that Ctr9 mutants die at late embryogenesis or early larval life, but can be partly rescued by nervous system reexpression of Ctr9. We observed a number of phenotypes in Ctr9 mutants, including increased neuroblast numbers, increased nervous system proliferation, as well as downregulation of many neuropeptide genes. Analysis of cell cycle and regulatory gene expression revealed upregulation of the E2f1 cell cycle factor, as well as changes in Antennapedia and Grainy head expression. We also found reduction of H3K4me3 modification in the embryonic nervous system. Genome-wide transcriptome analysis points to additional downstream genes that may underlie these Ctr9 phenotypes, revealing gene expression changes in Notch pathway target genes, cell cycle genes, and neuropeptide genes. In addition, we find significant effects on the gene expression of metabolic genes. These findings reveal that Ctr9 is an essential gene that is necessary at multiple stages of nervous system development, and provides a starting point for future studies of the Paf1C in Drosophila.

Keywords: neuroblast, lineage tree, cell cycle, epigenetics, terminal differentiation, FlyBook


During embryonic development, there is dynamic interplay between the primary level of transcriptional control, as chiefly executed by transcription factors and cofactors, and the epigenetic machinery (Cantone and Fisher 2013; Leeb and Wutz 2012). A number of epigenetic complexes have been identified, some with highly restricted enzymatic roles, such as the trimethylation of H3K27 by Polycomb Repressor Complex 2 (Muller and Verrijzer 2009). In contrast, other complexes have more pleiotropic roles, apparently affecting several epigenetic and transcriptional processes; the Polymerase-Associated Factor 1 (Paf1) complex (Paf1C) belongs to this latter category (Jaehning 2010; Tomson and Arndt 2013).

Paf1 was first identified in Saccharomyces cerevisiae by its interaction with RNA polymerase II (RNA pol II) (Shi et al. 1996). Related studies further identified the Cell Division Cycle 73 protein (Cdc73; denoted Parafibromin/Hrpt2 in mammals and Hyrax in Drosophila) as copurifying with Paf1 and RNA pol II (Shi et al. 1997). Subsequently, three additional proteins were identified as being part of the yeast: Paf1C:Ctr9, Leo, and Rtf1 (Mueller and Jaehning 2002; Squazzo et al. 2002) (Figure 1M). Ctr9 (Cln Three Requiring 9) had also been identified genetically based upon its role in controlling the yeast cell cycle (Di Como et al. 1995; Foreman and Davis 1996). In yeast, Paf1C genes are not essential during optimal conditions, but affect the expression levels of numerous genes. In contrast, in metazoans, several members of the complex are essential, and have demonstrated effects on cell cycle and DNA repair and development (Jaehning 2010; Newey et al. 2009; Tomson and Arndt 2013). Several studies have furthermore identified links between Paf1C and Notch or Wnt signaling (Mosimann et al. 2006; Mosimann et al. 2009), as well as between Paf1C members and cancer (Dey et al. 2011; Hanks et al. 2014; Muntean et al. 2010; Newey et al. 2009; Takahashi et al. 2011; Zeng and Xu 2015). At the molecular level, Paf1C controls a number of transcriptional and epigenetic processes. These involve, but are not limited to promotion of H3K4 and H3K36 trimethylation, recruitment and activity of the Rad6-Bre1 complex (which ubiquitinates H2BK123), recruitment of the Chd1 chromatin remodeling factor, and proper RNA Pol II transcriptional termination (Jaehning 2010; Tomson and Arndt 2013). More recent studies have expanded these pleiotropic transcriptional functions of Paf1C to include roles in histone turnover and chromatin states, RNA pol II phosphorylation, pausing, and release, as well as RNA-mediated epigenetic gene silencing (Chen et al. 2015; Kowalik et al. 2015; Sadeghi et al. 2015; Yu et al. 2015).

Figure 1.

Figure 1

A genetic screen for FMRFa expression identifies Ctr9. (A) Cartoon of the embryonic Drosophila embryo, depicting neuroblasts (NBs) in the CNS (gray circles). NB5-6 is generated along the entire CNS, but generates a specialized lineage in the three thoracic (T) segments (green circles). (B) Cartoon of the NB5-6T lineage. This NB undergoes nine rounds of Type I proliferation, budding off daughters that divide to generate two neurons per glia. Subsequently, it switches to Type 0 division, generating daughter cells that directly differentiate. Among the latter group of cells are the Ap neurons, which are born at the end of the lineage, with the FMRFa neuron born last. The NB exits the cell cycle at St15 and undergoes apoptosis (marked by X) at St16. (C) In control, FMRFa-eGFP labels the thoracic FMRFa Ap neurons. (D) In Ctr9 mutants, there is near complete loss of eGFP expression. The stain is eGFP fluorescence, no antibody stain. Magnification is 200x. (E and F) Close-up of the four Ap neurons, identified by expression of Eya, FMRFa, and Nplp1, in control and Ctr9 mutants. In control, all four Ap neurons express Eya, while one cell expresses FMRFa and one Nplp1. In Ctr9 mutants, one extra Ap neuron is often observed, while FMRFa and Nplp1 expression is frequently lost. (G) Homozygous Ctr912P023 mutants show similar phenotype as hemizygous mutants. (H) Both cell number and neuropeptide expression can be rescued by expressing UAS-Ctr9 from the pan-neural Gal4 driver insc-Gal4. (I and J) Expression of apGal4, Dimm, Dac, and pMad in control and Ctr9 hemizygous mutants. Control display four apGal4 neurons, out of which one expresses pMad, two Dimm, and one Dac. Ctr9 mutants display one extra apGal4 cell, which also expresses Dac and Dimm, while pMad appears unaffected. (K) Quantification of the observed phenotypes (*** P ≤ 0.001; Student’s two-tailed t-test ± SD; n ≥ 6 clusters). (L) (top) Sequencing of Ctr912P023 revealed a nonsense mutation early in the open-reading frame, converting a Trp to Stop; (bottom) the Drosophila Ctr9 protein shows a high degree of conservation to human Ctr9. (M) Ctr9 is part of the Paf1 complex, together with the other core components Leo1, Paf1, Rtf1, and Cdc73/Parafibromin/Hyrax, all of which are highly conserved throughout metazoans. Genotypes: (C) FMRFa-eGFP; (D) FMRFa-eGFP, UAS-myr-mRFP, Ctr912P023/Ctr9Df = Df(3L)BSC250; (E) OregonR; (F) Ctr912P023/Ctr9Df = Df(3L)BSC250; (G) Ctr912P023; (H) Ctr912P023, UAS-Ctr9/insc-Gal4.

