Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2016 Oct 24;54(11):2716–2725. doi: 10.1128/JCM.00610-16

Accurate Detection of Avian Respiratory Viruses by Use of Multiplex PCR-Based Luminex Suspension Microarray Assay

Nacira Laamiri a,b, Pia Fällgren c, Siamak Zohari c, Jaouher Ben Ali d, Abdeljelil Ghram a, Mikael Leijon c,, Issam Hmila a,
Editor: B W Fenwicke
PMCID: PMC5078549  PMID: 27558184

Abstract

A novel oligonucleotide suspension microarray (Luminex microsphere system) was developed for the rapid detection of avian respiratory viruses of major clinical importance. This test was optimized and validated with 70 clinical samples. The developed tool was accurate for high-throughput detection and differentiation of the most important avian respiratory viruses: avian influenza virus (AIV), Newcastle disease virus (NDV), infection bronchitis virus (IBV), and infectious laryngotracheitis virus (ILTV) in single- and mixed-virus infections. A multiplex reverse transcriptase PCR (RT-PCR), followed by a monoplex or a multiplex Luminex assays, were realized using a Luminex 200 analyzer instrument. The sensitivity, specificity, and reproducibility of the multiplex DNA suspension microarray system were evaluated. The results showed no significant differences in the median fluorescence intensity (MFI) value in monoplex and multiplex Luminex assays. The sensitivity and specificity proved to be completely concordant with monoplex real-time RT-PCR. We demonstrated that the multiplex DNA suspension microarray system is an accurate, high-throughput, and relatively simple method for the rapid detection of the main respiratory viruses of poultry.

INTRODUCTION

Global broiler meat production has shown a steady increase and is expected to overtake pig meat production in 2020 (http://www.fao.org and http://www.fas.usda.gov/). Likewise, in Tunisia, the poultry sector is becoming an increasingly important agriculture sector, which is facing tough challenges due to infectious diseases in the region (14). Viral respiratory diseases are leading causes of economic losses in the poultry industry worldwide due to increased mortality, impaired growth, and reduced egg and meat production. The etiology of these diseases is complex and often involves more than one pathogen (5, 6). The most severe losses in terms of mortality are caused by very virulent viruses, mainly Newcastle disease virus (NDV) and avian influenza virus (AIV) (79). The two viruses give similar symptoms, ranging from a subclinical infection to a severe disease (1012). Other respiratory viruses are also of major importance in terms of severity and impact on livestock production, mainly avian infectious bronchitis virus (IBV) and infectious laryngotracheitis virus (ILTV) (13). These viruses can cause disease independently, in association with each other, or in association with bacterial agents (6, 14). In addition, single- or multiple-virus infections may induce similar clinical signs/lesions, complicating diagnostic decisions and making it difficult for veterinarians to differentiate them clinically. Therefore, fast and sensitive detection techniques that are capable of differentiating between these different respiratory viral infections are needed for the surveillance of newly emerging viruses, outbreak management, as well as disease control.

In fact, accurate detection of respiratory avian disease-causing agents is an essential prerequisite for effective control. For this, a wide spectrum of methods is being developed and currently in use in diagnostic laboratories on a day-to-day basis. Although virus amplification combined with hemagglutination inhibition (HI) and neuraminidase inhibition (NI) tests are still considered to be the gold standard, they are highly time-consuming (7 to 14 days), labor-intensive, and have a low sample throughput (15). Many studies have demonstrated that molecular diagnostic assays, such as reverse transcriptase PCR (RT-PCR), show superior sensitivity compared to that of conventional assays and are now becoming acceptable as new gold standards (1618). In addition, real-time PCR in particular offers significant advantages due to its high sensitivity and rapid turnaround time (1921). Most of the methods used for the detection of avian viral diseases are geared toward specific detection of a single target. Multiplex RT-PCR (mRT-PCR) assays involve simultaneous amplification of more than one infectious agent, using more than one primer pair. The advantage of such mRT-PCR is that it combines the sensitivity and rapidity of PCR and eliminates the need for testing clinical samples separately for each virus. These types of assays have already been used successfully for typing and subtyping influenza viruses (2224) and diagnosing dual infections, such as NDV and AIV coinfection (25). Many other studies have also been performed using multiplex real-time RT-PCR to differentiate AIV, NDV, and IBV subtypes (2639). To date, and to our knowledge, there are no reports describing simultaneous detection of NDV, AIV, IBV, and ILTV in a single sample.

The recent development of low-density suspension array technology, such as the Luminex xMAP technology, has offered an interesting alternative to multiplex real-time PCR. This format uses microbeads that are internally dyed with various proportions of red and infrared fluorescent dyes producing 100 distinct colors (recently extended to 500) detected in a flow cytometry device (40). The Luminex assay has found increasing acceptance in both research and clinical laboratories for a variety of applications (4152). It has already been developed for the detection and differentiation of many different viruses (4345, 49, 5356).

In the present study, we describe an established high-throughput assay facilitating reliable recognition of four avian respiratory viruses of major clinical importance. We have designed and validated, for the first time, a rapid identification method combining one-tube multiplex RT-PCR with Luminex xMAP bead hybridization and detection technology to simultaneously identify four clinically important avian respiratory viruses, NDV, AIV, IBV, and ILTV, in a single or a mixed infection.

MATERIALS AND METHODS

Virus strains and clinical materials.

The AIV, NDV, IBV, and ILTV strains were obtained from the repositories of the National Veterinary Institute (SVA), Uppsala, Sweden. Clinical specimens from poultry verified by routine diagnostic procedures to be infected with respiratory viruses, including swabs (tracheal and cloacal) and internal organs (trachea-lungs, liver-heart-spleen-kidney, and intestine-tonsil-cecal-cloaca), were also provided by the SVA.

Briefly, the virus strains used in the present study were characterized as follows. A virulent NDV (aPMV1/ch/Sweden/2008/G7b) strain was isolated from a laying hen flock showing dramatic loss of egg production in October 2008. The virus was isolated from the oviducts of diseased animals using specific-pathogen-free (SPF) embryonated hen's eggs. Samples showing hemagglutinating activity were subjected to a conventional HI test to specify the serotype. The virus was further characterized by complete genome sequencing (genotype 7b) and determination of the intracerebral pathogenicity index (ICPI = 1.8). The amino acid sequence motif of 112RRQRRF117 at the F protein cleavage site was indicative of a virulent pathotype of avian paramyxovirus-1 (aPMV-1). The IBV strain (M41- 941125) was isolated during an outbreak investigation in 1994 from organ samples and tracheal swabs taken from a commercial layer flock experiencing drops in egg production, poor egg quality, and signs of respiratory disease. Virus isolation was performed according the OIE recommendations, and the isolated virus was further characterized as strain M41 based on cross-neutralization tests with type-specific antisera and partial S1 gene sequencing. The AIV strain (A/Duck/Hungary/2/77 H5N2) was isolated from domestic ducks from the eastern part of Hungary in 1977 showing relatively severe respiratory signs. Subtyping of the isolated virus was determined by conventional HI and neuraminidase inhibition (NI) tests, followed by its characterization by sequencing in 2008 (57). The virus belonged to the low-pathogenic (LP) Eurasian lineage of AIV based on the amino acid sequence of the proteolytic cleavage site of the hemagglutinin (HA) protein. The A489 ILTV strain was kindly provided by Walter Fuchs (Friedrich Loeffler Institute, Greifswald Insel Riems, Germany).

