Abstract
The metal-specific CzcRS two-component system in Pseudomonas aeruginosa is involved in the repression of the OprD porin, causing in turn carbapenem antibiotic resistance in the presence of high zinc concentration. It has also been shown that CzcR is able to directly regulate the expression of multiple genes including virulence factors. CzcR is therefore an important regulator connecting (i) metal response, (ii) pathogenicity and (iii) antibiotic resistance in P. aeruginosa. Recent data have suggested that other regulators could negatively control oprD expression in the presence of zinc. Here we show that the RNA chaperone Hfq is a key factor acting independently of CzcR for the repression of oprD upon Zn treatment. Additionally, we found that an Hfq-dependent mechanism is necessary for the localization of CzcR to the oprD promoter, mediating oprD transcriptional repression. Furthermore, in the presence of Cu, CopR, the transcriptional regulator of the CopRS two-component system also requires Hfq for oprD repression. Altogether, these results suggest important roles for this RNA chaperone in the context of environment-sensing and antibiotic resistance in P. aeruginosa.
Keywords: Hfq, carbapenem resistance, Pseudomonas aeruginosa, OprD, two-component system, Zinc, Copper
1. Introduction
Pseudomonas aeruginosa is an opportunistic pathogen that causes serious and diverse infections in host organisms by producing a broad range of virulence factors [1]. This bacterium carries intrinsic resistances to multiple classes of antimicrobial compounds, representing a major challenge for the treatment of Pseudomonas’ infections [2]. For instance, resistance to carbapenem, an important class of anti-Pseudomonas compounds, is mostly caused by the decrease in production of OprD porin. In normal conditions, OprD forms a trimeric outer-membrane channel [3] which is generally involved in the import of basic amino acids and small peptides from the outer medium [4]. However, carbepenem molecules are also imported through this porin and, consequently, a reduced production of OprD causes the insurgence of bacterial resistance [5,6,7].
We have previously found that the mechanism that triggers the negative regulation of OprD is linked to Zn and Cd metal resistance. According to [8], this mechanism is a process called co-regulation between metal and antibiotic resistance. The presence of an excess of these elements activates the metal-inducible CzcRS two-component system (TCS) that induces the expression of a metal efflux pump. Furthermore, it down-regulates the production of the OprD porin, thus rendering cells resistant to both trace metals and carbapenems. Cu has also been shown to induce expression of the copRS TCS which can directly repress oprD transcription [5]. Therefore, toxic metal concentrations of Zn, Cd, or Cu may all lead to the induction of carbapenem resistance. In addition to OprD, the CzcR regulator has been shown to modulate gene expression of multiple virulence factors in response to Zn treatment, with major clinical implications [9]. Consistently, certain physiological environments enriched in metals, such as the pulmonary sputum of cystic fibrosis (CF) patients, can increase both the virulence and carbapenem resistance of P. aeruginosa [10]. These situations could locally induce carbapenem resistance, rendering this antibiotic inefficient and could explain, in part, the discrepancies between antibiotic susceptibility profiles performed in vitro and effective resistance profiles in patients.
P. aeruginosa possesses a broad range of TCS systems, allowing it to adapt and thrive in many diverse environments by specifically modulating the transcription of response genes [11]. In addition to TCS signaling and transcriptional adaptation, bacteria take advantage of post-transcriptional regulation mechanisms to adjust their cellular functions. Several studies have shown that the expression of porins in Escherichia coli [12], Vibrio cholerae [13] and Salmonella [14,15] is regulated by the Hfq protein in association with specific small non-coding RNAs (sRNA) [16,17]. Hfq interacts with specific sRNAs and facilitates the binding to their target-mRNA, allowing the direct modulation of translation or of mRNA stability [17,18]. The Hfq protein is therefore a key player in the post-transcriptional regulation process involving sRNA. Hfq belongs to the Sm family of proteins, which members are found in bacteria, eukaryotes and archea [19]. Its crystal structure, characterized by a ring-like structure composed of six monomer subunits, has been solved for several bacteria such as Staphylococcus aureus [20], Bacillus subtilis [21], E. coli [22] and P. aeruginosa [23,24]. It has been shown to affect the expression of up to 5% of P. aeruginosa transcripts, mainly through post-transcriptional regulations [25]. Hfq deletion mutants present diminished fitness, growth defects and impaired resistance under conditions of stress. Interestingly, in pathogenic bacteria, the loss of Hfq reduces virulence in in vivo models [26] and impairs quorum sensing capacities [27].
In this study, we investigated the regulatory network controlling OprD porin production in P. aeruginosa in the presence of high Zn concentrations. Our results show that Hfq is required for OprD downregulation upon Zn treatment. More precisely, we found that the DNA-binding activity of the CzcR protein to the oprD promoter is strongly affected in an hfq mutant. Moreover, the CopRS TCS involved in copper response also requires Hfq to repress the porin. Altogether, these data highlight an important function for the RNA chaperone Hfq in the control of TCS signaling and might help the understanding of the induction of metal and antibiotic resistance in the environment. This might also explain the inability of hfq mutants to adapt to changing environments and open new opportunities for drug design in the context of anti-Pseudomonas therapy.