In contrast to the extensive studies of Paf1C in both yeast and mammals, studies in Drosophila are more limited. Cdc73 (hyrax in Drosophila) is an important mediator of both Wnt and Hedgehog signaling (Mosimann et al. 2006; Mosimann et al. 2009). Rtf1 is an essential gene (Tenney et al. 2006), important for H3K4 methylation (Adelman et al. 2006; Tenney et al. 2006). Paf1 (antimeros in Drosophila) is important for H3K4 methylation (Adelman et al. 2006), and is described as an essential gene (Spradling et al. 1999). Leo1 (another transcription unit in Drosophila) has not been extensively studied, but is also known as an essential gene (Spradling et al. 1999). Finally, Ctr9 (denoted CG2469 by Flybase) has not been previously studied.

In a recent forward mutagenesis screen for genes affecting expression of a neuropeptide-GFP transgene (FMRFa-eGFP), we identified a mutant allele in Ctr9 (Bivik et al. 2015). Here, we analyzed Ctr9 mutants in detail. We found that Ctr9 is an essential gene, with lethality during late embryogenesis and early larval life. Lethality can be partly suppressed into early larval stages by Gal4/UAS-mediated rescue in the developing nervous system. We also found that Ctr9 is involved in proliferation control in the developing central nervous system (CNS), with mutants displaying increased proliferation both of neuroblasts (NBs) and their daughter cells. This phenotype may, in part, be explained by the elevated number of NBs that we observe in Ctr9 mutants, but also by the altered expression of the cell cycle factor E2f1, as well as two transcription factors involved in proliferation control: Grainy head and Antennapedia. In line with the known role of Paf1C in specific histone modifications, in Ctr9 mutants we found reduction of H3K4me3 modification in developing NBs. In addition to downregulation of the FMRFa neuropeptide, we found that Ctr9 controls terminal differentiation of other neurons, evidenced by loss/reduction of expression of several other neuropeptide genes. Finally, genome-wide transcriptome analysis of Ctr9 mutants revealed changes in several Notch pathway target genes, as well as cell cycle and neuropeptide genes. In addition, we observed expression changes in genes involved in metabolism. This provides the first functional study of the highly conserved Paf1C member Ctr9 in Drosophila, demonstrating the fundamental role it plays during development, and provides a platform for future studies on this essential epigenetic complex.

Materials and Methods

Fly stocks

The following fly stocks were used: lbe(K)-EGFP (Ulvklo et al. 2012); E(spl)m8-EGFP (Castro et al. 2005) (provided by J. Posakony); UAS-nls-myc-EGFP, referred to as UAS-nmEGFP (Allan et al. 2003); lbe(K)-lacZ (Baumgardt et al. 2014); Ctr9Df = Df(3L)BSC250 (Bloomington stock #23150); hyx2 and hyx3 (Mosimann et al. 2006) (provided by K. Basler); and egMz360, referred to as egGal4 (BL#8758).

UAS-Ctr9 transgenic strain was generated by inserting Ctr9 cDNA clone LD24034 (from Drosophila Genomics Resource Center) into the pUASattB vector, and generating transgenes by PhiC31 transgenic integration (Bischof et al. 2007) (BestGene Inc., Chino Hills, CA), into cytological site 28E on chromosome 2 (BL#9723).

FMRFa-eGFP, UAS-myr-mRFP, and Ctr912P023 (BL#59389) (Bivik et al. 2015) stock were outcrossed to w1118 to remove both of the transgenic inserts, and other than Figure 1, C and D, a “clean” Ctr912P023 stock was used in this study.

Mutants were maintained over GFP- or YFP-marked balancer chromosomes; wild type, w1118, or OregonR was used. Staging of embryos was performed according to Campos-Ortega and Hartenstein (1985).

Immunohistochemistry

Immunohistochemistry was performed as previously described (Baumgardt et al. 2009). Primary antibodies were: guinea pig α-Dap (1:1000), rat α-E2f (1:100) (Baumgardt et al. 2014); guinea pig α-Dpn (1:1000), rat α-Dpn (1:500) (Ulvklo et al. 2012); rabbit α-phospho-histone H3-Ser10 (PH3) (1:1000) (Upstate/EMD Millipore, Billerica, MA); rat α-PH3 (1:1000; Abcam, Cambridge, UK); rabbit α-β-Gal (1:5000; ICN-Cappel, Aurora, OH); chicken α-GFP (1:2000; Molecular Probes, Eugene, OR); chicken α-proNplp1 (1:1000) and rabbit α-proFMRFa (1:1000) (Baumgardt et al. 2007); rat α-Grh (1:1000) (Baumgardt et al., 2009); rabbit α-Cas (1:2000) (Kambadur et al. 1998) (provided by W. Odenwald); rat mAb α-GsbN (1:10) (Buenzow and Holmgren 1995) (provided by R. Holmgren); mouse mAb α-Dap (1:500), mAb α-Antp (1:10), mAb α-Pros MR1A (1:10), and mAb α-Eya 10H6 (1:200) (Developmental Studies Hybridoma Bank, Iowa City, IA); rabbit α-CycE (1:500) (Santa Cruz Biotechnology, Santa Cruz, CA; and rabbit α-H3K4 trimethylation (1:1000; Abcam, AB8580).

Antibodies to Capa, CCAP, Crz, and Lk propeptides were generated by injecting animals with synthetic peptides (synthesized at Innovagen, Lund, Sweden) and conjugated to Keyhole limpet hemocyanin (KLH). proCapa (CKRSVDAKSFADISKGQKELN) was injected into two rabbits, proCCAP (CKQKMLQNEKEMQQLEERESK) was injected into two rabbits, proCrz (CLEELSAAGGASAEPNVFGKH) was injected into four hens, and proLk (CQRFHSWGGKRSPEPPILPDY) was injected into two rabbits. The N-terminal cysteine was added to allow for affinity purification. Sera from animals showing specific staining were purified using UltraLinkTM Iodoacetyl columns (PIERCE) and eluted at pH 7.0 using ActiSep (Sterogene). Peptide conjugation, animal sera production, and affinity purification was conducted by Agrisera (Umea, Sweden). Antibodies were used at anti-proCapa (1:500), anti-proCCAP (1:500), anti-proCrz (1:1000), and anti-proLk (1:500).

Confocal imaging, intensity measurements, and image analysis

Fluorescent images were captured on Zeiss LSM700 confocal microscopes and confocal stacks were visualized utilizing LSM software. Intensity measurement was done using ImageJ software, and control was always stained on the same slide and scanned using the same settings as for mutants. Statistical analysis was done using GraphPad Prism software. Adobe Photoshop and Adobe Illustrator was used to compile figures and graphs.

Sequencing of the Ctr912P023 allele

DNA of homozygous Ctr9 mutants was obtained from embryos at late stages, utilizing DNaesy Blood and Tissue Kit 5 (Qiagen, Hilden, Germany). A pair of primers were used to amplify a genomic 3770-bp segment, containing the eight exons of Ctr9, (forward primer: TGCATCAGCCGAGTAGAGA; reverse primer: AATCCCGGTTTGCCAGGTTT). Cloning of the PCR product was done by TOPO-TA Cloning Kit (Invitrogen) and sequenced (GATC Biotech, Konstanz, Germany), utilizing M13 forward and reverse primers.