Viral nucleic acid extraction.

Viral RNA was extracted from AIV, IBV, and NDV strains using TRIzol reagent (Invitrogen, Carlsbad, CA), according to the manufacturer's instructions. Furthermore, total nucleic acids were also extracted from the ILTV strain and clinical samples by phenol-chloroform-isoamyl alcohol treatment and ethanol precipitation. The final extracted pellets were suspended in 20 μl of RNase-free water and stored at −20°C.

Design primers and oligonucleotide probes for real-time RT-PCR and Luminex assays.

A high-throughput DNA suspension microarray assay was designed, allowing rapid and accurate detection and differentiation, in a single test, of the four avian respiratory viruses, AIV, NDV, IBV, and ILTV, in single or mixed infections. This quadruplex assay was adapted from previously published monoplex TaqMan real-time PCR assays targeting the matrix gene for AIV (20), the polymerase gene of NDV (19), the 5′-untranslated region of IBV (28), and the infected cell protein 4 (ICP4) gene of ILTV (58) (Table 1).

TABLE 1.

Target genes, amplicon sizes, labels, and sequences of primers and probes used in the multiplex Luminex assay

Virus Oligonucleotide Primer/probe sequence (5′–3′)a Size (bp) Target geneb Reference
AIV Fr_Phos [Phos]AGATGAGTCTTCTAACCGAGGTCG 100 Matrix protein (M) 20
Rv_Btn [Btn]TGCAAAAACATCTTCAAGTCTCTG
Probe [AmC12]TCAGGCCCCCTCAAAGCCGA
NDV Fr_Phos [Phos]AGTGATTGTCTCGGACCTTC 121 Polymerase (M) gene 19
Rv_Btn [Btn]CCTGAGGAGAGGCATTTGCTA
Probe [AmC12]TTCTCTAGCAGTGGGACAGCCTGC
IBV Fr_Btn [Btn]GCTTTTGAGCCTAGCGTT 143 5′ UTR 28
Rv_Phos [Phos]GCCATGTTGTCACTGTCTATTG
Probe [AmC12]CACCACCAGAACCTGTCACCTC
ILTV Fr_Phos [Phos]CCCCACCCAGTAGAGGAC 126 ICP4 gene 58
Rv_Btn [Btn]CGAGATACACGGAAGCTGATTT
Probe [AmC12]CAGTCTTTGGTCGATGACCCGC
a

Phos, primer phosphorylated at the 5′ end; Btn, primer labeled with biotin; AmC12, Luminex probes synthesized with a 5′-amino modification and a 12-carbon methylene linker.

b

ICP4, infected cell protein 4.

All primer and probe sequences were chosen after being thoroughly analyzed with the Premier Biosoft software and facilitated by applying the BLAST program for specificity prediction (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The Premier Biosoft software permitted the incorporation of existing proven primer and probe sequences together with new sequence targets to generate multiplexed assay designs. Available options for predesign analyses, including melting temperature (Tm), G+C content, repeat run length, and variety of alignment rules were determined. Once the parameter settings are chosen, the software iteratively evaluates each multiplex component as it is added to the assay pool, minimizing the possibility of duplex and cross-reactivity issues. All Luminex probes were synthesized with a 5′-amino modification and a 12-carbon methylene linker (C12) for bead conjugation (59). One primer was labeled with biotin (Btn), and the other was phosphorylated on the 5′ end (44). The primers and probes are listed in Table 1.

Virus detection using monoplex real-time RT-PCR.

Real-time RT-PCR primers and probes were adapted as previously described for AIV (20), NDV (19), IBV (28), and ILTV (58). The reaction volume was 15 μl, using 0.6 μl of primers (10 μM) and 0.2 μl of probe at 10 μM. A 2-μl volume of the template was added to the RT-PCR mixture. Real-time RT-PCR was performed on the Rotor-Gene Q system (Qiagen, Hilden, Germany) with a one-step RT-PCR (AgPath-ID one-step RT-PCR reagents; Applied Biosystems) at 45°C for 10 min, initial denaturation at 95°C for 10 min, followed by 40 PCR cycles of denaturation of 95°C for 10 s, and annealing and extension at 60°C for 45 s, with a single fluorescence acquisition step at the end of the annealing step. The cycle threshold (CT) values from these assays represent relative quantification and broadly express the relative levels of viral nucleic acid. Samples exhibiting CT values less than 40 were considered positive.

Multiplex RT-PCR for virus detection using Luminex xMAP.

To confirm that individual primer pairs were specific enough to amplify the four different gene fragments, single-target PCR conditions, including primer concentration, annealing temperature, and DNA polymerase amount, were optimized. Thus, a uniform set of conditions were selected to perform multiplex PCR amplification, with the optimal annealing temperature being 60°C. After confirming that all individual primer pairs allowed amplification of each of the four target viral genomes in a single PCR, virus-specific primers were mixed together in a multiplex reaction. The multiplex one-step RT-PCR volume was 15 μl, and the primer concentrations were 0.4 μM. The PCR cycling profile was as follows: a reverse transcription step at 45°C for 10 min, an enzyme activation step at 94°C for 10 min, and finally, 40 PCR cycles with 10 s of denaturation at 95°C, 15 s of primer annealing at 60°C, and a 30-s extension at 72°C. All primer pair combinations were performed successfully and allowed amplification of all target viruses.

It has been shown that asymmetric PCR, which creates an excess of one of the strands, yields a better signal-to-noise ratio in Luminex equipment (53). In the present study, we have used Lambda exonuclease to digest the amplicon complementary to the target strand of the Luminex bead probe. The PCR products were digested using the following reaction mixture: the reaction volume was 15 μl using 13.2 μl of PCR product, 1.5 μl of 10× Lambda buffer, and 3 units of Lambda exonuclease (Fermentas Life Science, Burlington, Canada). The single-strand product was generated by incubating the PCR product at 37°C for 30 min, followed by an enzyme inactivation step of 15 min at 80°C.

Preparation of oligonucleotide probe beads.

The probes contained a 5-terminal amino group with a seven-carbon spacer to allow covalent attachment to the microspheres (59). These probes were conjugated to color-coded beads (carboxylated microspheres; Luminex Corporation, Austin, TX) as follows. The beads (5 × 106 per oligonucleotide probe) were pelleted at 8,000 × g for 2 min and resuspended in 50 μl of 0.1 M 2-morpholinoethane sulfonic acid (MES) (pH 4.5), and aminated oligonucleotides (0.1 nmol) were added to the bead suspension. Following the addition of 25 μg of 1-ethyl-3-3-dimethylaminopropyl carbodiimide (EDC), the mixture was incubated at room temperature for 30 min in the dark. The addition of EDC and the incubation were repeated to ensure efficient conjugation. After the second 30-min incubation, the microspheres were washed by adding 0.5 ml of 0.02% Tween 20 and mixed gently by inverting the tube several times. The coupled beads were pelleted (8,000 × g for 2 min) and resuspended in 0.5 ml of 0.1% SDS by vortexing. Finally, the beads were pelleted again, resuspended to a concentration of 50,000 beads/μl in Tris-EDTA (TE [pH 8.0]) buffer, and stored protected from the light at 4°C.