2. Materials and Methods
2.1. Bacterial Strains, Growth Conditions and Minimum Inhibitory Concentration (MIC) Determination
The bacterial strains used in this study are listed in Table 1. E. coli and P. aeruginosa strains were grown at 37 °C in solid or liquid Luria-Bertani (LB) medium (US biological, Salem, MA, USA). Metal-containing LB media were supplemented with CuCl2 or ZnCl2 at the final concentration indicated in the figure legends. Antibiotics were used at the following concentrations (in µg per mL): gentamicin 50, tetracycline 50, carbenicillin 200, streptomycin 200 for P. aeruginosa and gentamicin 15, tetracycline 15, ampicillin 100 for E. coli.
Table 1.
Strain or Plasmid | Relevant Characteristic(s) | Reference or Source |
---|---|---|
Pseudomonas aeruginosa | ||
Wild type (WT) | PAO1 wild type | WT, laboratory collection |
ΔczcRS | PAO1 ΔczcRS | [5] |
hfq− | PAO1 hfq::aadA, Smr, Spr | [26] |
ΔczcRS, hfq− | PAO1 ΔczcRS, hfq::aadA, Smr, Spr | This study |
Escherichia coli | ||
Top10 | F-mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 Δ lacX74 recA1 araD139 Δ(araleu)7697 galU galK rpsL (StrR) endA1 nupG | Invitrogen |
Plasmids | ||
pMMB66EH | Broad host range expressing vector, Cbr | [29] |
pczcRWT pcopRWT |
pMMB66EH derivative containing czcR gene, Cbr
pMMB66EH derivative containing copR gene, Cbr |
[7] [5] |
pME4510 pME-Hfq |
Multicopy broad host range vector, Gmr pME4510 derivative containing hfq gene under its own promoter, Gmr |
[30] This study |
Abbreviations of antibiotics. Sm: streptomycin; Sp: spectinomycin; Cb: carbenicillin; Gm: gentamycin.
The minimum inhibitory concentration (MIC) for imipenem was determined according to the EUCAST (European Committee on Antimicrobial Susceptibility Testing) procedure [28] in LB medium supplemented or not with 2.5 mM CuCl2 or 0.5 mM ZnCl2, using the Imipenem E-test (Biomerieux, Marcy-l’Etoile, France).
2.2. DNA Manipulations
Restriction enzymes, PCR amplifications and cloning were performed using standard methods [31] following the manufacturers instructions. Plasmids were introduced into E. coli by heat-shock [31] and into P. aeruginosa by electroporation [32]. Plasmid inserts and genomic regions flanking the deletions were verified by sequencing.
hfq complementation: The full P. aeruginosa hfq gene and its promoter region were amplified by PCR using primers 636 and 610 (Appedix Table A1). The PCR product was digested with EcoRI and BamHI enzymes and ligated into the corresponding site of the pME4510 vector. The resulting plasmid containing the 6× His tag in the C-terminal part of the hfq gene was transformed into the P. aeruginosa WT strain and the hfq− mutant by electroporation [32].
Double mutant construction: The ΔczcRS;hfq− double mutant was constructed by homologous recombination. Briefly, the ΔczcRS strain was conjugated with the p202Sp plasmid containing the inactivated hfq gene, according to the initial protocol [26]. Clones were selected for streptomycin resistance and tetracycline sensitivity. Deletion was confirmed by PCR on genomic DNA using primers 314 and 315 (Appedix Table A1).
2.3. Western Blot Analysis
Overnight cultures were diluted to an OD600 of 0.05 for Wild Type (WT) and ΔczcRS or OD600 of 0.1 (absence of Zn) or 0.2 (presence of Zn) for hfq− and ΔczcRS;hfq− strains and grown for 6 h. Metal concentrations, when added, are 0.5 mM ZnCl2 or 2.5 mM CuCl2. When necessary, IPTG (isopropyl-1-thio-D-galactopyranoside) was added at a final concentration of 0.1 mM. Cultures were grown for 6 h and 1 mL of culture was pelleted in a microfuge. Total proteins were solubilized to a concentration of 2 mg·mL−1 by sonication in the appropriate volume of 1× β-mercaptoethanol gel-loading buffer (an OD600 of 1 gives 0.175 mg·mL−1 of protein). Samples were boiled for 5 min prior to loading. 15 µL (30 µg) of total protein was separated on a 4%–15% precast gel (Mini-PROTEAN TGX Gels, Biorad, Hercules, CA, USA) and transferred to a nitrocellulose membrane. Blots were incubated with anti-OprD, anti-CzcR and anti-Hsp70 antibodies as previously described [9] and revealed by chemiluminescence.
2.4. RNA Extraction and Reverse Transcription
Overnight cultures were diluted as described in Section 2.3. and grown for 6 h. RNA Protect bacteria solution (1 mL, Qiagen, Hilden, Germany) was added to 0.5 mL of culture. Cells were harvested by centrifugation and total RNA was extracted using RNeasy columns (Qiagen) according to the manufacturer’s instructions. RNA (3 µg) was treated for 2 h with RQ1 DNase (Promega, Fitchburg, MA, USA), in order to remove any residual DNA, followed by phenol-chloroform extraction and ethanol precipitation. The RNA was then resuspended in 30 μL RNAse-free water. For cDNA synthesis, 500 ng of total RNA was reverse-transcribed using random hexamer primers (Promega) and Improm-II reverse transcriptase (Promega) according to the supplier’s instructions. The reverse transcriptase was then heat-inactivated and the cDNAs obtained were diluted tenfold in water.
