Abstract
Premise of the study:
Chunia bucklandioides (Hamamelidaceae), endemic to Hainan, China, is listed as threatened in the IUCN Red List and is now only found on Mt. Diaoluo and Mt. Jianfeng. Thus, microsatellite markers were developed for future conservation genetic studies of this species.
Methods and Results:
A total of 115 primers were designed on the basis of the transcriptome data of C. bucklandioides. Of them, 59 successfully amplified in C. bucklandioides and polymorphisms were detected in 11; the number of alleles per locus varied from two to five, the observed heterozygosity ranged from 0.000 to 0.941, and the expected heterozygosity ranged from 0.000 to 0.699. A total of 13 primers amplified in Mytilaria laosensis, and five primers amplified in Exbucklandia tonkinensis and E. populnea.
Conclusions:
The markers screened here provide a basis to assess genetic structure and further establish conservation strategies for C. bucklandioides.
Keywords: Chunia bucklandioides, Hamamelidaceae, microsatellite markers, transcriptome
Hamamelidaceae, a family of woody plants ranging from tall trees to small shrubs, is an ancient family of approximately 26 genera and 100 species (Endress, 1993). The genera in this family are small: 14 are monotypic, six contain only two to three species, and others are composed of five to 14 species. Furthermore, most species in this family are narrow endemics or are very restricted in their distribution mostly due to past climatic changes (Endress, 1993). Fourteen species of Hamamelidaceae are currently listed as threatened in the IUCN Red List of Threatened Species (IUCN, 2015). To date, only sporadic studies have emphasized the genetic study and conservation of these species (Yu et al., 2014; Hatmaker et al., 2015).
Chunia bucklandioides H. T. Chang (Hamamelidaceae), the only species in Chunia H. T. Chang, was listed as threatened in the IUCN Red List in 1997. It is a tall tree endemic to Hainan, China, and the wood can be applied in agricultural implements, furniture, and construction. However, it is now found only on Mt. Diaoluo and Mt. Jianfeng (IUCN, 2015). Here, we developed and characterized 11 polymorphic expressed sequence tag–simple sequence repeat (EST-SSR) markers and tested their cross-transferability in three related species—Mytilaria laosensis Lecomte, Exbucklandia tonkinensis (Lecomte) H. T. Chang, and E. populnea (R. Br. ex Griff.) R. W. Brown—on the basis of the phylogenetic tree of Hamamelidaceae (Shi et al., 1999). We expect that these markers will be useful for future conservation genetic studies of the species.
METHODS AND RESULTS
The total RNAs were extracted from the fresh leaves of one individual of C. bucklandioides (Mt. Diaoluo; Appendix 1) using the optimized cetyltrimethylammonium bromide (CTAB) method (Gambino et al., 2008). A normalized cDNA library was constructed and sequenced using the HiSeq 2000 system (Illumina, San Diego, California, USA). A total of 55.34 million 100-bp paired-end reads were produced and de novo assembled into 88,011 contigs (N50: 1056 bp) using Trinity (Grabherr et al., 2011). With the MISA tool (Thiel et al., 2003; http://pgrc.ipk-gatersleben.de/misa), 11,100 SSRs were detected in 9456 contigs. Of them, dinucleotide repeat motifs (72.73%) were the most common, followed by tri- (24.69%), tetra- (2.23%), penta- (0.19%), and hexanucleotide (0.16%) repeats. Using Primer3 (Rozen and Skaletsky, 1999), 115 paired primers were designed on the basis of randomly selected contigs containing SSR loci, which were deposited in GenBank (Appendix S1).
A total of 48 individuals of C. bucklandioides representing two populations were used to evaluate the polymorphisms of the target SSR loci, and 28 individuals of M. laosensis, E. tonkinensis, and E. populnea were used to test their transferability (Appendix 1). Total genomic DNA was extracted from silica-dried leaves of these individuals using the modified CTAB method (Doyle, 1987). Voucher specimens of these species were deposited at the Herbarium of Sun Yat-sen University, Guangzhou, Guangdong Province, China.