Hybridization of biotinylated PCR amplicons to Luminex probes.

The biotinylated PCR products were hybridized to the probe-coupled beads in round-bottom 96-well plates and then conjugated to streptavidin-phycoerythrin. The microsphere mixture consisted of four types of beads, with each one being coated with conjugated virus-specific probes (Table 1).

The bead stocks (50,000 beads/μl) were diluted in 1.5× tetramethylammonium chloride (TMAC) hybridization buffer, such that 375 of each probe-coupled bead were present in each sample well (1,500 beads in total). The hybridization reactions were carried out in a total volume of 50 μl/well consisting of 5 μl of biotinylated PCR product, 13.5 μl of TE buffer, and 31.5 μl of the bead mixture in triplicate. For a background control, a no-template control (NTC) from the PCR assay was used.

According to previous studies (our unpublished data), the optimal hybridization condition was incubation on a shaker plate at 55°C for 30 min at 600 rpm. After hybridization, the solutions were pelleted by centrifugation for 30 s. About 40 μl of supernatant was carefully discarded without destroying the pellet to eliminate unbound PCR products. Then, the hybridized amplicons were fluorescently labeled by resuspending the pellet in 40 μl of 1× TMAC solution, containing a freshly prepared solution of streptavidin-R-phycoerythrin at a concentration of 0.01 mg/ml (Caltag Laboratories, Burlingame, CA, USA) and incubation in the dark at the same hybridization temperature for 30 min. Finally, the reaction plates were placed in a Luminex 200 instrument (Luminex Corporation, Austin, TX) at 55°C for bead enumeration and phycoerythrin fluorescence quantification. For each bead type, 100 microspheres were analyzed, representing 100 replicate measurements to calculate the MFI in each reaction (60). The signal-to-background ratio represents the MFI signals of positive controls versus the background fluorescence NTC. A positive signal was set as twice the MFI value of the NTC.

Sensitivity and multiplex detection of real-time RT-PCR and Luminex assays.

Quantified viral nucleic acid materials were not available. However, since this study has utilized published and validated monoplex TaqMan assays conditions as the starting point for the development of the Luminex multiplex system, we can compare detection using the Luminex system with that of the corresponding TaqMan monoplex assays on identical dilutions of an unquantified viral nucleic acid preparation to get a useful estimate of the relative sensitivity. Thus, triplicate serial dilutions of unknown concentrations of the extracted DNA/RNA materials for each of the four virus strains were used for the direct sensitivity comparison of the new Luminex oligonucleotide suspension microarray, with monoplex real-time RT-PCR as gold standard assay. The detection limit was defined as the dilution containing the fewest copies of viral genome that still gave a positive result for all replicates.

Specificity and accuracy of the Luminex DNA suspension microarray.

The specificity of the assay was theoretically assessed by evaluating the primers and probes for relevant homologies using the BLAST tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and assessing it experimentally by carrying out the multiplexed RT-PCR step against single- or multiple-virus DNA/RNA templates of the four avian viruses. In fact, the capability for multianalyte detection was investigated using several combinations of dilutions of the DNA/RNA standards of each of the four virus strains. The mixtures were then subjected to multiplex RT-PCR amplification and a subsequent Luminex array. Also, the individual probe beads were tested in the monoplex Luminex assay before pooling and testing them in a multiplex assay.

Interassay reproducibility.

To evaluate the interassay reproducibility of the Luminex DNA suspension microarray, triplicates of one mixture of dilutions of the DNA/RNA standards of the four virus strains (10−6 AIV, 10−3 IBV, 10−4 NDV, and 10−5 ILTV) were tested in three independent reactions over separate days. The variability of the MFI values was assessed by analysis of variance.

Clinical validation of the Luminex DNA suspension assay.

To validate the clinical applicability and accuracy of the Luminex assay, we have applied the assay on a set of 70 clinical samples from suspected poultry and compared the results with those of monoplex real-time RT-PCR as the gold standard assay.

Statistical analysis.

Spearman's test is used to compute the correlation between the CT of the monoplex real-time RT-PCR and MFI values of the multiplex Luminex assay. Some parameters considered were, for example, the P values, which typically should be less than 0.05 to validate the hypothesis in regard to the correlation, and the linear correlation coefficient (−1 < ρ < 1), which was calculated as such: if ρ = 0, there is no correlation between the two variables; and if ρ = 1 (or ρ = −1), it was concluded that the two variables are perfectly proportionally correlated (or inversely proportionally correlated, respectively). In addition, the coefficient of determination (0 < R2 < 1) was used. Using this coefficient, we could judge and evaluate the regression between the two essays (R2 = 1 for a good linearity and R2 = 0 for no linearity).

Besides Spearman's test, the performances of the proposed method were also evaluated using the confusion matrix analysis. The confusion matrix contains information about the two assays. The following parameters were defined: true positive (TP) was the number of positive samples categorized as positive, false positive (FP) was the number of negative samples categorized as positive, false negative (FN) was the number of positive samples categorized as negative, and true negative (TN) was the number of negative samples categorized as negative. Based on these 4 metrics, the sensitivity (Sn = TP/[TP + FN]) and specificity (Sp = TN/[TN + FP]) of the novel multiplex Luminex assay could be evaluated.

RESULTS

Comparison of the sensitivity of the Luminex DNA microarray with the gold standard monoplex real-time RT-PCR.

The sensitivity of the multiplex DNA microarray system was investigated and compared to the monoplex real-time RT-PCR as the gold standard. Serial dilutions of the extracted viral DNA/RNA of each one of the four virus strains were tested with both assays, and the results were compared, as shown in Table 2. For low concentrations of viruses, similar detection endpoints were obtained. The Luminex assay could detect AIV, NDV, IBV, and ILTV at dilutions of 10−6, 3 × 10−7, 7 × 10−7, and 7 × 10−7, respectively (Table 2). The obtained sensitivity of the multiplex Luminex assay was equivalent to that shown for each viral targets detected by the monoplex assay. The raw MFI values were consistent when amplified in multiplex (Table 2). In addition, the multiplex DNA microarray assay could detect the same amount of each virus as in the monoplex real-time RT-PCR assay. Our results were analyzed by the Spearman's correlation coefficient, which was statistically significant for AIV, NDV, IBV, and ILTV (P < 0.05 for all; Spearman's ρ values of −0.98, −0.97, −0.92, and −0.98, respectively) (Fig. 1). Furthermore, negative Spearman's ρ values indicated that as CT values increase, MFI values decrease, meaning that the two variables are inversely proportional.

TABLE 2.