2.5. Quantitative RT-PCR
qPCR procedures were performed in triplicate starting from three independent experiments, using SYBR Green mix (Power SYBR Green PCR Master Mix, Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. Primers used for qRT-PCR are described in Appedix Table A1. Results were analyzed according to [33]. The well expressed porin oprF was used for normalization since its expression was affected neither by Zn nor by hfq deletion.
2.6. Semi-Quantitative RT-PCR
PCR amplifications were performed using standard procedures with 27 cycles, except for the RT-negative control (without reverse-transcriptase) for which the amplification was carried out with 30 cycles, using hsp70 primer pairs. The primers used are listed in Appedix Table A1. Each analysis was performed at least three times from three independent cultures. A representative analysis is presented.
2.7. Chromosome Immunoprecipitation
ChIP (chromosome immunoprecipitation) experiments were performed as previously described [9]. Briefly, the WT and hfq− strains were grown for 6 h in 50 mL LB medium supplemented or not with 0.5 mM Zn. To fix the protein to DNA, the cultures were treated with 1.2% (final concentration) formaldehyde for 10 min. Glycine (330 mM) was then added to quench the reaction. Bacteria were lyzed by sonication and resuspended in 500 µL ice-cold FA-lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA pH 8, 1% Triton X-100, 0.1% Sodium deoxycholate) supplemented with lysozyme (5 mg·mL−1), AEBSF (4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride, 1 mM final) and SDS (0.5% final). The resuspended pellet was sonicated as previously described [34]. After sample centrifugation 200 µL of supernatant was used for immunoprecipitation. The immunoprecipitations were performed by addition of 800 µL FA-lysis buffer with 50 µL protein A sepharose (100 mg·mL−1) and 5 µL of CzcR anti-serum [10]. Immunoprecipitated DNA was quantified by real-time PCR using a SYBR Green mix (Power SYBR Green PCR Master Mix, Thermo Fisher Scientific, Waltham, MA, USA) according to the supplier's specifications. Results represent the amount of oprD promoter immunoprecipitated with CzcR in comparison to the input DNA. Each value represents the average of three independent experiments (standard deviations are indicated). The primers used are listed in Appedix Table A1.
3. Results
3.1. A CzcR-Independent Mechanism Represses the Production of the OprD Porin in Presence of Zn
CzcR, the transcriptional regulator of the Zn and Cd activated two-component system CzcRS, is able to directly repress the transcription of the oprD gene in the presence of Zn [7,9]. In a previous study we have shown that another mechanism, independently of CzcRS, could also be involved in oprD repression upon Zn treatment [10]. We decided to further investigate this alternative mechanism and used the ΔczcRS mutant, deleted for the metal-specific TCS, to analyze the abundance of OprD porin at different Zn concentrations in LB medium when cells are in early stationary phase, i.e., after 6 h of growth (Figure 1A). In the wild type P. aeruginosa PAO1 strain, at 0.05 mM Zn, we observed at 6 h a drop of OprD of approximately 60%, whereas no effect (only 3% reduction) was observed in the corresponding ΔczcRS mutant (Figure 1A). At 0.2 mM Zn, OprD could no longer be detected by western blot in the WT. Surprisingly, at this concentration, we observed a 50% decrease in OprD protein in the ΔczcRS strain. By increasing Zn to 0.5 mM, a concentration that does not affect the growth of the mutant (Figure 1B), we found that OprD is also strongly repressed (85%) in the ΔczcRS mutant (Figure 1A). Although this effect is not as strong as the one observed in the WT, it does however suggest that another mechanism, independent of CzcRS, might account for OprD down-regulation in the presence high Zn concentrations.
3.2. Hfq is Involved in the Repression of OprD in the Presence of Zn
The RNA chaperone Hfq is known to control the expression of several porins in Gram-negative bacteria, working mostly at the post-transcriptional level, on mRNA stability or translation [17,35]. We therefore decided to test the possible involvement of this protein in the repression of OprD upon Zn treatment. To this aim, an hfq mutant was created in the ΔczcRS genetic background to avoid the CzcR-mediated transcriptional repression. A slight growth delay was observed in the hfq mutants (hfq− and ΔczcRS;hfq−) in the presence of metal. This reflects the growth rate defect already detected in the P. aeruginosa hfq mutant [26]. The inoculum was therefore adapted (see experimental Section 2.3.) in order to reach the same optical density after 6h of growth (Figure 2A). As expected, the ΔczcRS mutant displayed a repression of OprD in the presence of 0.5 mM Zn, whereas the effect on OprD level was only very weak (5%) in the ΔczcRS;hfq− double mutant (Figure 2B). These observations suggested the possible involvement of the RNA chaperone Hfq in the control of OprD production under metal stress conditions. To investigate the contribution of Hfq in this process, we first determined the amount of oprD mRNA by quantitative RT-PCR. In the ΔczcRS mutant, addition of Zn induced a drop in oprD mRNA, while disruption of the hfq gene in this strain (ΔczcRS;hfq− mutant) totally abolished the decrease in the amount of oprD mRNA (Figure 2C). Zn treatment however did not affect the expression of hfq, as measured by semi-qRT-PCR (Appendix Figure A1). Altogether these results showed that, in addition to the transcriptional repression mediated by CzcR, Zn treatment induced an Hfq-dependent mechanism leading to oprD mRNA down-regulation.