RNA sequencing and analysis

RNA was extracted from frozen collections of homozygous Ctr9 mutants and wild-type embryos (50 mg), at late air-filled trachea (AFT) stage, using RNeasy Mini Kit (50) (Qiagen). Transcriptome sequencing of extracted RNA from samples was performed by GeneWhiz (South Plainfiled, NJ) on one lane of the HiSeq2500 with a 1 × 50 bp single-read sequencing configuration, which provided an average of 38 million reads per sample . RNA expression profiling and fold change comparison was performed using DNAStar 12.2.0.80, SeqMan NextGen software, performed in reads per kilobase of axon per million mapped sequence reads (RPMK). DNASTAR navigator 12.2.0.80 was used to search for RNA expression profiling, and gene ontology (GO) analysis were carried out with the web-based software GeneCodis (Carmona-Saez et al. 2007; Nogales-Cadenas et al. 2009; Tabas-Madrid et al. 2012).

Data availability

The authors state that all data necessary for confirming the conclusions presented in the article are represented fully within the article. Gene expression data is available upon request.

Results

Forward genetic screen for FMRFa-eGFP expression identifies Ctr9

To identify genes involved in nervous system development, we recently conducted a forward genetic screen focusing on the lineage and neuronal progeny of thoracic neuroblast 5-6 (NB5-6T) in the Drosophila ventral nerve cord (VNC) (Figure 1, A and B). We chose the NB5-6T lineage to identify novel genes required for lineage progression and terminal fate differentiation for numerous reasons, which together make it a very useful model. First, a unique feature of this rather large lineage is the highly selective expression of the neuropeptide FMRFa in the last neuron formed in the NB5-6T lineage, and hence in only six cells of the embryonic VNC (Figure 1, B and C). Second, this lineage has a programmed switch in its proliferation mode during lineage progression, switching from a Type I mode (generating daughters that divide once) to Type 0 mode (generating daughters that differentiate directly into postmitotic cells) for the last five divisions (Figure 1B) (Baumgardt et al. 2014; Baumgardt et al. 2009). The last four cells born in the lineage are the Apterous neurons (Ap cluster), and the last-born cell is the Ap4/FMRFa neuron. Hence, expression of FMRFa-eGFP in the last-born cell in the NB5-6T lineage (i.e., in a Type 0 daughter cell) not only identifies novel mutants that affect cell fate specification and differentiation, but also those that regulate proliferation control.

Using FMRFa-eGFP expression as marker, an EMS forward genetic screen for GFP expression in the Drosophila VNC was previously conducted, involving some 10,000 mutant lines (Bivik et al. 2015). One complementation group identified in the screen, displaying loss of FMRFa-eGFP, was mapped to the CG2469 gene (Figure 1, C and D) (Bivik et al. 2015). CG2469 encodes the single Drosophila ortholog of the Ctr9 gene; a member of the Paf1 complex (Paf1C; Figure 1M), and we will refer to CG2469 as Ctr9. The mouse and human genomes also contain a single Ctr9 gene, to which Drosophila shows an overall amino acid sequence identity of 68%, and a similarity of 81% (Figure 1L). In addition to a loss of FMRF-eGFP and proFMRFa neuropeptide expression, Ctr9 mutants often displayed a loss of the Nplp1 neuropeptide, normally expressed by the Ap1 neuron (Figure 1, E, F, and K). In contrast to loss of these terminal markers, there was often an extra Ap neuron in the cluster, and no loss of Ap neuron cell fate determinants, such as Dimm, Dac, and phosphorylated-Mad (Allan et al. 2005; Allan et al. 2003; Hewes et al. 2003; Miguel-Aliaga et al. 2004) (Figure 1, I–K).

Sequencing of the Ctr912P023 allele revealed a nonsense mutation early in the open reading frame (Figure 1L). This allele is likely a null, as all phenotypes were similar for Ctr912P023 homozygotes and hemizygotes (over a Ctr9 deficiency) (Figure 1K). Early Ctr9 expression revealed a maternal load, followed by ubiquitous zygotic expression at St4–6. However, from St7 onwards, expression is more restricted, with the strongest signal observed in the CNS (Berkeley Drosophila Genome Project; http://insitu.fruitfly.org). In order to confirm that it is the Ctr912P023 allele that causes lethality, we generated a UAS-Ctr9 transgene, and utilized insc-Gal4 to drive Ctr9 selectively in the developing nervous system. Hemizygous Ctr9 mutants (Ctr912P023/Ctr9Df) developed into late embryo stage (AFT), with some hatching into first instar larvae (L1). However, larvae were nonmotile and died. Rescue of Ctr9 mutants by insc > Ctr9 completely rescued all Ap cluster phenotypes, including restoration of FMRFa and Nplp1, as well as reducing Ap neuron numbers to wild type (Figure 1, G, H, and K). We also observed increased survival, as the rescued animals produced 20% motile L1 larvae that survived into late L1 stage (n = 60 larvae).

We conclude that Ctr9 is a highly conserved and essential gene in Drosophila, and that one important site of its function is the developing nervous system.

Ctr9 mutants show increased NB and daughter proliferation

The additional Ap neurons observed in Ctr9 mutants prompted us to investigate the proliferation profile in the NB5-6T lineage. Because of the programmed Type I > 0 switch in NB5-6T, and the stereotyped cell cycle exit of the NB at St15, increased Ap neuron numbers may reflect problems with the Type I > 0 switch and/or NB cell cycle exit.

To resolve the origin of extra Ap neurons in Ctr9 mutants, we used anti-Deadpan (Dpn), anti-Prospero (Pros) and anti-PH3, because they can be used to discriminate dividing NBs and daughter cells; NBs express Dpn and have asymmetrically distributed cortical Pros and PH3, whereas daughters are Dpn-negative and have nuclear Pros and PH3 (Figure 2A) (Baumgardt et al. 2014). In the wild-type lineage, we observed daughter divisions in NB5-6T up until St14, where the NB divided into St15 (Figure 2, A, C, and D). The presence of dividing daughters at St14, after the Type I > 0 switch occurred at St12, stems from the fact that while NBs divide every 40 min, daughters divide 100 min after they are born, and hence Type I daughters (GMCs) generated earlier in the lineage divide with a delay (Baumgardt et al. 2014; Hartenstein et al. 1987). In Ctr9 mutants, we observed a minor increase in daughter divisions at St12, but thereafter no evidence for prolonged daughter divisions (Figure 2D). We observed a stronger effect on NB divisions, with increased prolonged divisions into St16 and St17 (Figure 2, B and C).

Figure 2.