Comparison of the sensitivities of detection of AIV, NDV, IBV, and ILTV by the DNA suspension microarray and the monoplex real-time RT-PCRa

graphic file with name zjm01116-5200-t02.jpg

a

Shaded rows represent the smallest dilution at which the Luminex assay detected the virus.

b A minus sign in this column means that the value is greater than 40 and considered negative.

FIG 1.

FIG 1

Correlation between monoplex real-time RT-PCR cycle threshold (CT) and multiplex Luminex assay mean fluorescence intensity (MFI) values for the detection of serial dilutions of AIV, NDV, IBV, and ILTV strains. Trendlines indicate statistically significant Spearman's correlation and good linearity (R2 values of 0.97, 0.94, 0.85, and 0.97 for AIV, NDV, IBV, and ILTV, respectively).

Specificity and accuracy of the avian respiratory virus DNA suspension array.

Prior to Luminex hybridization reaction, multiplex RT-PCR was carried out to amplify a single viral DNA/RNA template. The PCR amplicons with the expected lengths of 100, 121, 143, and 126 bp for the respective AIV, NDV, IBV, and ILTV genome fragments were obtained. No cross-reactivity and no unspecific amplifications were recognizable on agarose gels, as shown in Fig. 2.

FIG 2.

FIG 2

A representative agarose gel electrophoresis of multiplex RT-PCR products for the detection of AIV (A/Duck/Hungary/2/77 H5N2), NDV (A/ch/Sweden/2008/G7d), IBV (M41- 941125), and ILTV (A489). Lane 1, 100-bp DNA size marker; lane 2, AIV product; lane 3, IBV product; lane 4, ILTV product; lane 5, NDV product; lane 6, negative control.

Biotin-labeled PCR products of the various viruses tested were hybridized with the multianalyte bead-based suspension array. The tests showed that the multiplex Luminex hybridization is able to detect all targets with no positive cross-reaction signals (Fig. 3), which is quite compatible with the results obtained in the multiplex PCR. All four avian respiratory viruses were detected using the multiplex DNA suspension microarray with 100% specificity.

FIG 3.

FIG 3

Representative data showing the comparison of the sensitivity of the monoplex and the multiplex Luminex assays for the detection of AIV (a), NDV (b), IBV (c), and ILTV (d).

To evaluate whether the Luminex assay could accurately detect individual or multiple-virus DNA/RNA in a mixture, various dilutions of viral DNA/RNA of each of the four virus strains were mixed, subjected to multiplex RT-PCR amplification, and subsequently subjected to DNA suspension microarray hybridization. Each mixture was tested in triplicate, and the data are shown as mean ± standard deviation (SD) MFI values (Table 3). The Luminex assay can still detect and differentiate each one of the four viruses present in the dilution mixtures (Table 3).

TABLE 3.

Multiple-virus pathogen detection capability of the multiplex Luminex assay

Virus mixture MFI (mean ± SD)
AIV IBV ILTV NDV
10−1 AIV + 10−1 NDV 3,729.3 ± 218.7 25 ± 10.5 21.6 ± 10.7 1,623.3 ± 39.7
10−5 AIV + 10−5 NDV 1,326.7 ± 47.1 23 ± 4.3 17.6 ± 5.6 926.3 ± 45.4
10−6 AIV + 10−2 IBV 344.6 ± 28.5 2,506 ± 46.5 20.3 ± 5.1 47.1 ± 1.4
10−3 AIV + 10−5 IBV + 10−4 NDV 2,885.2 ± 101.7 1,973.3 ± 36.9 25 ± 7.5 1,024.5 ± 16
10−3 NDV + 10−6 IBV 24.8 ± 4.2 1,205.7 ± 87.8 19.3 ± 9.6 46.2 ± 12.72
10−5 NDV + 10−5 IBV + 10−3 ILTV 28.5 ± 5.2 1,956.2 ± 124.5 1,155.8 ± 94.7 2,343 ± 88.4
10−4 AIV + 10−4 ILTV 1,734.7 ± 80.5 21.3 ± 1.1 1,026 ± 40 33.5 ± 3.1
10−5 IBV + 10−5 ILTV 40.6 ± 9.4 1,973,3 ± 36.9 732.6 ± 43.7 43.5 ± 6.3
10−3 AIV + 10−3 ILTV + 10−6 IBV 2,719 ± 102.3 1,205.7 ± 87.8 1,155.8 ± 94.7 12.6 ± 9.8
10−6 AIV + 10−3 IBV + 10−4 NDV + 10−5 ILTV 344.6 ± 28.5 2,343 ± 75 733.8 ± 47.4 1,024.5 ± 16

Reproducibility of the DNA suspension microarray.

To evaluate the interassay reproducibility of the multiplex Luminex array, triplicates of one mixture of dilutions of the DNA/RNA standards of the four virus strains were tested in three independent reactions over separate days. The mean MFI values obtained represented with the SD demonstrate that reproducible results were achieved from the same combination of viruses when the assays were repeated 3 times (Fig. 4). Analysis of variance showed no significant difference in the MFI values of the triplicate mixtures, which were run over separate days (P < 0.05).

FIG 4.

FIG 4

Interassay reproducibility of the Luminex avian respiratory virus array results over three independent tests (a to c) using one mixture of dilutions of the DNA/RNA standards (10−6 AIV, 10−3 IBV, 10−4 NDV, and 10−5 ILTV). Red lines indicate the MFI mean values of triplicate experiments, and blue windows indicate the minimum and maximum MFI values, with SD shown as error bars.

Performance of DNA microarray using field samples.

To validate the performance of both assays, 70 field samples collected from poultry with suspected viral respiratory infections were analyzed by the DNA suspension microarray. These specimens were selected since they were already characterized by a routine monoplex real-time RT-PCR as the gold standard. Of the 70 samples that were tested, multiplex Luminex assay has successfully detected a total of 57 positive avian respiratory virus samples, and 13 samples were negative for the four viruses. Of these, 11, 14, 22, and 10 specimens were positive for AIV, IBV, NDV, and ILTV, respectively. Two of these samples collected from poultry presented a coinfecting viruses. One chicken was coinfected with both AIV and NDV, and the other was coinfected with AIV and IBV (Table 4).

TABLE 4.

Sensitivity and the specificity of the multiplex Luminex assay for detecting viral DNA/RNA in 70 field samples

Target Sensitivity
Specificity
TP/(TP + FN)a % TN/(TN + FP)a %
AIV 11/11 100 59/59 100
IBV 14/14 100 56/56 100
NDV 22/22 100 48/48 100
ILTV 10/10 100 60/60 100
a

TP, true positive; FN, false negative; TN, true negative; FP, false positive.

All samples identified by the Luminex assay proved to be 100% concordant with the results obtained by the monoplex real-time RT-PCR. In addition, a detailed confusion matrix analysis was carried out to determinate the performance of the multiplex Luminex assay to detect and differentiate between the most important avian respiratory viruses compared to the monoplex real-time RT-PCR. The confusion matrix analysis indicated that the multiplex Luminex assay is 100% accurate in regard to its specificity and sensitivity (Table 4).