The PCR amplification trials were performed on two individuals from each of the two C. bucklandioides populations according to Fan et al. (2013), with appropriate annealing temperature (52–55°C; Table 1). For the 59 primer pairs that showed clear peaks with expected allele size, six individuals from each population were selected to tentatively assess their size polymorphism. The products were inspected with the Fragment Analyzer Automated CE System (Advanced Analytical Technologies [AATI], Ames, Iowa, USA) using the Quant-iT PicoGreen dsDNA Reagent Kit (35–500 bp; Invitrogen, Carlsbad, California, USA). The raw data were further processed to obtain allele size and number using PROSize version 2.0 software (AATI). The results showed that 11 loci were polymorphic in C. bucklandioides, and 48 loci were monomorphic. Further PCR amplification was performed on 48 individuals of C. bucklandioides with these 11 polymorphic primer pairs. The statistical parameters, including the number of alleles per locus (A), observed heterozygosity (Ho), and expected heterozygosity (He), were calculated with GenAlEx version 6.5 (Peakall and Smouse, 2012). GENEPOP 4.3 was used to measure the departure from Hardy–Weinberg equilibrium (HWE) (Rousset, 2008). The results showed that A varied from two to five, and Ho and He ranged from 0.000 to 0.941 and from 0.000 to 0.699, respectively. Four and six loci showed significant deviation from HWE in the Mt. Diaoluo and Mt. Jianfeng populations, respectively (see Table 2).
Table 1.
Characteristics of 19 microsatellite loci isolated from Chunia bucklandioides that showed polymorphism in C. bucklandioides or that could be amplified in closely related taxa.
| Locus | Primer sequences (5′–3′) | Repeat motif | Expected allele size (bp) | Ta (°C) | GenBank accession no. | Putative function [organism]a |
| N31 | F: ATTAGTCCATAACGGCTAGT | (CTA)5 | 161 | 52 | KX254740 | — |
| R: CCAAGAGAAGACAATGAACC | ||||||
| N34 | F: GCTTCCTCGTCCTTCTCT | (GAC)6 | 311 | 52 | KX254743 | PREDICTED: RING-H2 finger protein ATL67-like [Nelumbo nucifera] |
| R: CGGCATCATTCTAATCATCTC | ||||||
| N50 | F: TGAGCATCTGATTACGAAGA | (TTGT)6 | 204 | 52 | KX254759 | Conserved hypothetical protein [Ricinus communis] |
| R: CCAATCTCCGATACGACTT | ||||||
| N54 | F: CGGGAGATGATAAAGGATACA | (AT)8 | 237 | 52 | KX254763 | Hypothetical protein ZeamMp042 [Zea mays subsp. mays] |
| R: GGATCGGAGAAGCATTCG | ||||||
| N91 | F: GCTACCTGACCTCTTCTTC | (CT)6 | 361 | 55 | KX254800 | Uncharacterized protein LOC100854009 [Vitis vinifera] |
| R: GATTACTCGGACGGTGAC | ||||||
| N1 | F: ATCGCCATTCTTGCTCTC | (AG)6 | 300 | 52 | KX254710 | — |
| R: GCTCCAATACACGCCATA | ||||||
| N6 | F: GCCTCCGTTAATTGTGTAC | (AT)6 | 317 | 52 | KX254715 | Hypothetical protein, partial (mitochondrion) [Nicotiana tabacum] |
| R: AGCCTTCGATGTAGTGATG | ||||||
| N49 | F: GGAACAACCACGAAGAAGA | (AAG)7 | 219 | 52 | KX254758 | PREDICTED: nucleolar protein 56-like [Vitis vinifera] |
| R: GTCTACTCTGCCACAACTATA | ||||||
| N65 | F: TCACTTCTACCTCGCAATG | (CTT)5 | 187 | 52 | KX254774 | Uncharacterized protein LOC100262883 [Vitis vinifera] |
| R: ACAGTCTTCTCTTCAATGGA | ||||||
| N89 | F: CCGCAACAATATCGTCATT | (TCA)5 | 257 | 52 | KX254798 | Uncharacterized protein LOC100262883 [Vitis vinifera] |
| R: GGAAGAAGGTGGAGAACAT | ||||||
| N90 | F: ATAGATAGACACTGGTGGATAG | (GGT)5 | 163 | 52 | KX254799 | — |
| R: AACAGGCTCACATTACATCA | ||||||
| N97 | F: CGTAAGGTGTGCGATTCT | (AAC)5 | 305 | 52 | KX254806 | Uncharacterized protein LOC105794361 [Gossypium raimondii] |
| R: AGAGTTGCCAACAGAGATG | ||||||
| N98 | F: GCAGCAGTGAGTCAAGTG | (GAG)5 | 242 | 52 | KX254807 | Uncharacterized protein LOC105111436 [Populus euphratica] |
| R: CCTATCCTCCATCTCATCCA | ||||||
| N23 | F: TTGGAGTGATGGTTGAGG | (AC)6 | 194 | 55 | KX254732 | — |
| R: GTTCGGAGAAGAGGAAAGTA | ||||||
| N43 | F: ATTCAACGGAGTTAGGACAT | (TA)7 | 147 | 52 | KX254752 | — |
| R: GATTGACGAGAACACATCAT | ||||||
| N45 | F: CCTGATTACAATGAAGTCTTGG | (GA)7 | 189 | 52 | KX254754 | Tau class glutathione transferase GSTU43 [Theobroma cacao] |
| R: AGTAGTTCTGCCTTGAAGTT | ||||||
| N64 | F: TGACGGTGGTAAGAAGGTA | (AT)9 | 199 | 52 | KX254773 | — |
| R: GAACGCAACAGGCATCTA | ||||||
| N84 | F: CCTTGTCTCCTCATTGTCTT | (AT)7 | 270 | 52 | KX254793 | PREDICTED: serine/arginine repetitive matrix protein 1 [Gossypium raimondii] |
| R: GCTCTGCTGTTGCTTACT | ||||||
| N114 | F: ACCAGACGACCACTACAG | (AGATG)5 | 149 | 52 | KX254823 | — |
| R: CGAAGCATAAGGAGATTGGA |
Note: Ta = annealing temperature.