3.3. Hfq is also Involved in the Negative Regulation of OprD Mediated by CzcR
In the absence of CzcRS, we observed that Hfq might contribute to the negative regulation of OprD upon Zn challenge (Figure 2). To test whether Hfq contributes to CzcRS TCS function, we examined the amount of OprD porin in the WT strain and in the single hfq mutant. Surprisingly, while the CzcR protein was induced at the same level in both strains in presence of Zn, OprD repression is clearly impaired in the absence of Hfq protein (Figure 3A). This result suggested that either Hfq is the main OprD repressor in Zn conditions or CzcR-mediated regulation requires the RNA chaperone. Complementation of the hfq− strain with a plasmid containing a functional 6x His-tagged hfq gene led to a full restoration of OprD repression in the presence of Zn (Figure 3B), indicating that the observed result was not due to a polar effect caused by hfq deletion. The regulation of OprD in the control WT strain containing either the pME (empty plasmid) or the hfq gene (phfq) was not affected (data not shown). Moreover, the fact that the CzcR protein is fully produced suggested that Zn recognition by the CzcS sensor protein and the phosphorelay leading to CzcR induction are not affected by the absence of Hfq.
We have previously noticed that artificial overexpression of the transcriptional regulator CzcR is able to repress oprD, even in the absence of the sensor protein CzcS and in the absence of Zn [7]. We wondered whether in this situation negative regulation also required the Hfq protein. To this aim, we used the pCzcR plasmid containing the czcR gene under the control of an IPTG-inducible promoter. In the absence of Zn overexpression of czcR yielded complete repression of OprD in a ΔczcRS background, while only a minor effect was visible in the absence of Hfq (ΔczcRS;hfq− background) (Figure 3C). This indicates that full repression, mediated directly by CzcR, is dependent upon the Hfq protein even in the absence of Zn challenge.
3.4. Hfq is Necessary for Localization of CzcR to the oprD Promoter
In order to investigate the role of Hfq in CzcR-mediated transcriptional repression, we evaluated the DNA-binding efficiency of CzcR to the oprD promoter. To do so, we performed a ChIP (chromosome immunoprecipitation) experiment using anti-CzcR antibody. Interestingly, addition of Zn caused a clear localization of CzcR to the oprD promoter in the WT strain compared to the hfq mutant (Figure 4A). The weak occupancy of oprD promoter by CzcR observed in the hfq− strain is not due to a defect in czcR expression since the protein is produced to a similar level than in WT even in the absence of Hfq (Figure 3B). Furthermore, the fact that the level of transcriptional repression (Figure 4B) perfectly matches with the localization of CzcR on the oprD promoter (Figure 4A) suggests the requirement of RNA chaperone Hfq for the complete binding of CzcR to oprD, leading to transcriptional repression of the oprD porin.
3.5. Is Hfq also Involved in the Repression Mediated by other Transcriptional Regulators?
We have previously observed that CopR, the transcriptional regulator of the CopRS TCS involved in the copper response, also repressed the transcription of the oprD gene [5]. To determine whether this negative regulation mechanism also depends on the RNA chaperone Hfq, we first evaluated the effect of CopR induction after 6 h of growth in the presence of Cu. Western blot analysis showed no OprD repression in the absence of Hfq (Figure 5A). In addition, similarly to the overproduction of CzcR (Figure 3A), the overproduction of CopR, was unable to decrease OprD level in the absence of Hfq (Figure 5B). These results highlight the importance of Hfq for successful gene repression mediated by, at least, two TCS transcriptional regulators.
3.6. Involvement of the Hfq Protein in Carbapenem Resistance
According to these results, Hfq appears to be an important player in P. aeruginosa carbapenem resistance. In order to confirm this, we determined the minimum inhibitory concentration (MIC) for imipenem of various mutants (Table 2). Zn or Cu increased the MIC higher than the imipenem C value (8 µg·mL−1), conferring resistance to P. aeruginosa only in presence of Hfq protein. As previously observed [7], the CzcRS TCS is also essential for the imipenem resistance mechanism induced by Zn as the ΔczcRS mutant remained susceptible (Table 2). Interestingly, Hfq is also important for basal imipenem tolerance. In the hfq− or ΔczcRS;hfq− strains, the MIC dropped significantly even in absence of metals. Hfq is therefore a crucial player in OprD porin regulation, modulating imipenem resistance as a consequence of metal response.
Table 2.
Strain | Medium Supplemented with: | ||
---|---|---|---|
No Metal | Zn | Cu | |
WT | 1 | 16 | >32 |
ΔczcRS | 1 | 3 | >32 |
hfq− | 0.38 | 2 | 4 |
ΔczcRS;hfq− | 0.25 | 0.38 | 2 |
4. Discussion
Carbapenems are an important class of antibiotics active against both Gram-negative and Gram-positive bacteria. They are often used as last resource for the treatment of P. aeruginosa infections. Carbapenem resistance in P. aeruginosa, however, is an important and worldwide problem with a resistance rate of about 20% in Europe [36]. These antibiotics penetrate the bacterium via the OprD porin, therefore the main and most frequent mechanism of resistance to this family of antibiotics is a decrease in the amount of OprD protein [6,37]. Several regulators and small molecules are known to modulate the expression of oprD (reviewed in [38]) and the post-transcriptional regulation of this porin has been speculated on for a long time [39], suggesting OprD as a highly regulated porin. In the present study we found that, in the presence of Zn or Cu, oprD is negatively regulated by two mechanisms dependent on the RNA chaperone Hfq (Figure 6). Hfq is a well-known RNA binding protein involved in post-transcriptional regulation via modulation of sRNA-mRNA interactions [17]. Since many sRNAs control gene expression in proteobacteria, mutations affecting the Hfq expression yield pleiotropic effects. In P. aeruginosa, mutations in Hfq strongly affect quorum sensing and virulence factors production [26].