DISCUSSION

The rapid and accurate multiplex detection of avian respiratory viruses is potentially important in clinical diagnostic settings. The advantages of such specific and sensitive viral detection assays allow limiting the diagnostic cost of additional assays, as well as labor and instituting appropriate rapid disease control. Many methods have been developed and published as important tools for the identification of pathogens of the respiratory tract of poultry (16, 6163). Most techniques tend to be either molecular (e.g., PCR and real-time PCR) or serological (e.g., enzyme-linked immunosorbent assay [ELISA]). Some of them are not suitable for diagnoses, in some instances, to be used in multiplex assay. However, there is a lack of studies that discuss and investigate multiplex detections in the veterinary field (64), although, recently, nine avian respiratory pathogens were simultaneously detected based on GenomeLab gene expression profiler analyzer-multiplex PCR assay with 100% success as a rate of specificity (65). Most developed multiplex molecular assays have provided major steps to advance the diagnostic efficiency for the detection of human respiratory pathogens (17, 6670). Various multiplex nucleic acid amplification and microarray-based methods have been evaluated for the simultaneous detection and identification of multiple human respiratory viruses (67, 7173). Of these, the multianalyte suspension array is a rapid, sensitive, and high-throughput technique for viral detection compared to classical methods (53, 74, 75).

Multiplex PCR coupled with Luminex suspension arrays using microbeads for signal readout represents a recent diagnostic approach for clinical laboratories. To the best of our knowledge, the Luminex technology has not been utilized before for the simultaneous detection of four clinically important avian respiratory viruses, which are AIV, NDV, IBV, and ILTV. We assessed the performance of the developed assay by comparing its sensitivity with the gold standard monoplex real-time RT-PCR and testing 70 avian field samples. The sensitivity of our test was the same as that of the monoplex real-time RT-PCR using serial dilutions of the extracted viral DNA/RNA of each one of the four virus strains. This is in agreement with previous observations (44). The limit of detection of the monoplex real-time RT-PCR in template copies per reaction was reported as 103, 103, and 102, respectively, for the AIV M gene, the NDV M gene, and the 5′ untranslated region (UTR) for IBV (19, 20, 28). The multiplex assay is an efficient alternative to monoplex real-time PCR and greatly reduces the number of reactions required. However, multiplex real-time PCR is complicated by fluorescence receiver channel cross talk, which is not an issue with the Luminex technique that detects the fluorescent beads one by one in a flow cytometry device. The results demonstrated that the Luminex assay is specific for the target nucleic acid and easy to perform. The protocol could be made high throughput with a liquid handler and a 96-extracted-sample test in a rapid turnaround time of about 4 h (excluding DNA extraction). The approach is modular, and certain virus tests could be removed from the assay if the laboratory does not expect these avian viruses to be absent in the poultry flocks in the region. This assay can also be useful for research laboratories trying to understand the burden of avian respiratory viruses for poultry, which is worldwide related to mortality, impaired growth, reduced egg production or meat quality.

In summary, the DNA suspension array-based assay provides an alternative high-throughput molecular diagnostic platform for specific and sensitive detection of several major viruses commonly seen as important causes of viral respiratory diseases in poultry. The assay principle is straightforward, comprising few reaction steps in a single vessel. The run times are comparable to those of real-time PCR, with the benefit that the presence of several viruses can be analyzed in the same reaction. Although the reagent cost is higher than that for conventional PCR assays, it is reduced in proportion to the number of simultaneous analytes investigated. The clinical performance of the method was validated using a range of swabs as well as internal organs, and the potential utility of such a platform in veterinary diagnostics was demonstrated. This multiplex detection, using DNA suspension microarray, could provide more effective screening of viruses causing similar respiratory symptoms and in turn facilitates rapid counteractions, especially in case of outbreaks.

The establishment of this effective system for epidemiological surveillance will allow precise detection and identification of different avian respiratory viruses circulating in a region. This assay may close the gap of the absence of an efficient tool for multiplex diagnostic of these viruses and avoid the spread of infectious diseases in the poultry farms.

ACKNOWLEDGMENTS

We thank Hechmi Louzir, the head of the Institut Pasteur de Tunis, for his constant encouragements and Walter Fuchs (Friedrich Loeffler Institute, Greifswald Insel Riems, Germany) for providing the A489 ILTV strain. We extend many thanks to the supervisors and technician staff who provided laboratory assistance and helpful suggestions and advices.

This work was supported by the Institut Pasteur de Tunis (LEMV project), the Ministry of Higher Education and Scientific Research (Tunisia), and by the National Veterinary Institute (SVA), Uppsala, Sweden.