E-value < 10−6.
Table 2.
Amplification and polymorphism of 19 microsatellite loci in populations of the four species.a
| Chunia bucklandioides | ||||||||||||
| Mt. Diaoluo (N = 24) | Jianfengling (N = 24) | Mytilaria laosensis (N = 16) | Exbucklandia tonkinensis (N = 9) and E. populnea (N = 3) | |||||||||
| Locus | A | Ho | Heb | A | Ho | Heb | Allele size (bp) | A | Ho | Heb | Allele size (bp) | Allele size (bp) |
| N31 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 161 | 1 | 0.000 | 0.000 | 161 | 161 |
| N34 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 309 | 1 | 0.000 | 0.000 | 315 | 315 |
| N50 | 2 | 0.435 | 0.340 | 3 | 0.000 | 0.169*** | 187–204 | 1 | 0.000 | 0.000 | 195 | 195 |
| N54 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 234 | 1 | 0.000 | 0.000 | 238 | 218 |
| N91 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 359 | 1 | 0.000 | 0.000 | 364 | 364 |
| N1 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 300 | 1 | 0.000 | 0.000 | 296 | — |
| N6 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 317 | 1 | 0.000 | 0.000 | 317 | — |
| N49 | 1 | 0.000 | 0.000 | 2 | 0.083 | 0.080 | 211–226 | 3 | 0.200 | 0.380* | 284–311 | — |
| N65 | 1 | 0.000 | 0.000 | 5 | 0.091 | 0.504*** | 167–187 | 3 | 0.375 | 0.537 | 155–173 | — |
| N89 | 2 | 0.773 | 0.474 | 2 | 0.941 | 0.524 | 257–266 | 1 | 0.000 | 0.000 | 257 | — |
| N90 | 2 | 0.217 | 0.258** | 2 | 0.174 | 0.159 | 145–164 | 2 | 0.125 | 0.375* | 161–164 | — |
| N97 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 305 | 1 | 0.000 | 0.000 | 308 | — |
| N98 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 | 242 | 1 | 0.000 | 0.000 | 203 | — |
| N23 | 4 | 0.565 | 0.699 | 4 | 0.304 | 0.521* | 187–199 | — | — | — | — | — |
| N43 | 2 | 0.500 | 0.486** | 2 | 0.200 | 0.420 | 133–147 | — | — | — | — | — |
| N45 | 2 | 0.000 | 0.423*** | 2 | 0.217 | 0.496** | 181–189 | — | — | — | — | — |
| N64 | 2 | 0.130 | 0.122 | 3 | 0.095 | 0.459*** | 184–199 | — | — | — | — | — |
| N84 | 2 | 0.227 | 0.416** | 2 | 0.059 | 0.327*** | 266–272 | — | — | — | — | — |
| N114 | 2 | 0.087 | 0.083 | 1 | 0.000 | 0.000 | 140–150 | — | — | — | — | — |
Note: — = no amplification; A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = sampled individuals from each population.
Population and locality information are provided in Appendix 1.
Significant deviations from Hardy–Weinberg equilibrium after sequential Bonferroni corrections: *** represents significance at the 0.1% nominal level; ** represents significance at the 1% nominal level; * represents significance at the 5% nominal level.
Finally, the cross-amplification of the 59 primers that successfully amplified in C. bucklandioides was also tested in M. laosensis, E. tonkinensis, and E. populnea. Of them, 13 amplified in M. laosensis, and five amplified in E. tonkinensis and E. populnea (Table 2).
CONCLUSIONS
Here, we isolated and characterized a set of 11 polymorphic EST-SSR markers, which may be useful for future conservation genetic studies of C. bucklandioides. The cross-genus amplification and polymorphism were also tested in three related species.
Supplementary Material
Appendix 1.
Voucher specimen information for populations used in this study. Specimens are deposited at the Herbarium of Sun Yat-sen University, Guangzhou, Guangdong Province, China.
| Species | Voucher no. | Collection localitya | Geographic coordinates | N |
| Chunia bucklandioides H. T. Chang | Fan and Li 13194 | Jianfengling, Hainan | 18°44′58.90″N, 108°55′07.20″E | 24 |
| Fan and Li 13040 | Mt. Diaoluo, Hainan | 18°41′40.22″N, 109°50′39.28″E | 24 | |
| Mytilaria laosensis Lecomte | Fan, Li and Liu 13481 | Heishiding, Guangdong | 23°27′13.81″N, 111°52′19.63″E | 4 |
| Fan, Li and Liu 13497 | Tongledashan, Guangxi | 23°12′28.00″N, 111°24′13.00″E | 4 | |
| Fan, Li and Liu 13502 | Xinyi, Guangdong | 22°24′12.62″N, 111°30′38.26″E | 4 | |
| Fan, Li and Liu 13528 | Yangchun, Guangdong | 21°54′23.95″N, 111°30′32.71″E | 4 | |
| Exbucklandia tonkinensis (Lecomte) H. T. Chang | Liu Lxp-09-6584 | Taoyuandong, Hunan | 26°34′06.32″N, 114°04′46.71″E | 3 |
| Fan, Li and Liu 13484 | Heishiding, Guangdong | 23°25′52.00″N, 111°52′43.89″E | 3 | |
| Fan, Li and Liu 13540 | Yangchun, Guangdong | 21°51′31.73″N, 111°25′18.75″E | 3 | |
| Exbucklandia populnea (R. Br. ex Griff.) R. W. Brown | Fan 13585 | Malipo, Yunnan | 23°11′20.52″N, 104°49′17.23″E | 3 |
Note: N = number of individuals sampled.
City and province in China.
LITERATURE CITED
- Doyle J. J. 1987. A rapid DNA isolation procedure from small quantities of fresh leaf tissues. Phytochemical Bulletin 19: 11–15. [Google Scholar]
- Endress P. K. 1993. Hamamelidaceae. In K. Kubitzki [ed.], The families and genera of vascular plants, Vol. 2, 322–331. Springer, Berlin, Germany. [Google Scholar]
- Fan Q., Chen S. F., Li M. L., He S. Y., Zhou R. C., Liao W. B. 2013. Development and characterization of microsatellite markers from the transcriptome of Firmiana danxiaensis (Malvaceae s.l.). Applications in Plant Sciences 1: 1300047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gambino G., Perrone I., Gribaudo I. 2008. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochemical Analysis 19: 520–525. [DOI] [PubMed] [Google Scholar]
- Grabherr M. G., Haas B. J., Yassour M., Levin J. Z., Thompson D. A., Amit I., Adiconis X., et al. 2011. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nature Biotechnology 29: 644–652. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hatmaker E. A., Wadl P. A., Mantooth K., Scheffler B. E., Ownley B. H., Trigiano R. N. 2015. Development of microsatellites from Fothergilla ×intermedia (Hamamelidaceae) and cross transfer to four other genera within Hamamelidaceae. Applications in Plant Sciences 3: 1400123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- IUCN (International Union for Conservation of Nature and Natural Resources). 2015. IUCN Red List of Threatened Species. International Union for Conservation of Nature and Natural Resources, Cambridge, United Kingdom. Website http://www.iucnredlist.org [accessed 12 September 2016].
- Peakall R., Smouse P. E. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rousset F. 2008. GENEPOP’007: A complete reimplementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8: 103–106. [DOI] [PubMed] [Google Scholar]
- Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
- Shi S. H., Huang Y. L., Zhang Q., Qu L. H., Zhang H. D. 1999. The phylogenetic relationships between Mytilarioideae and the other subfamilies of Hamamelidaceae inferred from the ITS sequences of nuclear ribosomal DNA. Acta Scientiarum Naturalium Universitatis Sunyatseni 38: 34–38. [Google Scholar]
- Thiel T., Michalek W., Varshney R. K., Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 10: 411–422. [DOI] [PubMed] [Google Scholar]
- Yu Y., Fan Q., Shen R. J., Guo W., Jian J. H., Cui D. F., Liao W. B. 2014. Genetic variability and population structure of Disanthus cercidifolius subsp. longipes (Hamamelidaceae) based on AFLP analysis. PLoS ONE 9: e107769. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.