Promoter Orientation of Prokaryotic Phase-variable Genes by PCR

Abstract

One major mechanism of phase variable gene expression in prokaryotes is through inversion of the promoter element for a gene or operon. This protocol describes how to detect the promoter orientation of a phase-variable gene by PCR. This protocol, including primer design, is specific to detection of the promoter orientations of hyxR, a LuxR-like response regulator in Extraintestinal Pathogenic Escherichia coli (ExPEC) isolates (Bateman and Seed, 2012); however, this protocol can be generalized to other organisms and genes to discriminate prokaryotic promoter inversions by PCR through size discrimination of the amplification products. Expression of hyxR is regulated through bidirectional phase inversion of the upstream promoter region mediated by a member of the family of site-specific tyrosine recombinases called Fim-like recombinases. The recombinases recognize inverted DNA repeat sequences flanking the promoter and produce a genomic rearrangement, orientating the promoter in favor or disfavor of gene expression.

Materials and Reagents

1. Escherichia coli (E. coli) isolate UTI893

2. Sterile distilled, deionized water (diH₂O)

3. Agarose, molecular biology grade, standard sieve

4. Ethidium Bromide, 1 mg/ml in distilled, deionized water (diH₂O) (or other agent to visualize DNA)

5. Taq polymerase (1 U/µl) with 10× NH₄ buffer (APEX Bioresearch Products, catalog number: 42–409)

6. 10 mM dNTP mix, PCR grade (Life Technologies, catalog number: 18427-013)

7. Tryptone

8. Yeast extract

9. NaCl

10. Tris base

11. Boric acid

12. EDTA (pH 8.0)

13. SDS

14. Glycerol

15. Xylene cyanol

16. Bromophenol blue

17. hyxR phase-specific primers, 100 µM stock solution [Integrated DNA Technologies (IDT)]

    • 5’ – ACTGATAATAACCAGAGGCTTCTT – 3’
    • 5’ – CAGTGATTAACTTTCGAACATATTG – 3’
    • 5’ – GCGAAAGTTAATCACTGGTATGACC – 3’

18. Tris-Borate-EDTA (TBE) (10× stock) (see Recipes)

19. 10× DNA Loading Dye (see Recipes)

20. Luria-Bertani broth (LB) culture medium (Sigma-Aldrich, catalog number: L3022-250G (see Recipes)

21. 2% TBE agarose gel with EtBr (see Recipes)

22. 20 ml 10× DNA Loading dye⁶ (xylene cyanol/bromophenol blue) (see Recipes)

Equipment

1. 37 °C Incubator for bacteria with aeration

2. Thermal cycler (Bio-Rad Laboratories)

3. Gel electrophoresis system (Owl Separation Systems)

4. UV Transilluminator with photo documentation (Bio-Rad Laboratories)

Procedure

1. Start 5 ml overnight culture of E. coli isolate UTI89 (Note 1) in LB at 37 °C with aeration. Culture can be started from a colony on an agar plate or from a −80 °C glycerol stock.

2. Setting up the phase-PCR reaction

   1. Phase PCR was performed using a 1:1:1 mixture of 3 phase primers including 1) an anchor primer outside of the invertible region (primer 1); 2) a phase-specific primer for the OFF orientation (primer 2); and 3) a phase-specific primer for the ON orientation (primer 3).

      • 
      • Reaction mixture (Note 2)
      • 1 µl overnight bacterial culture (template)
      • 2.5 µl of 10× APEX NH₄ buffer (1× final concentration)
      • 0.5 µl of 1 unit/µl APEX Taq polymerase (0.5 unit final concentration)
      • 1.25 µl of 50 mM MgCl₂ (2.5 mM final concentration)
      • 0.1 µl of 100 µM stock of each of 3 primers (0.4 µM final concentration of each primer)
      • 0.5 µl of 10 mM dNTP mix (0.2 mM final concentration)
      • up to 25 µl total volume with sterile diH₂O.
   2. Thermal cycler program:

      94°C for 3 min		× 1 cycle
      94°C for 30 sec		×30 cycles
      54°C for 30 sec
      72°C for 25 sec
      72°C for 6 min		× 1 cycle
      Hold at 4°C

3. Make 50 ml volume of 2% agarose in 1× TBE (see below). Pour gel into casting apparatus.

4. Cover gel completely with 1× TBE (running buffer).

5. Mix 5–10 µl of PCR reaction with 0.5–1.0 µl 10× DNA loading dye (approx. 1× final concentration). Load into wells and run samples at 100–120 V for 45 min to 1 h.

6. Visualize and photograph using a UV gel transilluminator.

7. Mixed phase populations show two bands by PCR, corresponding to the OFF and ON promoter orientations. The OFF orientation gives a 196 bp amplicon vs. a 231 bp amplicon for the ON orientation.

Recipes

1. 1× LB

   • Suspend 20 g in 1 L of distilled water
   • Autoclave for 15 min at 121 °C
   • Final concentration of components (Tryptone 10 g/L, yeast extract 5 g/L, NaCl 5 g/L)
2. 1 L 10× TBE buffer stock (Tris-borate-EDTA)

   • 108 g Tris base
   • 55 g Boric acid
   • 40 ml 0.5 M EDTA (pH 8.0)
   • diH₂O to 1 L
   • Stir until completely dissolved.
3. 1 L 1× TBE buffer (working) (Note 3)

   • 100 ml 10× TBE
   • 900 ml diH₂O
   • Mix well
4. 2% TBE agarose gel with EtBr

   • 2 g agarose per 100 ml 1×
   • TBE Heat in microwave (approx. 2 min) until agarose is dissolved
   • Let stand at room temperature for 15–20 min to cool (you do not want to re-solidify)
   • Add EtBr to a final concentration of 0.1 µg/ml just prior to pouring gel.
5. 20 ml 10× DNA Loading dye (Note 4) (xylene cyanol/bromophenol blue)

   • Add 0.025 g each xylene cyanol and bromophenol blue
   • 1.25 ml 10% SDS
   • 12.5 ml 100% glycerol
   • 6.25 ml H₂O
   • Mix thoroughly and store at room temperature