REFERENCES

  • 1.Bourogâa H, Hellal I, Hassen J, Fathallah I, Ghram A. 2012. S1 gene sequence analysis of new variant isolates of avian infectious bronchitis virus in Tunisia. Vet Med Res Rep 3:41–48. doi: 10.2147/VMRR.S32498. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bourogâa H, Miled K, Gribâa L, El Behi I, Ghram A. 2009. Characterization of new variants of avian infectious bronchitis virus in Tunisia. Avian Dis 53:426–433. doi: 10.1637/8666-022609-Reg.1. [DOI] [PubMed] [Google Scholar]
  • 3.Tombari W, Paul M, Bettaieb J, Larbi I, Nsiri J, Elbehi I, Gribaa L, Ghram A. 2013. Risk factors and characteristics of low pathogenic avian influenza virus isolated from commercial poultry in Tunisia. PLoS One 8:e53524. doi: 10.1371/journal.pone.0053524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Tombari W, Nsiri J, Larbi I, Guerin JL, Ghram A. 2011. Genetic evolution of low pathogenecity [sic] H9N2 avian influenza viruses in Tunisia: acquisition of new mutations. Virol J 8:467. doi: 10.1186/1743-422X-8-467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ahmed A, Khan TA, Kanwal B, Raza Y, Akram M, Rehmani SF, Lone NA, Kazmi SU. 2009. Molecular identification of agents causing respiratory infections in chickens from southern region of Pakistan from October 2007 to February 2008. Int J Agric Biol 11:325–328. [Google Scholar]
  • 6.Malik YS, Patnayak DP, Goyal SM. 2004. Detection of three avian respiratory viruses by single-tube multiplex reverse transcription-polymerase chain reaction assay. J Vet Diagn Invest 16:244–248. [DOI] [PubMed] [Google Scholar]
  • 7.Alexander DJ. 2000. A review of avian influenza in different bird species. Vet Microbiol 74:3–13. doi: 10.1016/S0378-1135(00)00160-7. [DOI] [PubMed] [Google Scholar]
  • 8.Capua I, Alexander DJ. 2002. Avian influenza and human health. Acta Trop 83:1–6. doi: 10.1016/S0001-706X(02)00050-5. [DOI] [PubMed] [Google Scholar]
  • 9.Sakai K, Yada K, Sakabe G, Tani O, Miyaji K, Nakamura M, Takehara K. 2006. Serological and virological studies of Newcastle disease and avian influenza in slaughter-age ostriches (Struthio camelus) in Japan. J Vet Med Sci 68:491–494. doi: 10.1292/jvms.68.491. [DOI] [PubMed] [Google Scholar]
  • 10.Achenbach JE, Bowen RA. 2011. Transmission of avian influenza A viruses among species in an artificial barnyard. PLoS One 6:e17643. doi: 10.1371/journal.pone.0017643. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.El Zowalaty ME, Chander Y, Redig PT, Abd El Latif HK, El Sayed MA, Goyal SM. 2011. Selective isolation of avian influenza virus (AIV) from cloacal samples containing AIV and Newcastle disease virus. J Vet Diagn Invest 23:330–332. [DOI] [PubMed] [Google Scholar]
  • 12.Wang L-C, Pan C-H, Severinghaus LL, Liu L-Y, Chen C-T, Pu C-E, Huang D, Lir J-T, Chin S-C, Cheng M-C, Lee S-H, Wang C-H. 2008. Simultaneous detection and differentiation of Newcastle disease and avian influenza viruses using oligonucleotide microarrays. Vet Microbiol 127:217–226. doi: 10.1016/j.vetmic.2007.08.019. [DOI] [PubMed] [Google Scholar]
  • 13.Cavanagh D. 2003. Severe acute respiratory syndrome vaccine development: experiences of vaccination against avian infectious bronchitis coronavirus. Avian Pathol 32:567–582. doi: 10.1080/03079450310001621198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ali A, Reynolds DL. 2000. A multiplex reverse transcription-polymerase chain reaction assay for Newcastle disease virus and avian pneumovirus (Colorado strain). Avian Dis 44:938–943. doi: 10.2307/1593068. [DOI] [PubMed] [Google Scholar]
  • 15.Ziegler T, Hall H, Sánchez-Fauquier A, Gamble WC, Cox NJ. 1995. Type- and subtype-specific detection of influenza viruses in clinical specimens by rapid culture assay. J Clin Microbiol 33:318–321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hodinka RL. 2013. Point-Counterpoint: Is the era of viral culture over in the clinical microbiology laboratory? J Clin Microbiol 51:2–8. doi: 10.1128/JCM.02593-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Létant SE, Ortiz JI, Bentley Tammero LF, Birch JM, Derlet RW, Cohen S, Manning D, McBride MT. 2007. Multiplexed reverse transcriptase PCR assay for identification of viral respiratory pathogens at the point of care. J Clin Microbiol 45:3498–3505. doi: 10.1128/JCM.01712-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lee MS, Chang PC, Shien JH, Cheng MC, Shieh HK. 2001. Identification and subtyping of avian influenza viruses by reverse transcription-PCR. J Virol Methods 97:13–22. doi: 10.1016/S0166-0934(01)00301-9. [DOI] [PubMed] [Google Scholar]
  • 19.Wise MG, Suarez DL, Seal BS, Pedersen JC, Senne DA, King DJ, Kapczynski DR, Spackman E. 2004. Development of a real-time reverse-transcription PCR for detection of Newcastle disease virus RNA in clinical samples. J Clin Microbiol 42:329–338. doi: 10.1128/JCM.42.1.329-338.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Spackman E, Senne DA, Myers TJ, Bulaga LL, Garber LP, Perdue ML, Lohman K, Daum LT, Suarez DL. 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol 40:3256–3260. doi: 10.1128/JCM.40.9.3256-3260.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Szewczuk E, Thapa K, Anninos T, McPhie K, Higgins G, Dwyer DE, Stanley KK, Iredell JR. 2010. Rapid semi-automated quantitative multiplex tandem PCR (MT-PCR) assays for the differential diagnosis of influenza-like illness. BMC Infect Dis 10:113. doi: 10.1186/1471-2334-10-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Munch M, Nielsen LP, Handberg KJ, Jørgensen PH. 2001. Detection and subtyping (H5 and H7) of avian type A influenza virus by reverse transcription-PCR and PCR-ELISA. Arch Virol 146:87–97. doi: 10.1007/s007050170193. [DOI] [PubMed] [Google Scholar]
  • 23.Stockton J, Ellis JS, Saville M, Clewley JP, Zambon MC. 1998. Multiplex PCR for typing and subtyping influenza and respiratory syncytial viruses. J Clin Microbiol 36:2990–2995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Leijon M, Ullman K, Thyselius S, Zohari S, Pedersen JC, Hanna A, Mahmood S, Banks J, Slomka MJ, Belák S. 2011. Rapid PCR-based molecular pathotyping of H5 and H7 avian influenza viruses. J Clin Microbiol 49:3860–3873. doi: 10.1128/JCM.01179-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Chen H, Zhang J, Sun D, Zhang J, Cai X, Liu X, Ding Y, Ma L, Yang S, Jin L, Liu Y. 2008. Rapid discrimination of H5 and H9 subtypes of avian influenza viruses and Newcastle disease virus by multiplex RT-PCR. Vet Res Commun 32:491–498. doi: 10.1007/s11259-008-9052-z. [DOI] [PubMed] [Google Scholar]
  • 26.Acevedo AM, Perera CL, Vega A, Ríos L, Coronado L, Relova D, Frías MT, Ganges L, Núñez JI, Pérez LJ. 2013. A duplex SYBR Green I-based real-time RT-PCR assay for the simultaneous detection and differentiation of Massachusetts and non-Massachusetts serotypes of infectious bronchitis virus. Mol Cell Probes 27:184–192. doi: 10.1016/j.mcp.2013.06.001. [DOI] [PubMed] [Google Scholar]