Since Zn treatment did not affect the expression of hfq (Appendix Figure A1), the Hfq-mediated regulation in the absence of CzcR might be due to a Zn-regulated sRNA. To date, the only known sRNA able to modulate oprD levels is phrS [40]. However, overexpression of this sRNA was shown to increase OprD protein levels [40] and Zn treatment failed to modulate phrS expression (Appendix Figure A2). To our knowledge, there are no sRNAs shown to be involved in oprD negative regulation. On the other hand, several studies have demonstrated that Hfq can bind directly to the target mRNA without the help of sRNA [41,42,43].
The transcriptional effect of Hfq on the regulation of oprD reveals an important function of this RNA chaperone targeting the functionality of two-component systems transcriptional regulators. In P. aeruginosa, some 130 TCS have been listed [11]; a huge number accounting for its great versatility and ability to sense and respond to environmental stimuli. These two-component systems usually consist of a sensor histidine kinase membrane-spanning protein involved in the detection of environmental stimuli. This sensor protein activates a response regulator by phosphorylation that, in turn, modulates gene expression by binding to the target promoters [44].
The data presented here demonstrate that Hfq is necessary for the binding activity of CzcR to the oprD promoter in the presence of Zn (Figure 4 and Figure 6), without affecting its expression or stability (Figure 3). The mechanism by which Hfq allows the binding of CzcR to the oprD promoter is not yet understood, but several possibilities could be investigated according to the known properties of this RNA chaperone [45]. Hfq is able to bind to DNA and organize the E. coli nucleoid [46], it could therefore be directly involved in the modeling of the oprD promoter, favoring CzcR binding. On the other hand, the possibility of an indirect effect on the regulation of oprD through the modulation of CzcR co-factor expression by a small RNA cannot be excluded.
We showed that Hfq is also necessary to the copper repression mediated by the CopRS TCS. In the presence of Cu, the CopR regulator represses oprD independently of CzcR [5]. We showed here that this activity is also Hfq-dependent (Figure 5). Interestingly in the absence of Hfq, the overexpression of CopR displayed no OprD repression (Figure 5B) while CzcR overexpression weakly decreased the amount of OprD protein (Figure 3C). This difference could be explained by the modest presence of CzcR on the oprD promoter even in the absence of Hfq (Figure 4A). This suggests that the Hfq requirement for repression mediated by TCS regulators might differ from one regulator to the next. The fact that Hfq is necessary for the repressor activity of two distinct TCSs suggests an important role of this RNA chaperone in the sensing and adaptation of P. aeruginosa to its environment. Consistently, this might explain the pleiotropic effects observed in the hfq mutant [25,26]. Taken together our data support the fact that the Hfq protein may represent a very interesting target for drug discovery [47]. Blocking Hfq functions will affect not only P. aeruginosa quorum sensing and virulence but also several TCSs involved in carbapenem resistance.
5. Conclusions
We previously observed that the environmental opportunistic pathogen Pseudomonas aeruginosa becomes more virulent and resistant to carbapenem antibiotic in the presence of metal pollutants such as zinc, or copper. The data presented here, bring new light on the mechanisms of metal inducible antibiotic resistance. We found that the transcriptional repression of OprD, involved in carbapenem resistance, requires the RNA chaperone Hfq. By revealing the underlying mechanism, we discovered that the metal specific transcriptional regulator CzcR requires Hfq to bind to the oprD promoter. Furthermore, we demonstrated that another transcriptional regulator from another two-component system also requires the Hfq protein to repress OprD in presence of metal. These results highlight how Hfq chaperone acts as an essential component of the environment-sensing in P. aeruginosa, liking metal detection to antibiotic resistance.
Acknowledgments
This work was supported by funding from the Ernst et Lucie Schmidheiny Foundation and the Swiss National Science Foundation (Grant 31003A_124931). The authors wish to thank Massimo Caine for helpful comments on the manuscript.
Appendix
Table A1.
Amplicon | Primer | Sequence (5′ to 3′) | Position | Length |
---|---|---|---|---|
Coding region | ||||
oprD | oprD1 | ATCTACCGCACAAACGATGAAGG | 772 | 156 |
oprD2 | GCCGAAGCCGATATAATCAAACG | 927 | ||
oprF | oprF1 | GGTTACTTCCTGACCGACGA | 172 | 664 |
oprF2 | TCGGTGTTGATGTTGGTGAT | 836 | ||
hfq | 263 | GTCAAAAGGGCATTCGCTAC | 3 | 176 |
331 | AGATCGCGTGCTTGTAAACC | 178 | ||
hsp70 | 406 | CCACACCGTGATCGTCTATG | 561 | 185 |
407 | CGCTTTCCTTCTTGAACTCG | 745 | ||
czcR | czcR1 | GTCATCACCCGGACGCAGATCAT | 502 | 153 |
czcR2 | GTAGCCGACGCCGCGAATGGTAT | 654 | ||
phrS | 449 | CAACTGGAGGCCATCAACAT | 21 | 160 |
450 | CCTTGCGTGCTCTGTGTATC | 180 | ||
Promoter | ||||
poprD | poprD R | CGCAGATGCGACATGCGTCA | −178 | 101 |
poprD L | GGCGCTCCACTTCATCACTT | −77 | ||
Primers used for DNA cloning | ||||
Hfq:6His | 609 | GCCGAATTCGCGAAGCTGGAGCCATCTAC | −200 | 449 |
667 | GCCGGATCCTCAATGATGATGATGAT GATGAGCGTTGCCCGGCTCGG |
249 | ||
Hfq insertion verification | 314 | TGCCGTATACTGTCGCTCAG | PA4945 | 1390/3534 * |
315 | ATTGAACAGGGTCGATTTGC | PA4944 |
* Without and with aadA insertion cassette.
Author Contributions
V.D., M.R.G. and K.P. conceived and designed the experiments; V.D., M.R.G. and T.S. performed the experiments; V.D., M.R.G., T.S. and K.P. analyzed the data; K.P. contributed reagents/materials/analysis tools; V.D., M.R.G. and K.P. wrote the paper.
Conflicts of Interest
The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.
References
- 1.Lyczak J.B., Cannon C.L., Pier G.B. Establishment of Pseudomonas Aeruginosa infection: Lessons from a versatile opportunist. Microbes Infect. 2000;2:1051–1060. doi: 10.1016/S1286-4579(00)01259-4. [DOI] [PubMed] [Google Scholar]
- 2.Poole K. Pseudomonas Aeruginosa: Resistance to the max. Front. Microbiol. 2011 doi: 10.3389/fmicb.2011.00065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Biswas S., Mohammad M.M., Patel D.R., Movileanu L., van den Berg B. Structural insight into oprd substrate specificity. Nat. Struct. Mol. Biol. 2007;14:1108–1109. doi: 10.1038/nsmb1304. [DOI] [PubMed] [Google Scholar]
- 4.Ochs M.M., Lu C.D., Hancock R.E., Abdelal A.T. Amino acid-mediated induction of the basic amino acid-specific outer membrane porin oprd from Pseudomonas Aeruginosa. J. Bacteriol. 1999;181:5426–5432. doi: 10.1128/jb.181.17.5426-5432.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Caille O., Rossier C., Perron K. A copper-activated two-component system interacts with zinc and imipenem resistance in Pseudomonas Aeruginosa. J. Bacteriol. 2007;189:4561–4568. doi: 10.1128/JB.00095-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Ochs M.M., McCusker M.P., Bains M., Hancock R.E. Negative regulation of the Pseudomonas Aeruginosa outer membrane porin oprd selective for imipenem and basic amino acids. Antimicrob. Agents Chemother. 1999;43:1085–1090. doi: 10.1128/aac.43.5.1085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Perron K., Caille O., Rossier C., Van Delden C., Dumas J.L., Kohler T. Czcr-czcs, a two-component system involved in heavy metal and carbapenem resistance in Pseudomonas Aeruginosa. J. Biol. Chem. 2004;279:8761–8768. doi: 10.1074/jbc.M312080200. [DOI] [PubMed] [Google Scholar]
- 8.Baker-Austin C., Wright M.S., Stepanauskas R., McArthur J.V. Co-selection of antibiotic and metal resistance. Trends Microbiol. 2006;14:176–182. doi: 10.1016/j.tim.2006.02.006. [DOI] [PubMed] [Google Scholar]
- 9.Dieppois G., Ducret V., Caille O., Perron K. The transcriptional regulator czcr modulates antibiotic resistance and quorum sensing in Pseudomonas Aeruginosa. PLoS ONE. 2012;7:82. doi: 10.1371/journal.pone.0038148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Marguerettaz M., Dieppois G., Que Y.-A., Ducret V., Zuchuat S., Perron K. Sputum containing zinc enhances carbapenem resistance, biofilm formation and virulence of Pseudomonas Aeruginosa. Microb. Pathog. 2014;77:36–41. doi: 10.1016/j.micpath.2014.10.011. [DOI] [PubMed] [Google Scholar]
- 11.Rodrigue A., Quentin Y., Lazdunski A., Mejean V., Foglino M. Two-component systems in Pseudomonas Aeruginosa: Why so many? Trends Microbiol. 2000;8:498–504. doi: 10.1016/S0966-842X(00)01833-3. [DOI] [PubMed] [Google Scholar]
- 12.Chen S., Zhang A., Blyn L.B., Storz G. MicC, a second small-RNA regulator of Omp protein expression in escherichia coli. J. Bacteriol. 2004;186:6689–6697. doi: 10.1128/JB.186.20.6689-6697.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Song T., Sabharwal D., Wai S.N. VrrA mediates Hfq-dependent regulation of OmpT synthesis in Vibrio cholerae. J. Mol. Biol. 2010;400:682–688. doi: 10.1016/j.jmb.2010.05.061. [DOI] [PubMed] [Google Scholar]
- 14.Frohlich K.S., Papenfort K., Berger A.A., Vogel J. A conserved RpoS-dependent small RNA controls the synthesis of major porin OmpD. Nucleic. Acids Res. 2012;40:3623–3640. doi: 10.1093/nar/gkr1156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Pfeiffer V., Sittka A., Tomer R., Tedin K., Brinkmann V., Vogel J. A small non-coding RNA of the invasion gene island (SPI-1) represses outer membrane protein synthesis from the Salmonella core genome. Mol. Microbiol. 2007;66:1174–1191. doi: 10.1111/j.1365-2958.2007.05991.x. [DOI] [PubMed] [Google Scholar]
- 16.Pfeiffer V., Papenfort K., Lucchini S., Hinton J.C., Vogel J. Coding sequence targeting by MicC RNA reveals bacterial mrna silencing downstream of translational initiation. Nat. Struct. Mol. Biol. 2009;16:840–846. doi: 10.1038/nsmb.1631. [DOI] [PubMed] [Google Scholar]
- 17.Vogel J., Luisi B.F. Hfq and its constellation of RNA. Nat. Rev. Microbiol. 2011;9:578–589. doi: 10.1038/nrmicro2615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Repoila F., Darfeuille F. Small regulatory non-coding RNAs in bacteria: Physiology and mechanistic aspects. Biol. Cell. 2009;101:117–131. doi: 10.1042/BC20070137. [DOI] [PubMed] [Google Scholar]
- 19.Mura C., Randolph P.S., Patterson J., Cozen A.E. Archaeal and eukaryotic homologs of Hfq: A structural and evolutionary perspective on Sm function. RNA Biol. 2013;10:636–651. doi: 10.4161/rna.24538. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Schumacher M.A., Pearson R.F., Moller T., Valentin-Hansen P., Brennan R.G. Structures of the pleiotropic translational regulator Hfq and an Hfq-RNA complex: A bacterial Sm-like protein. EMBO J. 2002;21:3546–3556. doi: 10.1093/emboj/cdf322. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Someya T., Baba S., Fujimoto M., Kawai G., Kumasaka T., Nakamura K. Crystal structure of hfq from bacillus subtilis in complex with selex-derived RNA aptamer: Insight into RNA-binding properties of bacterial hfq. Nucleic Acids Res. 2012;40:1856–1867. doi: 10.1093/nar/gkr892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Sauter C., Basquin J., Suck D. Sm-like proteins in eubacteria: The crystal structure of the Hfq protein from Escherichia coli. Nucleic Acids Res. 2003;31:4091–4098. doi: 10.1093/nar/gkg480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Moskaleva O., Melnik B., Gabdulkhakov A., Garber M., Nikonov S., Stolboushkina E., Nikulin A. The structures of mutant forms of Hfq from Pseudomonas Aeruginosa reveal the importance of the conserved his57 for the protein hexamer organization. Acta Crystallogr. Sect. F. 2010;66:760–764. doi: 10.1107/S1744309110017331. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Nikulin A., Stolboushkina E., Perederina A., Vassilieva I., Blaesi U., Moll I., Kachalova G., Yokoyama S., Vassylyev D., Garber M., et al. Structure of Pseudomonas Aeruginosa Hfq protein. Acta Crystallogr. Sect. D. 2005;61:141–146. doi: 10.1107/S0907444904030008. [DOI] [PubMed] [Google Scholar]
- 25.Sonnleitner E., Schuster M., Sorger-Domenigg T., Greenberg E.P., Blasi U. Hfq-dependent alterations of the transcriptome profile and effects on quorum sensing in Pseudomonas Aeruginosa. Mol. Microbiol. 2006;59:1542–1558. doi: 10.1111/j.1365-2958.2006.05032.x. [DOI] [PubMed] [Google Scholar]
- 26.Sonnleitner E., Hagens S., Rosenau F., Wilhelm S., Habel A., Jager K.E., Blasi U. Reduced virulence of a hfq mutant of Pseudomonas Aeruginosa o1. Microb. Pathog. 2003;35:217–228. doi: 10.1016/S0882-4010(03)00149-9. [DOI] [PubMed] [Google Scholar]
- 27.Lenz D.H., Mok K.C., Lilley B.N., Kulkarni R.V., Wingreen N.S., Bassler B.L. The small RNA chaperone hfq and multiple small rnas control quorum sensing in vibrio harveyi and vibrio cholerae. Cell. 2004;118:69–82. doi: 10.1016/j.cell.2004.06.009. [DOI] [PubMed] [Google Scholar]
- 28.Matuschek E., Brown D.F., Kahlmeter G. Development of the eucast disk diffusion antimicrobial susceptibility testing method and its implementation in routine microbiology laboratories. Clin. Microbiol. Infect. 2014;20:O255–O266. doi: 10.1111/1469-0691.12373. [DOI] [PubMed] [Google Scholar]
- 29.Furste J.P., Pansegrau W., Frank R., Blocker H., Scholz P., Bagdasarian M., Lanka E. Molecular cloning of the plasmid RP4 primase region in a multi-host-range tacp expression vector. Gene. 1986;48:119–131. doi: 10.1016/0378-1119(86)90358-6. [DOI] [PubMed] [Google Scholar]
- 30.Rist M., Kertesz M.A. Construction of improved plasmid vectors for promoter characterization in Pseudomonas Aeruginosa and other gram-negative bacteria. FEMS Microbiol. Lett. 1998;169:179–183. doi: 10.1111/j.1574-6968.1998.tb13315.x. [DOI] [PubMed] [Google Scholar]
- 31.Sambrook J., Russell D.W. Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY, USA: 2001. [Google Scholar]
- 32.Choi K.H., Kumar A., Schweizer H.P. A 10-min method for preparation of highly electrocompetent Pseudomonas Aeruginosa cells: Application for DNA fragment transfer between chromosomes and plasmid transformation. J. Microbiol. Methods. 2006;64:391–397. doi: 10.1016/j.mimet.2005.06.001. [DOI] [PubMed] [Google Scholar]
- 33.Pfaffl M.W., Horgan G.W., Dempfle L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002 doi: 10.1093/nar/30.9.e36. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Perron K., Comte R., van Delden C. Dksa represses ribosomal gene transcription in Pseudomonas Aeruginosa by interacting with RNA polymerase on ribosomal promoters. Mol. Microbiol. 2005;56:1087–1102. doi: 10.1111/j.1365-2958.2005.04597.x. [DOI] [PubMed] [Google Scholar]
- 35.Vogel J., Papenfort K. Small non-coding RNAs and the bacterial outer membrane. Curr. Opin. Microbiol. 2006;9:605–611. doi: 10.1016/j.mib.2006.10.006. [DOI] [PubMed] [Google Scholar]
- 36.Gales A.C., Jones R.N., Sader H.S. Global assessment of the antimicrobial activity of polymyxin b against 54 731 clinical isolates of gram-negative bacilli: Report from the sentry antimicrobial surveillance programme (2001–2004) Clin. Microbiol. Infect. 2006;12:315–321. doi: 10.1111/j.1469-0691.2005.01351.x. [DOI] [PubMed] [Google Scholar]
- 37.Lister P.D., Wolter D.J., Hanson N.D. Antibacterial-resistant Pseudomonas Aeruginosa: Clinical impact and complex regulation of chromosomally encoded resistance mechanisms. Clin. Microbiol. Rev. 2009;22:582–610. doi: 10.1128/CMR.00040-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Li H., Luo Y.F., Williams B.J., Blackwell T.S., Xie C.M. Structure and function of oprd protein in Pseudomonas Aeruginosa: From antibiotic resistance to novel therapies. Int. J. Med. Microbiol. 2012;302:63–68. doi: 10.1016/j.ijmm.2011.10.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Kohler T., Epp S.F., Curty L.K., Pechere J.C. Characterization of mext, the regulator of the mexe-mexf-oprn multidrug efflux system of Pseudomonas Aeruginosa. J. Bacteriol. 1999;181:6300–6305. doi: 10.1128/jb.181.20.6300-6305.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sonnleitner E., Sorger-Domenigg T., Madej M.J., Findeiss S., Hackermuller J., Huttenhofer A., Stadler P.F., Blasi U., Moll I. Detection of small RNAs in Pseudomonas Aeruginosa by rnomics and structure-based bioinformatic tools. Microbiology. 2008;154:3175–3187. doi: 10.1099/mic.0.2008/019703-0. [DOI] [PubMed] [Google Scholar]
- 41.Ellis M.J., Trussler R.S., Haniford D.B. Hfq binds directly to the ribosome-binding site of IS10 transposase mrna to inhibit translation. Mol. Microbiol. 2015;96:633–650. doi: 10.1111/mmi.12961. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Sobrero P., Valverde C. Evidences of autoregulation of hfq expression in sinorhizobium meliloti strain 2011. Arch. Microbiol. 2011;193:629–639. doi: 10.1007/s00203-011-0701-1. [DOI] [PubMed] [Google Scholar]
- 43.Wang G., Huang X., Li S., Huang J., Wei X., Li Y., Xu Y. The RNA chaperone hfq regulates antibiotic biosynthesis in the rhizobacterium Pseudomonas Aeruginosa M18. J. Bacteriol. 2012;194:2443–2457. doi: 10.1128/JB.00029-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Stock A.M., Robinson V.L., Goudreau P.N. Two-component signal transduction. Annu. Rev. Biochem. 2000;69:183–215. doi: 10.1146/annurev.biochem.69.1.183. [DOI] [PubMed] [Google Scholar]
- 45.Sobrero P., Valverde C. The bacterial protein Hfq: Much more than a mere RNA-binding factor. Crit. Rev. Microbiol. 2012;38:276–299. doi: 10.3109/1040841X.2012.664540. [DOI] [PubMed] [Google Scholar]
- 46.Ohniwa R.L., Muchaku H., Saito S., Wada C., Morikawa K. Atomic force microscopy analysis of the role of major DNA-binding proteins in organization of the nucleoid in Escherichia Coli. PLoS ONE. 2013;8:82. doi: 10.1371/journal.pone.0072954. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.El-Mowafi S.A., Alumasa J.N., Ades S.E., Keiler K.C. Cell-based assay to identify inhibitors of the hfq-sRNA regulatory pathway. Antimicrob. Agents Chemother. 2014;58:5500–5509. doi: 10.1128/AAC.03311-14. [DOI] [PMC free article] [PubMed] [Google Scholar]