Figure 2

Ctr9 controls proliferation in the embryonic VNC. (A and B) Dividing NBs and daughters in the NB5-6T lineage can be identified by expression of GFP, Dpn, Pros, and PH3; NBs are GFP+, Dpn+, asymmetric cortical Pros+ and PH3+, while daughters are GFP+, Dpn−, nuclear Pros+ and PH3+. (A) In control, the NB divides until St15 while daughters divide until St14 (dividing cells are circled). (B) In Ctr9 mutants, NB divisions are observed also at St16 and St17. (A–B): Stain is anti-PH3, anti-Dpn, anti-Pros and anti-GFP. Magnification is 400X. In contrast, daughter divisions are not markedly extended into later stages. (C and D) Quantification of NB and daughter divisions in the NB5-6T lineage (* P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001; n ≥ 9 lineages; two-sided Chi-squared test ± SEM) reveals aberrant divisions at St16 and St17 in Ctr9. Daughter divisions are elevated at St12, but do not extend aberrantly into St15 and onward. (E and F) Global mitotic analysis in the VNC reveals increased divisions in Ctr9 mutants. (E–F): Stain is anti-Pros, anti-Dpn and anti-PH3. Magnification is 200X. In addition, the VNC appears enlarged and contains supernumerary Pros and Dpn cells. (G) Quantification of NB numbers (Dpn+/Pros-cytoplasmic) in T2 and T3 segments reveals a minor but significant increase in NB numbers (** P ≤ 0.01; Student’s two-tailed t-test ± SD; n ≥ 20 segments). (H and I) Quantification of NB and daughter divisions in T2 and T3 segments reveals increased NB and daughter divisions at multiple stages (* P ≤ 0.05; ** P ≤ 0.01; *** P ≤ 0.001; Student’s two-tailed t-test ± SD; n ≥ 14 segments). Genotypes: (A) lbe(K)-EGFP; (B) lbe(K)-EGFP, Ctr912P023/Ctr9Df = Df(3L)BSC250; (E) OregonR; (F) Ctr912P023/Ctr9Df = Df(3L)BSC250.

To further address the role of Ctr9 in proliferation control, we analyzed the NB3-3A lineage, which can be readily identified by expression of eagle and eagle-reporters (Dittrich et al. 1997; Lundell and Hirsh 1998). NB3-3A has a short Type I window, followed by a long Type 0 window, with the NB exiting the cell cycle at a defined stage (Supplemental Material, Figure S1D). Hence, it is an informative lineage for identifying daughter switch phenotypes, as well as NB exit problems (Baumgardt et al. 2014; Bivik et al. 2016). Using the abovementioned markers, we followed NB and daughter proliferation in NB3-3A from St13 to St16. In Ctr9 mutants we observed an increase in NB divisions at St13, and aberrant extension of NB divisions into St16. In contrast, we did not observe any daughter divisions during these stages in control or Ctr9 mutants (Figure S1, A–D).

To address if Ctr9 affects proliferation globally in the VNC, we used the same markers and analyzed the thoracic VNC between St12 and St16. This revealed a significant increase in proliferation in both NBs and daughter cells, albeit to different extents at different stages (Figure 2, E, F, H, and I). Ctr9 mutant VNCs appeared enlarged and displayed an apparent increase in the number of Pros and Dpn cells (Figure 2, E and F). Indeed, quantification of NBs (Dpn+/Pros-cytoplasmic) revealed a small but significant increase in the number of NBs (Figure 2G).

We conclude that Ctr9 mutants show an increased number of NBs, and elevated and extended NB divisions, both in the NB5-6T and NB3-3A lineages, as well as globally. There is elevated daughter proliferation globally, but minor daughter proliferation effects in NB5-6T, and no apparent daughter effects in NB3-3A.

hyrax (Cdc73/Parafibromin/Hrpt2) affects Ap cluster generation

The additional Ap neurons and loss of Nplp1 and FMRFa observed in Ctr9 mutants prompted us to use this sensitive read-out to investigate the role of other Paf1C members. As previously mentioned, the Paf1C members have not been extensively studied in Drosophila, and there is not an abundance of alleles available for these genes. However, strong alleles have been identified for the hyrax gene (Cdc73/Parafibromin/Hrpt2) (Mosimann et al. 2006). Therefore, we analyzed expression of the Ap cluster markers Eya, Nplp1, and FMRFa in a hyx2/hyx3 allelic combination. We observed a weak but significant effect on all three markers (Figure S2). These effects mimicked the Ctr9 mutants, with an increase of Eya (Ap cell numbers) but reduction of Nplp1 and FMRFa (Figure S2). We conclude that at least one additional Drosophila Paf1C member phenocopies Ctr9.

Ctr9 affects E2f1, Grh, Antp, and H3K4me3 expression in the embryonic VNC

Previous studies have linked Paf1C components to the Notch pathway, exemplified by its involvement in the regulation of Notch downstream genes, such as the HES genes (Akanuma et al. 2007; Tenney et al. 2006). Given that Notch signaling is known to affect both the NB selection process and the Type I > 0 daughter proliferation switch in the VNC (Lehmann et al. 1983; Poulson 1937; Ulvklo et al. 2012), we addressed the possible connection between Ctr9 and Notch signaling. To this end, we analyzed expression of the Notch target gene E(spl)-HLHm8, as evidenced by expression of an E(spl)-HLHm8-GFP reporter transgene that reports on Notch signaling in developing NBs (Ulvklo et al. 2012). However, this revealed no obvious effect on GFP expression in NBs or daughter cells, at St14 (Figure 3, A–C).

Figure 3.

Figure 3

Ctr9 affects E2f1, Grh, Antp and H3K4me3 expression in the embryonic VNC. (A and B) Expression of E(spl)-HLHm8-GFP in control and Ctr9 mutants, at St14, T2-T3. GFP expression is not apparently affected in Ctr9 mutants. anti-Dpn and anti-GFP stained. Magnification 400X. (C) Quantification of GFP levels in NBs at St14 reveals no significant effect (Student’s two-tailed t-test ± SD; n ≥ 127 NBs). (D–K) Expression of E2f1, CycE, Dap, and H3K4me3 in control and Ctr9 mutants, in thoracic T2–T3 segments, at St14. Dividing NBs are circled. Levels of E2f1 are increased in dividing NBs, while H3K4me3 is decreased. (L–O) Quantification of Dap, CycE, E2f1, CycA, CycB, H3K4me3, Grh, Cas, and Antp expression levels in dividing NBs, in control and Ctr9 mutants, in T2 and T3 segments, at St14. Expression of E2f1 is significantly increased in Ctr9 mutants, while the other four cell cycle proteins are not affected. (D–K) anti-Dpn, anti-PH3, anti-E2f1 stained (D–E), anti-CycE (F–G), anti-Dap (H–I) and anti-H3K27me3 (J–K). Magnification if 400X. With regard to the developmental regulators, Ctr9 mutants display elevated Antp expression and lowered Grh expression, while Cas was not affected. H3K4me3 is reduced in Ctr9 mutants (* P ≤ 0.05; *** P ≤ 0.001; Student’s two-tailed t-test ± SD; n ≥ 85 NBs).

The global proliferation phenotypes we observed in Ctr9 mutants prompted us to also address expression of several key regulators involved in NB and daughter proliferation control in the VNC. We focused on the two temporal factors, Castor (Cas) and Grainy head (Grh), as well as the Hox factor Antennapedia (Antp), again focusing on dividing NBs in the T2–T3 segments (Baumgardt et al. 2014). These studies revealed no effect on Cas and a partial loss of Grh, while Antp was upregulated (Figure 3O).

A number of cell cycle genes have been identified as key components for NB and daughter proliferation control in the Drosophila embryonic VNC (Baumgardt et al. 2014). To understand the underlying mechanisms behind the increased proliferation in Ctr9 mutants, we addressed the expression of Cyclin A (CycA), Cyclin B (CycB), Cyclin E (CycE), E2f1, and Dacapo (Dap). Because both the E2f1 and Dap protein levels cycle during the cell cycle, with nondetectable levels during S-phase (Baumgardt et al. 2014), we quantified dividing NBs, focusing on thoracic segments T2–T3, at St14. We noted a significant increase in E2f1 expression in Ctr9 mutants, while the other four cell cycle proteins were not affected (Figure 3, D–I, L, and M).

Finally, given the known role of Paf1C in histone modifications, we addressed the level of H3K4me3 modification, using an antibody directed against this modification, in NBs at St14, again focusing on thoracic segments T2–T3. We noted an apparent overall decrease in H3K4me3 in the VNC (Figure 3, J and K), and quantification revealed significant reduction in the expression levels in NBs (Figure 3N).

Ctr9 regulates a number of neuropeptides

The near complete loss of the FMRFa and Nplp1 neuropeptides prompted us to analyze expression of a number of other neuropeptides. To this end, we generated antibodies to four neuropeptides known to be expressed in the developing CNS (see Materials and Methods): Crustacean cardioactive peptide (CCAP), Leucokinin (Lk), Corazonin (Crz), and Capability (Capa) (Park et al. 2008). Analyzing late-stage embryos, we noted strong reduction in the expression of all four neuropeptides in Ctr9 mutants, both with respect to intensity of expression and apparent loss of expression in some cells (Figure 4, A–H).

Figure 4.

Figure 4

Ctr9 affects expression of several neuropeptide genes. (A–H) Expression of CCAP, Crz, Lk, and Capa neuropeptides in the CNS, at AFT stage, in control and Ctr9 mutants. For each neuropeptide, CNSs from control and mutant were stained on the same slide and scanned using identical confocal settings. Expression of all four neuropeptides is affected in Ctr9 mutants, with levels down in all expressing cells and expression beyond detection for many cells. (A–B) Anti-CCAP stained (C–D) Lk. stained (E–F) Crz Stained. (G–H) Capa Stained. Magnification is 200x. (I) Transcriptome analysis (RNA sequencing) of control and Ctr9 mutants, from RNA prepared at stage AFT; pair-wise comparison of two independent wild-type and mutant samples. In line with the antibody analysis, transcriptome analysis reveals downregulation of FMRFa, Nplp1, Crz, Lk, and Capa neuropeptide genes. In addition, Tachykinin, Hugin, and the Ilp2, Ilp3, and Ilp8 genes were also downregulated. Ccap was not downregulated.

To validate these findings, and to obtain a broader picture of the gene expression changes in Ctr9 mutants, we analyzed the transcriptome in late-stage embryos. To this end, two independent RNA preparations were extracted from wild-type and Ctr9 mutant embryos at late embryonic stage (AFT). The four RNA samples was subjected to sequencing on the Illumina HiSeq2500, with 50 bp single reads, at an average depth of 38M reads per sample. The four pair-wise comparisons between the two wild-type and two Ctr9 mutant biological replicates were in line with the antibody staining, and revealed downregulation of five out of the six neuropeptide genes tested (Figure 4I). We also noted downregulation of the Tachykinin (Tk) and Hugin (Hug) neuropeptide genes, as well as three of the Insulin-like peptide genes (Ilp2, Ilp3, and Ilp8) (Figure 5I).

Figure 5.

Figure 5

Ctr9 affects expression of metabolic genes. Pair-wise comparison between two control and two Ctr9 mutant RNA samples, all isolated at stage AFT, reveals a significant enrichment for gene expression changes in genes involved in metabolism. (A) Down-regulated genes. (B) Up-regulated genes. BP, Biological Process.

Hence, in addition to FMRFa and Nplp1, a number of other terminal differentiation genes (such as neuropeptides) are affected in Ctr9 mutants.

Ctr9 mutants display changes in gene expression of homeostatic genes

Pair-wise comparisons between the two wild-type and two Ctr9 mutant transcriptomes revealed that 252 genes were ≥2-fold upregulated in Ctr9 mutants, while 797 genes were ≥2-fold downregulated (Table S1). The bias toward gene downregulation is in agreement with the important role of the Paf1 complex in Pol II transcription. In line with the involvement of Paf1C in the regulation of Notch downstream genes, such as the HES genes (Akanuma et al. 2007; Tenney et al. 2006), we noted downregulation of six previously identified Notch target genes (Krejci et al. 2009). These include three other E(spl) complex genes: E(spl)m4, E(spl)m5-HLH, E(spl)m6, Peb, Him, and stg (Table S1). Looking at the GO profile of the misregulated genes, we noted a significant overrepresentation of genes involved in adult homeostatic processes, such as proteolysis, metabolic, and oxidative processes (Figure 5, A and B).

Discussion

The Paf1C is involved in a number of transcriptional and epigenetic events. Here, we provide the first detailed study of the Drosophila gene encoding one of the central components, Ctr9, and find that this gene is essential in Drosophila. Our results point to Ctr9 contributing to NB selection, proliferation control, terminal differentiation, and control of metabolic gene expression. Analysis of histone modifications further reveals a clear reduction in H3K4me3, in line with the known role of Paf1C in controlling this modification. We also observed a phenocopy of the Ctr9 effects on the Ap cluster neurons, albeit milder, in hyrax mutants (Cdc73/Parafibromin/Hrpt2). This lends some support to the notion that the effects of Ctr9 may occur during Drosophila embryogenesis, within the context of a canonical Paf1C.

Involvement of Ctr9 in proliferation control

We observed elevated and extended NB divisions in Ctr9 mutants, both globally and in two specific lineages. We also noted a minor increase in overall NB numbers. These extra NBs may stem from defects in the lateral inhibition process and/or from dedifferentiation of daughter cells into NBs. Irrespective of their origin(s), the extra NBs observed in Ctr9 raises the question of whether proliferation effects are solely due to the presence of supernumerary NBs. However, we do not favor this interpretation because global NB proliferation was robustly elevated and extended during several stages while the increase in NB numbers was minimal. In addition, we did not observe any extra NB5-6T or NB3-3A NBs, and we still observed elevated and extended NB proliferation in these single lineages.

Regarding increased daughter proliferation, we noted minor effects in NB5-6T but no effects in NB3-3A. Globally, we did observe elevated daughter divisions, but these may stem from elevated and extended NB divisions. Hence, we favor the interpretation that increased daughter proliferation in Ctr9 mutants primarily results from a combination of supernumerary NBs and extended NB proliferation, with the latter being the main driver. However, we cannot rule out problems with the precise execution of the Type I > 0 daughter proliferation switch.

What are the underlying gene expression changes driving increased proliferation in Ctr9 mutants? While we noted increase in E2f1 expression, E2f1 only plays a minor role in VNC proliferation (Baumgardt et al. 2014). In mammals, Parafibromin (Cdc73/Hyrax) and Paf1 were found to control expression of a number of cyclins (Moniaux et al. 2009; Woodard et al. 2005). However, we did not observe any effects on CycE, CycA, or CycB expression. We did not analyze CycD expression, but it was previously found not to be a key regulator of embryonic VNC proliferation (Baumgardt et al. 2014). In addition to E2f1 upregulation, we noted weak expression changes of two transcription factors known to be important for VNC proliferation control (Baumgardt et al. 2014): downregulation of Grh and upregulation of Antp. Both Grh and Antp were found to repress E2f1 (Baumgardt et al. 2014). Hence the downregulation of Grh in Ctr9 could, at least in part, explain the upregulation of E2f1, while the upregulation of Antp does not fit easily with its role in repressing E2f1 expression.

Paf1C/Ctr9 is important for proper Notch signaling

We noted supernumerary NBs in Ctr9 mutants, and since it is well known that NB selection during early VNC formation critically depends upon Notch signaling (Lehmann et al. 1983; Poulson 1937), it is tempting to speculate that these effects are due to affects upon early Notch signaling. This notion is further supported by other studies that have revealed a link between Paf1C and Notch signaling in both Drosophila and zebrafish (Akanuma et al. 2007; Tenney et al. 2006). Moreover, Paf1C is essential in recruiting the Rad6-Bre1 H2B ubiquitin ligase complex (Tomson and Arndt 2013), and Bre1 has been found have an important effect on Notch signaling, evidenced in part by downregulation of the E(spl)-HLH (HES) Notch target genes (Bray et al. 2005). Surprisingly, we did not find any apparent effects upon E(spl)m8-GFP expression at St14. However, in the transcriptome analysis we did note downregulation of six previously identified Notch target genes (Krejci et al. 2009), including three other E(spl) complex genes: E(spl)m4, E(spl)m5-HLH, E(spl)m6, Peb, Him, and stg (Table S1). In addition to the possible connection between Ctr9, Paf1C, and Notch signaling with respect to NB selection, our studies have previously identified that late Notch signaling also controls the Type I > 0 daughter proliferation switch in the developing VNC (Bivik et al. 2016; Ulvklo et al. 2012). Hence, we propose that in several of the Ctr9 mutant phenotypes, extra NBs and increased daughter proliferation are likely due to a connection between Ctr9 and the Notch pathway. Against the backdrop of growing evidence for a tight interplay between Paf1C/Ctr9 and Notch signaling, as well as cell cycle gene expression, it is not surprising that Paf1C/Ctr9 is emerging as an important factor in human cancer (Dey et al. 2011; Hanks et al. 2014; Muntean et al. 2010; Newey et al. 2009; Takahashi et al. 2011; Zeng and Xu 2015).

Ctr9 and the Paf1C: connections to early embryonic development

A number of studies have identified important roles for Paf1C in early mouse development, as well as in embryonic stem cell identity, and Ctr9 knockdown and Parafibromin (Hrpt2) knockout completely blocks early mouse embryo development (Ding et al. 2009; Ponnusamy et al. 2009; Wang et al. 2008; Zhang et al. 2013).

In contrast to these effects, we find rather mild effects of Ctr9 mutations on embryonic development in Drosophila, and although the gene is essential, embryos develop until completion, with a small number even hatching out as larvae (although they immediately die). The reason for this embryonic “escape” from Ctr9 function may be due to the maternal loading of the genes, and hence embryonic development can rely solely upon maternal Ctr9 RNA and protein.

Ctr9 regulates metabolism genes

The Paf1C has previously been linked to dynamic gene regulation, being involved in heat-shock response genes in Drosophila (Hsp70) (Adelman et al. 2006), and in the regulation of metabolic genes, i.e., those involved in lipid and nucleic acid metabolism in yeast (Betz et al. 2002). In line with these findings, our genome-wide transcriptome analysis revealed that Ctr9 mutants were enriched for expression changes in a number of metabolic genes, including lipid metabolism and nucleotide biosynthesis (Figure 5 and Table S1). It would thus appear that the connection between Paf1C and metabolic gene regulation is conserved in eukaryotes.

Supplementary Material

Supplemental Material

Acknowledgments

We are grateful to Johannes Bischof, Konrad Basler, Ward Odenwald, Jim Posakony, the Developmental Studies Hybridoma Bank at the University of Iowa, the Drosophila Genomics Resource Center, and the Bloomington Stock Center for sharing antibodies, fly lines, and DNAs. We thank Douglas W. Allan for critically reading the manuscript. Helen Ekman, Carolin Jonsson, and Annika Starkenberg provided excellent technical assistance. This work was supported by the Swedish Research Council (621-2013-5258), the Knut and Alice Wallenberg Foundation (KAW2011.0165), the Swedish Cancer Foundation (120531), and the Swedish Royal Academy of Sciences, to S.T.

Footnotes

Supplemental material is available online at www.g3journal.org/lookup/suppl/doi:10.1534/g3.116.034231/-/DC1

Communicating editor: H. K. Salz

Literature Cited

  1. Adelman K., Wei W., Ardehali M. B., Werner J., Zhu B., et al. , 2006.  Drosophila Paf1 modulates chromatin structure at actively transcribed genes. Mol. Cell. Biol. 26: 250–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akanuma T., Koshida S., Kawamura A., Kishimoto Y., Takada S., 2007.  Paf1 complex homologues are required for Notch-regulated transcription during somite segmentation. EMBO Rep. 8: 858–863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Allan D. W., Pierre S. E., Miguel-Aliaga I., Thor S., 2003.  Specification of neuropeptide cell identity by the integration of retrograde BMP signaling and a combinatorial transcription factor code. Cell 113: 73–86. [DOI] [PubMed] [Google Scholar]
  4. Allan D. W., Park D., St Pierre S. E., Taghert P. H., Thor S., 2005.  Regulators acting in combinatorial codes also act independently in single differentiating neurons. Neuron 45: 689–700. [DOI] [PubMed] [Google Scholar]
  5. Baumgardt M., Miguel-Aliaga I., Karlsson D., Ekman H., Thor S., 2007.  Specification of neuronal identities by feedforward combinatorial coding. PLoS Biol. 5: 295–308. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Baumgardt M., Karlsson D., Terriente J., Diaz-Benjumea F. J., Thor S., 2009.  Neuronal subtype specification within a lineage by opposing temporal feed-forward loops. Cell 139: 969–982. [DOI] [PubMed] [Google Scholar]
  7. Baumgardt M., Karlsson D., Salmani B. Y., Bivik C., MacDonald R. B., et al. , 2014.  Global programmed switch in neural daughter cell proliferation mode triggered by a temporal gene cascade. Dev. Cell 30: 192–208. [DOI] [PubMed] [Google Scholar]
  8. Betz J. L., Chang M., Washburn T. M., Porter S. E., Mueller C. L., et al. , 2002.  Phenotypic analysis of Paf1/RNA polymerase II complex mutations reveals connections to cell cycle regulation, protein synthesis, and lipid and nucleic acid metabolism. Mol. Genet. Genomics 268: 272–285. [DOI] [PubMed] [Google Scholar]
  9. Bischof J., Maeda R. K., Hediger M., Karch F., Basler K., 2007.  An optimized transgenesis system for Drosophila using germ-line-specific φC31 integrases. Proc. Natl. Acad. Sci. USA 104: 3312–3317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bivik C., Bahrampour S., Ulvklo C., Nilsson P., Angel A., et al. , 2015.  Novel genes involved in controlling specification of Drosophila FMRFamide neuropeptide cells. Genetics 200: 1229–1244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Bivik C., MacDonald R. B., Gunnar E., Mazouni K., Schweisguth F., et al. , 2016.  Control of neural daughter cell proliferation by multi-level Notch/Su(H)/E(spl)-HLH signaling. PLoS Genet. 12: e1005984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Bray S., Musisi H., Bienz M., 2005.  Bre1 is required for Notch signaling and histone modification. Dev. Cell 8: 279–286. [DOI] [PubMed] [Google Scholar]
  13. Buenzow D. E., Holmgren R., 1995.  Expression of the Drosophila gooseberry locus defines a subset of neuroblast lineages in the central nervous system. Dev. Biol. 170: 338–349. [DOI] [PubMed] [Google Scholar]
  14. Campos-Ortega J. A., Hartenstein V., 1985.  The Embryonic Development of Drosophila melanogaster, Springer-Verlag, New York. [Google Scholar]
  15. Cantone I., Fisher A. G., 2013.  Epigenetic programming and reprogramming during development. Nat. Struct. Mol. Biol. 20: 282–289. [DOI] [PubMed] [Google Scholar]
  16. Carmona-Saez P., Chagoyen M., Tirado F., Carazo J. M., Pascual-Montano A., 2007.  GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists. Genome Biol. 8: R3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Castro B., Barolo S., Bailey A. M., Posakony J. W., 2005.  Lateral inhibition in proneural clusters: cis-regulatory logic and default repression by Suppressor of Hairless. Development 132: 3333–3344. [DOI] [PubMed] [Google Scholar]
  18. Chen F. X., Woodfin A. R., Gardini A., Rickels R. A., Marshall S. A., et al. , 2015.  PAF1, a molecular regulator of promoter-proximal pausing by RNA polymerase II. Cell 162: 1003–1015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dey P., Ponnusamy M. P., Deb S., Batra S. K., 2011.  Human RNA polymerase II-association factor 1 (hPaf1/PD2) regulates histone methylation and chromatin remodeling in pancreatic cancer. PLoS One 6: e26926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Di Como C. J., Chang H., Arndt K. T., 1995.  Activation of CLN1 and CLN2 G1 cyclin gene expression by BCK2. Mol. Cell. Biol. 15: 1835–1846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ding L., Paszkowski-Rogacz M., Nitzsche A., Slabicki M. M., Heninger A. K., et al. , 2009.  A genome-scale RNAi screen for Oct4 modulators defines a role of the Paf1 complex for embryonic stem cell identity. Cell Stem Cell 4: 403–415. [DOI] [PubMed] [Google Scholar]
  22. Dittrich R., Bossing T., Gould A. P., Technau G. M., Urban J., 1997.  The differentiation of the serotonergic neurons in the Drosophila ventral nerve cord depends on the combined function of the zinc finger proteins Eagle and Huckebein. Development 124: 2515–2525. [DOI] [PubMed] [Google Scholar]
  23. Foreman P. K., Davis R. W., 1996.  CDP1, a novel Saccharomyces cerevisiae gene required for proper nuclear division and chromosome segregation. Genetics 144: 1387–1397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hanks S., Perdeaux E. R., Seal S., Ruark E., Mahamdallie S. S., et al. , 2014.  Germline mutations in the PAF1 complex gene CTR9 predispose to Wilms tumour. Nat. Commun. 5: 4398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hartenstein V., Rudloff E., Campos-Ortega J. A., 1987.  The pattern of proliferation of the neuroblasts in the wild-type embryo of Drosophila melanogaster. Roux Arch. Dev. Biol. 196: 473–485. [DOI] [PubMed] [Google Scholar]
  26. Hewes R. S., Park D., Gauthier S. A., Schaefer A. M., Taghert P. H., 2003.  The bHLH protein Dimmed controls neuroendocrine cell differentiation in Drosophila. Development 130: 1771–1781. [DOI] [PubMed] [Google Scholar]
  27. Jaehning J. A., 2010.  The Paf1 complex: platform or player in RNA polymerase II transcription? Biochim. Biophys. Acta 1799: 379–388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kambadur R., Koizumi K., Stivers C., Nagle J., Poole S. J., et al. , 1998.  Regulation of POU genes by castor and hunchback establishes layered compartments in the Drosophila CNS. Genes Dev. 12: 246–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kowalik K. M., Shimada Y., Flury V., Stadler M. B., Batki J., et al. , 2015.  The Paf1 complex represses small-RNA-mediated epigenetic gene silencing. Nature 520: 248–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Krejci A., Bernard F., Housden B. E., Collins S., Bray S. J., 2009.  Direct response to Notch activation: signaling crosstalk and incoherent logic. Sci. Signal. 2: ra1. [DOI] [PubMed] [Google Scholar]
  31. Leeb M., Wutz A., 2012.  Establishment of epigenetic patterns in development. Chromosoma 121: 251–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Lehmann R., Jimenez F., Dietrich U., Campos-Ortega J. A., 1983.  On the phenotype and development of mutants of early neurogenesis in Drosophila melanogaster. Rouxs Arch. Dev. Biol. 192: 62–74. [DOI] [PubMed] [Google Scholar]
  33. Lundell M. J., Hirsh J., 1998.  eagle is required for the specification of serotonin neurons and other neuroblast 7–3 progeny in the Drosophila CNS. Development 125: 463–472. [DOI] [PubMed] [Google Scholar]
  34. Miguel-Aliaga I., Allan D. W., Thor S., 2004.  Independent roles of the dachshund and eyes absent genes in BMP signaling, axon pathfinding and neuronal specification. Development 131: 5837–5848. [DOI] [PubMed] [Google Scholar]
  35. Moniaux N., Nemos C., Deb S., Zhu B., Dornreiter I., et al. , 2009.  The human RNA polymerase II-associated factor 1 (hPaf1): a new regulator of cell-cycle progression. PLoS One 4: e7077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mosimann C., Hausmann G., Basler K., 2006.  Parafibromin/Hyrax activates Wnt/Wg target gene transcription by direct association with β-catenin/Armadillo. Cell 125: 327–341. [DOI] [PubMed] [Google Scholar]
  37. Mosimann C., Hausmann G., Basler K., 2009.  The role of Parafibromin/Hyrax as a nuclear Gli/Ci-interacting protein in Hedgehog target gene control. Mech. Dev. 126: 394–405. [DOI] [PubMed] [Google Scholar]
  38. Mueller C. L., Jaehning J. A., 2002.  Ctr9, Rtf1, and Leo1 are components of the Paf1/RNA polymerase II complex. Mol. Cell. Biol. 22: 1971–1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Muller J., Verrijzer P., 2009.  Biochemical mechanisms of gene regulation by polycomb group protein complexes. Curr. Opin. Genet. Dev. 19: 150–158. [DOI] [PubMed] [Google Scholar]
  40. Muntean A. G., Tan J., Sitwala K., Huang Y., Bronstein J., et al. , 2010.  The PAF complex synergizes with MLL fusion proteins at HOX loci to promote leukemogenesis. Cancer Cell 17: 609–621. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Newey P. J., Bowl M. R., Thakker R. V., 2009.  Parafibromin–functional insights. J. Intern. Med. 266: 84–98. [DOI] [PubMed] [Google Scholar]
  42. Nogales-Cadenas R., Carmona-Saez P., Vazquez M., Vicente C., Yang X., et al. , 2009.  GeneCodis: interpreting gene lists through enrichment analysis and integration of diverse biological information. Nucleic Acids Res. 37: W317–W322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Park D., Veenstra J. A., Park J. H., Taghert P. H., 2008.  Mapping peptidergic cells in Drosophila: where DIMM fits in. PLoS One 3: e1896. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ponnusamy M. P., Deb S., Dey P., Chakraborty S., Rachagani S., et al. , 2009.  RNA polymerase II associated factor 1/PD2 maintains self-renewal by its interaction with Oct3/4 in mouse embryonic stem cells. Stem Cells 27: 3001–3011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Poulson D. F., 1937.  Chromosomal deficiencies and the embryonic development of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 23: 133–137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sadeghi L., Prasad P., Ekwall K., Cohen A., Svensson J. P., 2015.  The Paf1 complex factors Leo1 and Paf1 promote local histone turnover to modulate chromatin states in fission yeast. EMBO Rep. 16: 1673–1687. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Shi X., Finkelstein A., Wolf A. J., Wade P. A., Burton Z. F., et al. , 1996.  Paf1p, an RNA polymerase II-associated factor in Saccharomyces cerevisiae, may have both positive and negative roles in transcription. Mol. Cell. Biol. 16: 669–676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Shi X., Chang M., Wolf A. J., Chang C. H., Frazer-Abel A. A., et al. , 1997.  Cdc73p and Paf1p are found in a novel RNA polymerase II-containing complex distinct from the Srbp-containing holoenzyme. Mol. Cell. Biol. 17: 1160–1169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Spradling A. C., Stern D., Beaton A., Rhem E. J., Laverty T., et al. , 1999.  The Berkeley Drosophila Genome Project gene disruption project. Single P-element insertions mutating 25% of vital Drosophila genes. Genetics 153: 135–177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Squazzo S. L., Costa P. J., Lindstrom D. L., Kumer K. E., Simic R., et al. , 2002.  The Paf1 complex physically and functionally associates with transcription elongation factors in vivo. EMBO J. 21: 1764–1774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Tabas-Madrid D., Nogales-Cadenas R., Pascual-Montano A., 2012.  GeneCodis3: a non-redundant and modular enrichment analysis tool for functional genomics. Nucleic Acids Res. 40: W478–W483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Takahashi A., Tsutsumi R., Kikuchi I., Obuse C., Saito Y., et al. , 2011.  SHP2 tyrosine phosphatase converts parafibromin/Cdc73 from a tumor suppressor to an oncogenic driver. Mol. Cell 43: 45–56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Tenney K., Gerber M., Ilvarsonn A., Schneider J., Gause M., et al. , 2006.  Drosophila Rtf1 functions in histone methylation, gene expression, and Notch signaling. Proc. Natl. Acad. Sci. USA 103: 11970–11974. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tomson B. N., Arndt K. M., 2013.  The many roles of the conserved eukaryotic Paf1 complex in regulating transcription, histone modifications, and disease states. Biochim. Biophys. Acta 1829: 116–126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Ulvklo C., Macdonald R., Bivik C., Baumgardt M., Karlsson D., et al. , 2012.  Control of neuronal cell fate and number by integration of distinct daughter cell proliferation modes with temporal progression. Development 139: 678–689. [DOI] [PubMed] [Google Scholar]
  56. Wang P., Bowl M. R., Bender S., Peng J., Farber L., et al. , 2008.  Parafibromin, a component of the human PAF complex, regulates growth factors and is required for embryonic development and survival in adult mice. Mol. Cell. Biol. 28: 2930–2940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Woodard G. E., Lin L., Zhang J. H., Agarwal S. K., Marx S. J., et al. , 2005.  Parafibromin, product of the hyperparathyroidism-jaw tumor syndrome gene HRPT2, regulates cyclin D1/PRAD1 expression. Oncogene 24: 1272–1276. [DOI] [PubMed] [Google Scholar]
  58. Yu M., Yang W., Ni T., Tang Z., Nakadai T., et al. , 2015.  RNA polymerase II-associated factor 1 regulates the release and phosphorylation of paused RNA polymerase II. Science 350: 1383–1386. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Zeng H., Xu W., 2015.  Ctr9, a key subunit of PAFc, affects global estrogen signaling and drives ERα-positive breast tumorigenesis. Genes Dev. 29: 2153–2167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Zhang K., Haversat J. M., Mager J., 2013.  CTR9/PAF1c regulates molecular lineage identity, histone H3K36 trimethylation and genomic imprinting during preimplantation development. Dev. Biol. 383: 15–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Material

Data Availability Statement

The authors state that all data necessary for confirming the conclusions presented in the article are represented fully within the article. Gene expression data is available upon request.


Articles from G3: Genes|Genomes|Genetics are provided here courtesy of Oxford University Press

RESOURCES