  • 27.Aldous EW, Collins MS, McGoldrick A, Alexander DJ. 2001. Rapid pathotyping of Newcastle disease virus (NDV) using fluorogenic probes in a PCR assay. Vet Microbiol 80:201–212. doi: 10.1016/S0378-1135(00)00371-0. [DOI] [PubMed] [Google Scholar]
  • 28.Callison SA, Hilt DA, Boynton TO, Sample BF, Robison R, Swayne DE, Jackwood MW. 2006. Development and evaluation of a real-time Taqman RT-PCR assay for the detection of infectious bronchitis virus from infected chickens. J Virol Methods 138:60–65. doi: 10.1016/j.jviromet.2006.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Farkas T, Székely E, Belák S, Kiss I. 2009. Real-time PCR-based pathotyping of Newcastle disease virus by use of TaqMan minor groove binder probes. J Clin Microbiol 47:2114–2123. doi: 10.1128/JCM.01652-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fuller CM, Brodd L, Irvine RM, Alexander DJ, Aldous EW. 2010. Development of an L gene real-time reverse-transcription PCR assay for the detection of avian paramyxovirus type 1 RNA in clinical samples. Arch Virol 155:817–823. doi: 10.1007/s00705-010-0632-1. [DOI] [PubMed] [Google Scholar]
  • 31.Fuller CM, Collins MS, Alexander DJ. 2009. Development of a real-time reverse-transcription PCR for the detection and simultaneous pathotyping of Newcastle disease virus isolates using a novel probe. Arch Virol 154:929–937. doi: 10.1007/s00705-009-0391-z. [DOI] [PubMed] [Google Scholar]
  • 32.He J, Bose ME, Beck ET, Fan J, Tiwari S, Metallo J, Jurgens LA, Kehl SC, Ledeboer N, Kumar S, Weisburg W, Henrickson KJ. 2009. Rapid multiplex reverse transcription-PCR typing of influenza A and B virus, and subtyping of influenza A virus into H1, 2, 3, 5, 7, 9, N1 (human), N1 (animal), N2, and N7, including typing of novel swine origin influenza A (H1N1) virus, during the 2009 outbreak in Milwaukee, Wisconsin. J Clin Microbiol 47:2772–2778. doi: 10.1128/JCM.00998-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Huber I, Campe H, Sebah D, Hartberger C, Konrad R, Bayer M, Busch U, Sing A. 2011. A multiplex one-step real-time RT-PCR assay for influenza surveillance. Euro Surveill 16:pii=19798 http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19798. [PubMed] [Google Scholar]
  • 34.Li P-Q, Zhang J, Muller CP, Chen J-X, Yang Z-F, Zhang R, Li J, He Y-S. 2008. Development of a multiplex real-time polymerase chain reaction for the detection of influenza virus type A including H5 and H9 subtypes. Diagn Microbiol Infect Dis 61:192–197. doi: 10.1016/j.diagmicrobio.2008.01.007. [DOI] [PubMed] [Google Scholar]
  • 35.Li YP, Zhang MF. 2004. Rapid pathotyping of Newcastle disease virus from allantoic fluid and organs of experimentally infected chickens using two novel probes. Arch Virol 149:1231–1243. doi: 10.1007/s00705-003-0272-9. [DOI] [PubMed] [Google Scholar]
  • 36.Meir R, Maharat O, Farnushi Y, Simanov L. 2010. Development of a real-time TaqMan RT-PCR assay for the detection of infectious bronchitis virus in chickens, and comparison of RT-PCR and virus isolation. J Virol Methods 163:190–194. doi: 10.1016/j.jviromet.2009.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Mia Kim L, Suarez DL, Afonso CL. 2008. Detection of a broad range of class I and II Newcastle disease viruses using a multiplex real-time reverse transcription polymerase chain reaction assay. J Vet Diagn Invest 20:414–425. [DOI] [PubMed] [Google Scholar]
  • 38.Monne I, Ormelli S, Salviato A, De Battisti C, Bettini F, Salomoni A, Drago A, Zecchin B, Capua I, Cattoli G. 2008. Development and validation of a one-step real-time PCR assay for simultaneous detection of subtype H5, H7, and H9 avian influenza viruses. J Clin Microbiol 46:1769–1773. doi: 10.1128/JCM.02204-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tan SW, Ideris A, Omar AR, Yusoff K, Hair-Bejo M. 2009. Detection and differentiation of velogenic and lentogenic Newcastle disease viruses using SYBR Green I real-time PCR with nucleocapsid gene-specific primers. J Virol Methods 160:149–156. doi: 10.1016/j.jviromet.2009.05.006. [DOI] [PubMed] [Google Scholar]
  • 40.Dunbar SA. 2006. Applications of Luminex xMAP technology for rapid, high-throughput multiplexed nucleic acid detection. Clin Chim Acta 363:71–82. doi: 10.1016/j.cccn.2005.06.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bongoni AK, Lanz J, Rieben R, Banz Y. 2013. Development of a bead-based multiplex assay for the simultaneous detection of porcine inflammation markers using xMAP technology. Cytometry A 83:636–647. [DOI] [PubMed] [Google Scholar]
  • 42.Hansenová Maňásková S, Bikker FJ, Veerman ECI, van Belkum A, van Wamel WJB. 2013. Rapid detection and semi-quantification of IgG-accessible Staphylococcus aureus surface-associated antigens using a multiplex competitive Luminex assay. J Immunol Methods 397:18–27. doi: 10.1016/j.jim.2013.07.016. [DOI] [PubMed] [Google Scholar]
  • 43.Leblanc N, Cortey M, Fernandez Pinero J, Gallardo C, Masembe C, Okurut AR, Heath L, van Heerden J, Sánchez-Vizcaino JM, Ståhl K, Belák S. 2013. Development of a suspension microarray for the genotyping of African swine fever virus targeting the SNPs in the C-terminal end of the p72 gene region of the genome. Transbound Emerg Dis 60:378–383. doi: 10.1111/j.1865-1682.2012.01359.x. [DOI] [PubMed] [Google Scholar]
  • 44.LeBlanc N, Leijon M, Jobs M, Blomberg J, Belák S. 2010. A novel combination of TaqMan RT-PCR and a suspension microarray assay for the detection and species identification of pestiviruses. Vet Microbiol 142:81–86. doi: 10.1016/j.vetmic.2009.09.046. [DOI] [PubMed] [Google Scholar]
  • 45.Lim MS, Kim SM, Choi SH. 2016. Simultaneous detection of three lily-infecting viruses using a multiplex Luminex bead array. J Virol Methods 231:34–37. doi: 10.1016/j.jviromet.2016.02.007. [DOI] [PubMed] [Google Scholar]
  • 46.Mengelle C, Mansuy JM, Prere MF, Grouteau E, Claudet I, Kamar N, Huynh A, Plat G, Benard M, Marty N, Valentin A, Berry A, Izopet J. 2013. Simultaneous detection of gastrointestinal pathogens with a multiplex Luminex-based molecular assay in stool samples from diarrhoeic patients. Clin Microbiol Infect 19:E458–E465. [DOI] [PubMed] [Google Scholar]
  • 47.Preuner S, Lion T. 2013. Species-specific identification of a wide range of clinically relevant fungal pathogens by the Luminex xMAP technology. Methods Mol Biol Clifton NJ 968:119–139. doi: 10.1007/978-1-62703-257-5_9. [DOI] [PubMed] [Google Scholar]
  • 48.Ryan JT, Rose TM. 2013. Development of whole-virus multiplex Luminex-based serological assays for diagnosis of infections with kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 homologs in macaques. Clin Vaccine Immunol 20:409–419. doi: 10.1128/CVI.00673-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Selove W, Rao LV. 2016. Performance of rapid SOFIA influenza A+B test compared to Luminex x-TAG respiratory viral panel assay in the diagnosis of influenza A, B, and subtype H3. J Investig Med 64:905–907. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Spierings G, Dunbar SA. 2013. Pharmacogenetics using Luminex xMAP technology: a method for developing a custom multiplex single nucleotide polymorphism mutation assay. Methods Mol Biol 1015:115–126. doi: 10.1007/978-1-62703-435-7_7. [DOI] [PubMed] [Google Scholar]
  • 51.Staples E, Ingram RJM, Atherton JC, Robinson K. 2013. Optimising the quantification of cytokines present at low concentrations in small human mucosal tissue samples using Luminex assays. J Immunol Methods 394:1–9. doi: 10.1016/j.jim.2013.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Wessels E, Rusman LG, van Bussel MJAWM, Claas ECJ. 2013. Added value of multiplex Luminex gastrointestinal pathogen panel (xTAG GPP) testing in the diagnosis of infectious gastroenteritis. Clin Microbiol Infect 20:182–187. [DOI] [PubMed] [Google Scholar]
  • 53.Deregt D, Gilbert SA, Dudas S, Pasick J, Baxi S, Burton KM, Baxi MK. 2006. A multiplex DNA suspension microarray for simultaneous detection and differentiation of classical swine fever virus and other pestiviruses. J Virol Methods 136:17–23. doi: 10.1016/j.jviromet.2006.03.025. [DOI] [PubMed] [Google Scholar]
  • 54.Munro SB, Kuypers J, Jerome KR. 2013. Comparison of a multiplex real-time PCR assay with a multiplex Luminex assay for influenza virus detection. J Clin Microbiol 51:1124–1129. doi: 10.1128/JCM.03113-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Ozaki S, Kitamura S, Hara H, Shimoyama Y, Kubota H, Abe Y, Kato K, Inoue M. 2012. Clinical evaluation of a novel multiplex HPV genotyping reagent using the luminex xMAP technology. Rinsho Byori 60:621–626. (In Japanese.) [PubMed] [Google Scholar]
  • 56.Popowitch EB, O'Neill SS, Miller MB. 2013. Comparison of the Biofire FilmArray RP, Genmark eSensor RVP, Luminex xTAG RVPv1, and Luminex xTAG RVP fast multiplex assays for detection of respiratory viruses. J Clin Microbiol 51:1528–1533. doi: 10.1128/JCM.03368-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Szeleczky Z, Kecskeméti S, Kiss I, Lomniczi B. 2008. Genetic analysis of old Hungarian avian influenza viruses. Hung Vet J 130:165–179. [Google Scholar]
  • 58.Ou S-C, Giambrone JJ, Macklin KS. 2012. Detection of infectious laryngotracheitis virus from darkling beetles and their immature stage (lesser mealworms) by quantitative polymerase chain reaction and virus isolation. J Appl Poult Res 21:33–38. doi: 10.3382/japr.2010-00314. [DOI] [Google Scholar]
  • 59.Cowan LS, Diem L, Brake MC, Crawford JT. 2004. Transfer of a Mycobacterium tuberculosis genotyping method, spoligotyping, from a reverse line-blot hybridization, membrane-based assay to the Luminex multianalyte profiling system. J Clin Microbiol 42:474–477. doi: 10.1128/JCM.42.1.474-477.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Diaz MR, Fell JW. 2005. Use of a suspension array for rapid identification of the varieties and genotypes of the Cryptococcus neoformans species complex. J Clin Microbiol 43:3662–3672. doi: 10.1128/JCM.43.8.3662-3672.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Kok J, Blyth CC, Foo H, Patterson J, Taylor J, McPhie K, Ratnamohan VM, Iredell JR, Dwyer DE. 2010. Comparison of a rapid antigen test with nucleic acid testing during cocirculation of pandemic influenza A/H1N1 2009 and seasonal influenza A/H3N2. J Clin Microbiol 48:290–291. doi: 10.1128/JCM.01465-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Kuypers J, Campbell AP, Cent A, Corey L, Boeckh M. 2009. Comparison of conventional and molecular detection of respiratory viruses in hematopoietic cell transplant recipients. Transpl Infect Dis 11:298–303. doi: 10.1111/j.1399-3062.2009.00400.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Renaud C, Crowley J, Jerome KR, Kuypers J. 2012. Comparison of FilmArray respiratory panel and laboratory-developed real-time reverse transcription-polymerase chain reaction assays for respiratory virus detection. Diagn Microbiol Infect Dis 74:379–383. doi: 10.1016/j.diagmicrobio.2012.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Christopher-Hennings J, Araujo KPC, Souza CJH, Fang Y, Lawson S, Nelson EA, Clement T, Dunn M, Lunney JK. 2013. Opportunities for bead-based multiplex assays in veterinary diagnostic laboratories. J Vet Diagn Invest 25:671–691. [DOI] [PubMed] [Google Scholar]
  • 65.Xie Z, Luo S, Xie L, Liu J, Pang Y, Deng X, Xie Z, Fan Q, Khan MI. 2014. Simultaneous typing of nine avian respiratory pathogens using a novel GeXP analyzer-based multiplex PCR assay. J Virol Methods 207:188–195. doi: 10.1016/j.jviromet.2014.07.007. [DOI] [PubMed] [Google Scholar]
  • 66.Gadsby NJ, Hardie A, Claas ECJ, Templeton KE. 2010. Comparison of the Luminex respiratory virus panel fast assay with in-house real-time PCR for respiratory viral infection diagnosis. J Clin Microbiol 48:2213–2216. doi: 10.1128/JCM.02446-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Mahony J, Chong S, Merante F, Yaghoubian S, Sinha T, Lisle C, Janeczko R. 2007. Development of a respiratory virus panel test for detection of twenty human respiratory viruses by use of multiplex PCR and a fluid microbead-based assay. J Clin Microbiol 45:2965–2970. doi: 10.1128/JCM.02436-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Marshall DJ, Reisdorf E, Harms G, Beaty E, Moser MJ, Lee W-M, Gern JE, Nolte FS, Shult P, Prudent JR. 2007. Evaluation of a multiplexed PCR assay for detection of respiratory viral pathogens in a public health laboratory setting. J Clin Microbiol 45:3875–3882. doi: 10.1128/JCM.00838-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Nolte FS, Marshall DJ, Rasberry C, Schievelbein S, Banks GG, Storch GA, Arens MQ, Buller RS, Prudent JR. 2007. MultiCode-PLx system for multiplexed detection of seventeen respiratory viruses. J Clin Microbiol 45:2779–2786. doi: 10.1128/JCM.00669-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Pabbaraju K, Tokaryk KL, Wong S, Fox JD. 2008. Comparison of the Luminex xTAG respiratory viral panel with in-house nucleic acid amplification tests for diagnosis of respiratory virus infections. J Clin Microbiol 46:3056–3062. doi: 10.1128/JCM.00878-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Fox JD. 2007. Nucleic acid amplification tests for detection of respiratory viruses. J Clin Virol 40(Suppl 1):S15–S23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Mahony JB. 2008. Detection of respiratory viruses by molecular methods. Clin Microbiol Rev 21:716–747. doi: 10.1128/CMR.00037-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Yan Y, Zhang S, Tang Y-W. 2011. Molecular assays for the detection and characterization of respiratory viruses. Semin Respir Crit Care Med 32:512–526. doi: 10.1055/s-0031-1283288. [DOI] [PubMed] [Google Scholar]
  • 74.Drago F, Karpasitou K, Poli F. 2009. Microarray beads for identifying blood group single nucleotide polymorphisms. Transfus Med Hemotherapy 36:157–160. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Jiang H-L, Zhu H-H, Zhou L-F, Chen F, Chen Z. 2006. Genotyping of human papillomavirus in cervical lesions by L1 consensus PCR and the Luminex xMAP system. J Med Microbiol 55:715–720. doi: 10.1099/jmm.0.46493-0. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES