Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2016 Oct 27;82(22):6664–6671. doi: 10.1128/AEM.02281-16

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

Federico Rosconi a,b,*, Stefan P W de Vries b, Abiyad Baig b,*, Elena Fabiano a, Andrew J Grant b,✉
Editor: M Kivisaarc
PMCID: PMC5086560  PMID: 27590816

ABSTRACT

The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle.

IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria.

INTRODUCTION

Plants rely on beneficial interactions with their microbiota for nutrient availability, growth promotion, and suppression of disease. The plant interior, referred to as the endosphere, has been shown to contain a distinct microbiome that is less diverse than those from the rhizoplane (the root surface) and the rhizosphere (a narrow zone of soil subject to the influence of living roots) (1). Microorganisms that colonize the endosphere are referred to as endophytes (2, 3); these include all microorganisms that for all or part of their lifetimes colonize internal plant tissues (4).

The knowledge of plant-bacterial endophyte interactions at the genetic and molecular levels has increased due to the use of suitable (laboratory-controlled) biological models. A model endophyte is Herbaspirillum seropedicae, a member of the Betaproteobacteria subclass, which includes many plant-associated bacteria such as species of the genera Azoarcus, Burkholderia, and Ralstonia (5). Several characteristics make H. seropedicae a suitable model endophyte (6), i.e., (i) it provides fixed nitrogen for important agroeconomic cultivars, (ii) it is genetically tractable, (iii) it has mechanisms of plant growth promotion other than nitrogen fixation, (iv) it has a wide range of plant hosts, (v) culturable bacteria are not isolated from soil and are isolated only from inside plants (7, 8), and (vi) there are publicly available genome sequences (8). Some isolates of H. seropedicae have been described as being pathogenic in plants, although this may be the result of the host being unable to control colonization, and there have also been reports that it can be an opportunistic pathogen in immunocompromised individuals (9, 10). The most well-studied H. seropedicae strains, SmR1 and Z67, have been tested in different plant species without symptoms of disease (11).

Recently, transcriptomic and proteomic approaches have identified genes and pathways that are regulated during the interactions of H. seropedicae with different plant hosts (12–14). In addition, comparative genomics and metagenomics studies have shown that certain functions, e.g., nutrient transport systems, type IV conjugal DNA-protein transfer secretion systems, plant growth promotion genes, and iron uptake systems, are overrepresented in the genomes of bacterial endophytes, compared to rhizospheric or soil bacteria (4, 15–17). Gene inactivation/deletion studies have shown that lipopolysaccharide (LPS) production is essential for effective H. seropedicae attachment to maize roots (18), and high-affinity iron uptake mechanisms contribute to the competitive fitness of H. seropedicae inside host plants (19).

Compared to gene expression and comparative genomics studies, high-throughput functional analyses of endophyte-plant interactions have lagged. In recent years, there has been much progress in the application of transposon (Tn)-based gene inactivation methods in combination with massively parallel sequencing of Tn insertion sites, e.g., Tn insertion site sequencing (Tn-seq) and related techniques (20–22), which have advanced, and continue to advance, the characterization of bacterium-host interactions.

In this study, we successfully employed in vivo mariner Tn mutagenesis in H. seropedicae strain SmR1 and characterized the resulting Tn mutants by Tn-seq. The resulting data set was used to identify the genes that, upon inactivation, have detrimental effects on fitness during in vitro growth and survival, i.e., essential genes.

MATERIALS AND METHODS

Bacterial strains, media, and growth conditions.

H. seropedicae SmR1 was routinely cultured at 30°C in TY medium (tryptone, 5 g/liter; yeast extract, 3 g/liter; CaCl2, 0.1 g/liter) (5). Escherichia coli strains NEB 5-alpha (New England BioLabs), TransforMax EC100D pir+ (Epicentre), and SM10-λpir were cultured at 37°C in Luria-Bertani (LB) broth (23). Where necessary for selection of plasmids, the medium was supplemented with ampicillin (50 μg/ml), kanamycin (50 μg/ml), or tetracycline (10 μg/ml) as appropriate (24, 25). For selection of H. seropedicae SmR1 Tn mutants, TY medium was supplemented with streptomycin (100 μg/ml) and either kanamycin (200 μg/ml) or tetracycline (10 μg/ml) as appropriate. The bacterial strains and plasmids used in this study are listed in Table 1.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain and plasmid Relevant genotype and/or descriptiona Source or reference
Herbaspirillum seropedicae SmR1 Wild type; spontaneous streptomycin-resistant mutant of strain Z78 5
Escherichia coli
    NEB 5-alpha Subcloning efficiency DH5α-derived competent cells; fhuA2 Δ(argF-lacZ)U169 phoA glnV44 Φ80Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 New England Biolabs
    TransforMax EC100D pir+ Electrocompetent cells constitutively expressing pir gene; F− mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80dlacZΔM15 ΔlacX74 recA1 endA1 araD139 Δ(ara, leu)7697 galU galK λ− rpsL (StrR) nupG pir+(DHFR) Epicentre
    SM10-λpir Donor strain carrying transfer genes of broad host range; IncP-type plasmid RP4, Kmr; thi-1 thr leu tonA lacY supE recA::RP4-2-Tc::Mu pir 23
Plasmids
    pBR322 Cloning vector; Ampr, Tcr 24
    pMiniT Cloning vector; Ampr New England Biolabs
    pFRC002 tetA gene from pBR322 cloned in pMiniT; Ampr, Tcr This work
    pSAM_R1 Suicide mobilizable vector; Ampr, Kmr, himar1-C9 25
    pSAM_R5 tetA gene from pFRC002 cloned in pSAM_R1; Ampr, Tcr This work
a

Amp, ampicillin; Km, kanamycin; Tc, tetracycline.

Recombinant DNA techniques.

Standard methods were used for molecular cloning (26). Chromosomal and plasmid DNA purification, DNA modification, and ligations were performed using commercial kits (from Qiagen, Thermo Scientific, or New England BioLabs), according to the manufacturers' instructions. DNA concentrations were measured using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific). PCR primers were purchased from Sigma-Genosys. Thermal cycling was performed in a GeneAmp PCR System 9700 (PE Applied Biosystems) or T100 thermal cycler (Bio-Rad). Thermal cycling conditions were 96°C for 2 min, 30 cycles of 96°C for 1 min, 55 to 60°C for 1 min, and 72°C for 30 s/kb, and finally extension at 72°C for 5 min.

Generation of Tn mutant libraries.

For construction of Tn mutants, we used either (i) plasmid pSAM_R1 (25), which contained the mariner Tn with the kanamycin resistance gene nptII and the Himar1_C9 transposase gene under the control of the rpoD promoter of the alphaproteobacterium Rhizobium leguminosarum, or (ii) plasmid pSAM_R5, in which we replaced the nptII gene with the tet gene of plasmid pBR322, flanked by mariner-specific inverted repeats. The tetA gene from pBR322 was amplified with primers Tet_FW1_XhoI and Tet_RV1_XbaI (details of the oligonucleotides used in this study are presented in Table 2). PCR amplicons were cloned into pMiniT using the NEB PCR cloning kit (New England BioLabs), generating plasmid pFRC002. This plasmid was digested with XhoI and XbaI (New England BioLabs), and the fragment released was gel purified and cloned into the same restriction enzyme sites of pSAM_R1, generating pSAM_R5. The sequences of these plasmids were confirmed by Sanger sequencing (Source BioScience). Subsequently, the plasmids were transformed into E. coli TransforMax EC100D pir+ (Epicentre).

TABLE 2.

Primer sequences used in this studya

Name Characteristics Sequence (5′ to 3′)
Primers
    Tet_FW1_XhoI For amplification of tetA gene CTCGAGTCTCATGTTTGACAGCTTATCATCG
    Tet_RV1_XbaI For amplification of tetA gene TCTAGAGTTTGCGCATTCACAGTTCTCCG
    Km_RV2 For identification of Tn insertion sites by single-primer PCR CGTGCAATCCATCTTGTTCAATC
Oligonucleotides for Tn-seq
    PBGSF29 ATCACG Adapter primer with ATCACG barcode TTCCCTACACGACGCTCTTCCGATCTATCACGNN
    PBGSF30 ATCACG Adapter primer with ATCACG barcode P-CGTGATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGT-P
    PBGSF29 CGATGT Adapter primer with CGATGT barcode TTCCCTACACGACGCTCTTCCGATCTCGATGTNN
    PBGSF30 CGATGT Adapter primer with CGATGT barcode P-ACATCGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGT-P
    PBGSF29 TGACCA Adapter primer with TGACCA barcode TTCCCTACACGACGCTCTTCCGATCTTGACCANN
    PBGSF30 TGACCA Adapter primer with TGACCA barcode P-TGGTCAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGT-P
    PBGSF29 CTTGTA Adapter primer with CTTGTA barcode TTCCCTACACGACGCTCTTCCGATCTCTTGTANN
    PBGSF30 CTTGTA Adapter primer with CTTGTA barcode P-TACAAGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGT-P
    PBGSF29 CGTACG Adapter primer with CGTACG barcode TTCCCTACACGACGCTCTTCCGATCTCGTACGNN
    PBGSF30 CGTACG Adapter primer with CGTACG barcode P-CGTACGAGATCGGAAGAGCGTCGTGTAGGGAAAGAGT-P
    PBGSF23 GSF amplification primer 1 CAAGCAGAAGACGGCATACGAAGACCGGGGACTTATCATCCAACCTGT
    PBGSF31 GSF amplification primer 2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
a

For the primer sequences, the underlined sequence indicates the restriction enzyme site. For oligonucleotides for Tn-seq, the underlined sequence indicates the barcode sequence for demultiplexing. GSF, genome sequence footprinting (29).

Tn mutagenesis was performed by biparental mating using E. coli SM10-λpir containing pSAM_R1 or pSAM_R5 as a donor strain, as described previously (25). Briefly, 10 ml of a H. seropedicae culture was mixed with 5 ml of E. coli SM10-λpir (containing pSAM_R1 or pSAM_R5), both at an optical density at 600 nm (OD600) of 0.8. Bacterial cells were washed once with phosphate-buffered saline (PBS) (Sigma) and resuspended in 1.5 ml of PBS; 100 μl of this suspension was spotted on TY plates without antibiotics, left to dry, and incubated overnight at 30°C. Bacterial colonies were scraped from the plates and pooled in 10 ml of TY medium. One hundred microliters of this suspension was plated on TY agar with streptomycin, either kanamycin or tetracycline was added (depending on the resistance cassette in the Tn element used), and the plates were incubated overnight at 30°C. Bacterial colonies were scraped from the plates into 2 ml of TY medium per plate and pooled. The cell suspension was diluted in 50 ml of TY medium with the appropriate antibiotics, at an initial density of 1.5 × 107 cells per ml (OD600 of 0.15), and was grown to an OD600 of 0.5, with shaking. Aliquots were mixed with glycerol to a final concentration of 15% and then were frozen at −80°C for future use.

As a quality control, the random insertion of transposons into the chromosome was analyzed using a single-primer PCR amplification approach to map the Tn insertion site, as described previously (27). Briefly, randomly selected colonies were isolated from the first Tn library, genomic DNA was extracted, and the Tn insertion site was amplified by PCR using the primer Km_RV2 (Table 2), followed by Sanger DNA sequencing of the amplicon. The sequence was aligned to the H. seropedicae SmR1 genome to identify the Tn insertion site.

Characterization of Tn mutant libraries by Tn-seq.

Tn mutant libraries were characterized by Tn-seq, essentially as described previously (28, 29). Briefly, genomic DNA from Tn mutant libraries was isolated using the DNeasy blood and tissue kit (Qiagen) but, before the manufacturer's recommendations for Gram-negative bacteria were followed, cells were washed once with 1 M NaCl and once with PBS. Five micrograms of genomic DNA was digested with the restriction enzyme MmeI, and double-stranded Tn-seq DNA adapters with different barcodes were ligated to the restriction fragments. Tn insertion site flanking sequences were amplified by PCR using adapter- and mariner Tn-specific primers, using NEBNext Q5 High-Fidelity DNA polymerase (New England BioLabs). Cleanup of the PCR products was performed using MinElute PCR purification columns (Qiagen), DNA concentrations were measured with a Qubit fluorometer (Life Technologies), and DNA was sequenced using 50-bp single-end sequencing on a HiSeq 2500 Illumina sequencing platform (Genomics Core Facility at Cancer Research UK).

Identification of genes essential for in vitro growth and survival.

Tn-seq Illumina sequence reads were demultiplexed using the FastX toolkit barcode splitter and were analyzed using the ESSENTIALS pipeline (30). The following analysis parameters were used in the ESSENTIALS analysis: sequence reads were aligned with a minimal match of 16 nucleotides, repeat regions were filtered, reads mapping to the 3′ end of the gene were removed, genomic position bias was corrected through Loess normalization, and read counts were normalized with the trimmed mean of M values (TMM) normalization method. In the implemented EdgeR statistical analysis part of ESSENTIALS, the dispersion was estimated with the Cox-Reid profile-adjusted likelihood method and the variance was modeled using common dispersion. To determine the number of unique Tn insertion mutants in each library, a read count cutoff value was derived from Kernel density plots in R, which allow delineation of “true” Tn insertions from “noise” sequencing reads. The distribution of Tn insertions was visualized by plotting the log2 read count for each chromosomal position, using an in-house Perl script. As a measure of gene essentiality, the log2 fold change between the observed and expected sequence reads was calculated for each gene, and a cutoff value was determined as described previously (30). Genes that had no informative TA insertion site flanking sequences (43 genes), i.e., no unique flanking sequences, were excluded from the analysis; for reference, these genes are listed in Table S1 in the supplemental material. Additional selection criteria were as follows: a P value adjusted with the Benjamini-Hochberg method of <0.05 and a probability that the gene was hit by a Tn of >0.95, as calculated using a derivative of Poisson's law, i.e., 1 − eN × ln(1 − f), with N being the number of unique Tn insertion mutants and f representing the number of unique TA flanking sequences in a gene divided by the number of unique TA flanking sequences in the genome. In addition, genes for which no sequence reads were detected and the probability of disruption was >0.95 were considered for further analysis. Analysis of functional class enrichment of candidate genes was performed using Fisher's exact test and was corrected for multiple testing using Q values (31). Genes required for in vitro growth and survival of H. seropedicae were visualized in DNAplotter (32).

Determination of essential gene features.

A homology search of the Database of Essential Genes (DEG) (www.essentialgene.org) was performed using the BLASTP tool. Other analyses (Clusters of Orthologous Groups [COG] category assignment, metabolic pathway description, and prediction of transmembrane domains and signal peptides) were performed with tools of the Integrated Microbial Genomics platform (http://img.jgi.doe.gov) (33).

Accession number(s).

Illumina Tn-seq sequencing data have been deposited in the European Nucleotide Archive (http://www.ebi.ac.uk/ena) and are available under accession number PRJEB15080.

RESULTS AND DISCUSSION

Characterization of H. seropedicae SmR1 Tn mutant libraries.

To identify genes critical for the growth of H. seropedicae, Tn mutant libraries were constructed under nutrient-rich conditions, i.e., in TY medium, using a biparental mating protocol. The in vivo Tn mutagenesis had an efficiency of ∼5 × 10−6 Tn mutants per H. seropedicae recipient cell. A total of six Tn mutant libraries were constructed, with sizes ranging between 24,000 and 140,000 CFU (Table 3).

TABLE 3.

Tn mutant libraries constructed in H. seropedicae SmR1a

Library (antibiotic marker)b Estimated Tn library size (CFU) No. of sequence reads No. (%) of aligned reads No. (%) of insertion site flanking sequences hit in library Average no. of reads/flanking sequence
A (Km) 24,000 14,008,866 10,465,200 (74.7) 26,590 (15.5) 394
B (Km) 55,000 3,046,565 2,491,660 (81.8) 19,038 (11.1) 131
C (Km) 90,000 25,122,546 22,284,725 (88.7) 52,327 (30.5) 426
D (Km) 140,000 20,353,571 18,537,039 (91.1) 50,639 (29.5) 366
E (Tc) 70,000 12,165,012 10,998,288 (90.4) 30,984 (18.0) 355
F (Tc) 50,000 7,775,781 6,969,727 (89.6) 28,492 (16.6) 245
a

The criteria for identification of unique Tn insertion sites are listed in Materials and Methods.

b

Km, kanamycin; Tc, tetracycline.

Tn insertion site sequencing (Tn-seq) was performed using Illumina sequencing. Of the 88,320 potential TA dinucleotide mariner Tn insertion sites in the H. seropedicae SmR1 genome, 56,174 insertion sites (i.e., 63.6% of the total TA sites) were hit by a Tn insertion (Table 3). A cumulative analysis of amalgamating libraries revealed that the number of new unique Tn insertion mutants leveled off at ∼55,000 mutants (Fig. 1A). This suggests that, although we achieved Tn insertions in only ∼64% of the potential TA dinucleotide mariner Tn insertion sites, the maximum empirical number of mutants was obtained with this approach (without the use of much larger libraries). In addition, rarefaction analysis showed that we reached saturation in terms of the number of genes in the H. seropedicae genome that could be mutated (Fig. 1B). Tn insertions were distributed evenly throughout the chromosome, without any apparent evidence of hot spots, with an average of one Tn insertion every 95 bp (Fig. 1C).

FIG 1.

FIG 1

Characterization of H. seropedicae SmR1 Tn mutant libraries. (A) Cumulative numbers of Tn insertions in the different constructed mutant libraries and the numbers of unique Tn insertion mutants obtained. (B) Rarefaction analysis of intragenic Tn insertion positions, indicating near saturation of the number of genes that can be inactivated with a Tn. (C) Circular genome visualization, indicating the genes required for growth and survival in H. seropedicae SmR1.

It is widely assumed that genes with very few, or no, Tn insertions are essential for growth and survival or are underrepresented because their corresponding Tn insertion mutants have a growth defect (20) or they were not inactivated by a Tn element during Tn mutagenesis. To identify the genes required for growth under nutrient-rich conditions, a fold change was calculated between the actual number of sequence reads and the expected number of sequence reads (Fig. 2A); the latter takes into account the number of Tn mutants in the library, the length of the gene, and the number of possible Tn insertion positions (i.e., TA sites) for each gene (30). Of note, 43 genes lacked unique TA insertion site flanking sequences, and the essentiality of those genes could not be accurately addressed; the genes without unique TA flanking sequences are listed in Table S1 in the supplemental material. Analysis revealed that 136 genes had no reads at all and 296 genes showed log2 fold change (actual/expected sequence reads) values below −6.86. Next, to reduce the number of genes falsely identified as essential, we applied a 0.95 probability (calculated with a derivative of Poisson's law) cutoff value that the gene, if possible, was inactivated by a Tn insertion (based on 56,176 unique Tn mutants). Application of this cutoff value excluded 37 genes from the analysis, yielding a total of 395 genes that were found to be essential for in vitro growth and survival of H. seropedicae SmR1 in TY medium (see Table S2 in the supplemental material).

FIG 2.

FIG 2

Identification and characterization of H. seropedicae SmR1 essential genes. (A) Density plot of log2 fold changes (measured reads/expected reads per gene). Black dot, gene essentiality cutoff value. (B) Functional class enrichment analysis of essential genes based on COG categories. Bars, number of essential genes assigned to each COG category, with the number of essential genes over the total number of genes in the COG category displayed to the right of each bar. COG category enrichment was analyzed using Fisher's exact test, with correction for multiple testing using Q values, as a measure of significance representing the false discovery rate (31). *, Q = 0.1; ∗∗, Q = 0.01; ∗∗∗, Q = 0.001.

Essential genes were distributed relatively uniformly across the genome. However, eight regions larger than 100,000 bp were found to be dispensable for growth and survival. The two largest dispensable regions were located between Hsero_2418 and Hsero-4580 (trnL) (202,525 bp) and between Hsero_4426 (glmS) and Hsero_4580 (194,479 bp).

In-depth analysis of the genes required for in vitro growth and survival.

Of the 395 genes identified as being required for growth and survival in TY medium, 22 corresponded to tRNA genes and 1 corresponded to a 23S rRNA gene (Hsero_4734 [rrlC]) (see Table S2 in the supplemental material). The other two 23S rRNA genes, i.e., rrlA (Hsero_0480) and rrlB (Hsero_3882), could not be evaluated for their essentiality as they had no unique TA insertion site flanking sequence (rrlA) or the probability of inactivation was only 0.632 (rrlB). Of the remaining 372 protein-coding genes required for in vitro growth, 346 were assigned a COG identifier. The COG categories significantly enriched among the genes identified as being essential in H. seropedicae are shown in Fig. 2B and included cell cycle control, cell division, and chromosome partitioning (category D); nucleotide transport and metabolism (category F); coenzyme transport and metabolism (category H); translation, ribosomal structure, and biogenesis (category J); replication, recombination, and repair (category L); and cell wall/membrane/envelope biogenesis (category M). The COG category of RNA processing and modification (category A) had only one representative, the product of the gene Hsero_1434, which is predicted to encode an oligoribonuclease. A total of 1,624 protein-coding genes containing transmembrane domains or signal peptides are present in the genome, and we identified 72 of those as being essential; 64 were assigned to one or more COG categories. As expected, the most represented COG category in this subset was cell wall/membrane/envelope biogenesis (category M).

Essential metabolic pathways.

In silico analysis has revealed that H. seropedicae cannot utilize l-histidine, l-arginine, or l-lysine as carbon sources (8, 34). The l-histidine and l-lysine degradation pathways are incomplete, and no specific l-arginine transporter has been identified. In agreement with these findings, our Tn-seq data indicate that the genes involved in the biosynthesis pathways of these proteinogenic amino acids are essential. In addition, and to our knowledge not previously reported, both serine and glutamine synthesis seem to be essential for H. seropedicae growth in TY medium. In the case of glutamine, glnA (encoding glutamine synthetase) appears to be essential. Together with the glutamine oxoglutarate aminotransferase (GOGAT) enzyme, GlnA is the main route of assimilation of NH4+ in bacteria (35, 36) and, considering TY medium as a nitrogen-rich medium, we assume that GlnA activity should be low (36) and therefore nonessential under these conditions. GlnA activity and glnA expression were shown previously to be reduced but not absent when nitrogen levels were in excess of 20 mM NH4+ (37). No reduction in the expression of this gene or the activity of the enzyme was observed in the presence of glutamate (37). It is possible that nitrogen, from amino acids and peptides, may be more abundant in TY medium; hence, glnA is probably expressed and GlnA is active.

Another candidate essential gene related to nitrogen metabolism is ntrX (Hsero_0069), which encodes a two-component response regulator protein. Interestingly, a comparative genomics study reported that this gene is overrepresented in endophyte genomes, compared to the genomes of phytopathogens and rhizospheric bacteria (4).

We determined several genes encoding proteins in the pentose phosphate and glycolysis pathways to be essential. Three enzymes of the citric acid (tricarboxylic acid [TCA]) cycle, i.e., aconitate hydratase (acnA [Hsero_2979]), 2-oxoglutarate dehydrogenase components E1 (sucA [Hsero_2969]) and E3 (lpdA [Hsero_2967]), and two subunits of succinate dehydrogenase (sdhB [Hsero_2972] and sdhC [Hsero_2974]), were essential. Hsero_2971 (annotated as hypothetical) was also found to be essential; this gene has homology to sdhE, the product of which assists in the covalent attachment of flavin adenine dinucleotide (FAD) to SdhA (the product of the gene Hsero_2973) (38), which was not identified as essential.

Functional redundancy between genes precludes essentiality of central metabolic pathways; however, two homologous genes are not always redundant in their functions. In the case of the already mentioned acnA gene (Hsero_2979), which codes for the TCA cycle enzyme aconitate hydratase, H. seropedicae contains in its genome another gene annotated as acnA (Hsero_2283), with 41.89% identity. However, a mutant of that gene was identified in a Tn mutant library previously described for the closely related strain H. seropedicae Z67 (39); this suggests that acnA (Hsero_2283) does not participate in the TCA cycle. Homologs of iscA (Hsero_3845 and Hsero_3142), a gene involved in Fe-S cluster biogenesis, were identified as essential genes. The two genes belong to the same COG0316, pfam01521, and TIGR00049 families. Their essentiality indicates that they are not functionally redundant. This suggests the existence of different Fe-S biogenesis machineries for different proteins.

The hfq gene (Hsero_2948), encoding an RNA chaperone, is also essential for H. seropedicae SmR1 under the conditions studied. Several attempts to construct a defined deletion mutant of this gene were unsuccessful (Emmanuel de Souza, personal communication). The Hsero_4268 gene encodes a plasmid maintenance system antidote protein that we identified as being essential in our analysis. Transcriptome sequencing (RNA-seq) expression analysis showed that this gene and its toxin counterpart gene, Hsero_4269, were actively expressed in minimal medium (13), which indicates that there is an active toxin-antitoxin system in H. seropedicae SmR1.

Critical reflection on identified candidate essential genes.

In this study, the Tn mutants were grown in pools. Consequently, Tn mutants with reduced fitness (i.e., slowly growing/dividing bacteria) would be present at lower abundance in the pools (reflected by lower read counts for Tn flanking sequences), and the corresponding genes could be tagged as essential in our analysis, i.e., the number of sequence reads per gene would fall below the essentiality cutoff value (21).

As part of our preliminary studies of the Tn libraries, we performed Sanger sequencing to identify the Tn insertion site in eight randomly selected mutants. Through this, we identified a mutant in which the Tn was inserted in the dadX gene (Hsero_2150). The enzyme encoded by this gene is predicted to catalyze the conversion of l-alanine to d-alanine, which then is incorporated into the peptidoglycan biosynthesis pathway by the d-alanine–d-alanine ligase protein (encoded by the gene ddlB [Hsero_0338]). Interestingly, according to our Tn-seq data, dadX appears to be essential in H. seropedicae (see Table S2 in the supplemental material). We hypothesized that d-alanine may be synthesized via an alternative pathway at a lower rate, allowing recovery of the mutant as a single colony but not after growth in a Tn mutant pool, during which there is competition between Tn mutants. We hypothesized that the alternative pathway could rely on Hsero_4778, which is predicted to encode d-alanine transaminase (EC:2.6.1.21), which catalyzes the interconversion of pyruvate and d-glutamate to d-alanine and 2-oxoglutarate.

Comparative analysis of candidate essential genes and genes in other bacteria.

To identify orthologs of the 372 (including dadX) protein-encoding candidate essential genes in H. seropedicae, a BLASTP search was performed (E value cutoff of 1 × 10−5, with >30% sequence identity over >50% of the sequence length) against essential genes in 39 bacterial strains of 28 bacterial species present in the DEG (accessed in July 2016) (40). A total of 347 H. seropedicae SmR1 essential genes had at least one essential ortholog among the bacterial species present in the DEG. The 347 H. seropedicae SmR1 genes had 8,472 orthologs in the database (see Table S3 in the supplemental material). The high percentage of genes identified as essential in our study that were also described as being essential in other bacterial species reinforces the quality of our candidate essential gene set.

A total of 25 genes were uniquely essential in H. seropedicae SmR1, i.e., no essential orthologs were found in the DEG (see Table S4 in the supplemental material). Of the 20 essential proteins annotated as hypothetical, 14 are essential only in H. seropedicae. Three are proteins related to secretion systems; Hsero_0751 and Hsero_0943 are related to the type VI secretion system and Hsero_0804 is related to the type III secretion system of H. seropedicae. Type VI secretion systems are important for bacterial competition through contact-dependent killing of competitors (41). RNA-seq analysis of H. seropedicae grown in minimal medium or attached to maize roots showed that genes encoding the type III secretion system were not expressed in either case (13). This might suggest that Hsero_0804 is essential conditionally, i.e., when the bacteria are grown in nutrient-rich media.

Five of the genes uniquely essential in H. seropedicae code for transcriptional regulators, three of which belong to the transcription COG category. Hsero_1027 is homologous to the global regulator gene pecS from the phytopathogen Dickeya dadantii 33937, which is reported to repress the premature expression of virulence genes during the first stage of plant infection, when D. dadantii has to colonize the plant apoplast without provoking symptoms (42). A D. dadantii pecS mutant is hypervirulent (43). The expression of pecS is downregulated (fold change of −12.24; P = 9.39 × 10−9) in H. seropedicae attached to maize roots, implying that the genes repressed by PecS are expressed and may be important under those conditions (13). However, the products of those genes may be toxic when expressed under nutrient-rich conditions. The genes Hsero_1086, Hsero_2104, and Hsero_2356 code for transcriptional regulators with lambda-repressor-like, DNA-binding domains. Hsero_2356 is part of a locus (Hsero_2351 to Hsero_2371) that has a lower GC content (56% GC) than the rest of the SmR1 genome (63% GC). Interestingly, RNA-seq expression profiling of bacteria grown in minimal medium as well as bacteria attached to maize roots showed that genes of this locus (Hsero_2351 to Hsero_2356) were highly expressed, while the genes downstream of this genomic locus were not (13). We hypothesize that the essentiality of these three regulators could be due to repression of genes that might be lethal under the growth conditions used in our study. The gene Hsero_4425 is annotated as a member of the AsnC family of transcription-regulating proteins. It is divergently transcribed from the essential gene glmS (Hsero_4426). Homologs of glmS have been described as essential for 25 other bacterial species, and the arrangement of these two genes is conserved in many proteobacteria (data not shown). It is possible that the essentiality of Hsero_4425 in H. seropedicae SmR1 is related to the expression of glmS. Finally, the essential hypothetical genes Hsero_2418 and Hsero_3074 are both adjacent to genes coding for homologs of the RNA polymerase sigma E factor protein RpoE (Hsero_2419 and Hsero_3073). Both genes have predicted transmembrane helices; in the case of Hsero_2418, it belongs to the pFAM PF13490 family, i.e., a putative zinc finger found in several anti-sigma factor proteins. Homologs of these two genes are always linked to RNA polymerase sigma factors in other bacteria. We hypothesize that the essentiality of these genes in TY medium could be due to regulation of genes activated by the cognate sigma factors.

H. seropedicae candidate essential genes with described essential orthologs in only one or two of the strains in the DEG are indicated in Table S3 in the supplemental material. Interestingly, the gene Hsero_4295, which codes for an outer membrane porin, has essential orthologs only in the two betaproteobacteria Burkholderia thailandensis E264 and Burkholderia pseudomallei K96243 (44, 45), for which the essential gene sets have been described. Further, the gene Hsero_4295 was reported to be upregulated when H. seropedicae was attached to wheat roots but downregulated when H. seropedicae was attached to maize roots (12, 13), suggesting that this gene may be involved in host specificity. Six of the genes described in Table S3 were found to be essential only in H. seropedicae and in the soil inhabitant B. thailandensis. This subset of genes might indicate essential systems for Burkholderiales.

Conclusions.

In this study, we have developed functional genomic techniques and resources for the model endophyte H. seropedicae that had not used previously in this species or in other bacterial endophytes. We have generated large comprehensive Tn libraries, and we have characterized the Tn insertion sites using next-generation sequencing (Tn-seq). These nearly saturated Tn libraries allowed us to perform robust essentiality analysis, and the results obtained are consistent with those reported for other bacteria. Our analysis of H. seropedicae Tn libraries from TY medium has enabled us to define the genes that are essential under those growth conditions. The results obtained enabled us to describe, at a functional level, the mechanisms of growth of H. seropedicae, including synthetic pathways, toxins, and regulatory mechanisms. Furthermore, these Tn libraries represent a valuable resource for the endophyte research community and will facilitate studies into the comprehensive assessment of the genetic mechanisms of the endophytic lifestyle of H. seropedicae, i.e., attachment to the root surface, internal colonization of the plant, and survival of the bacteria inside plants.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

H. seropedicae SmR1 was kindly provided by Ray Dixon. Plasmid pSAM_R1 was kindly provided by Chris Yost. We thank Roy Chaudhuri for sharing the Perl script for read count mapping. We thank Aldert Zomer for providing R scripts for the rarefaction analysis.

The funders had no role in the study design, data collection and interpretation, or the decision to submit the work for publication.

We have no conflicting financial interests.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.02281-16.

REFERENCES

  • 1.Edwards J, Johnson C, Santos-Medellin C, Lurie E, Podishetty NK, Bhatnagar S, Eisen JA, Sundaresan V. 2015. Structure, variation, and assembly of the root-associated microbiomes of rice. Proc Natl Acad Sci U S A 112:E911–E920. doi: 10.1073/pnas.1414592112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Coleman-Derr D, Tringe SG. 2014. Building the crops of tomorrow: advantages of symbiont-based approaches to improving abiotic stress tolerance. Front Microbiol 5:283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Mendes R, Garbeva P, Raaijmakers JM. 2013. The rhizosphere microbiome: significance of plant beneficial, plant pathogenic, and human pathogenic microorganisms. FEMS Microbiol Rev 37:634–663. doi: 10.1111/1574-6976.12028. [DOI] [PubMed] [Google Scholar]
  • 4.Hardoim PR, van Overbeek LS, Berg G, Pirttila AM, Compant S, Campisano A, Doring M, Sessitsch A. 2015. The hidden world within plants: ecological and evolutionary considerations for defining functioning of microbial endophytes. Microbiol Mol Biol Rev 79:293–320. doi: 10.1128/MMBR.00050-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Baldani J, Baldani VLD, Seldin Döbereiner LJ. 1986. Characterization of Herbaspirillum seropedicae gen. nov., sp. nov., a root-associated nitrogen-fixing bacterium. Int J Syst Bacteriol 36:86–93. [Google Scholar]
  • 6.Tripplett EW. 2007. Prospects for significant nitrogen fixation in grasses from bacterial endophytes, p 303–314. In Elmerich C, Newton WE (ed), Associative and endophytic nitrogen-fixing bacteria and cyanobacterial associations. Springer Netherlands, Dordrecht, Netherlands. [Google Scholar]
  • 7.Bertani I, Abbruscato P, Piffanelli P, Subramoni S, Venturi V. 2016. Rice bacterial endophytes: isolation of a collection, identification of beneficial strains and microbiome analysis. Environ Microbiol Rep 8:388–398. doi: 10.1111/1758-2229.12403. [DOI] [PubMed] [Google Scholar]
  • 8.Pedrosa FO, Monteiro RA, Wassem R, Cruz LM, Ayub RA, Colauto NB, Fernandez MA, Fungaro MH, Grisard EC, Hungria M, Madeira HM, Nodari RO, Osaku CA, Petzl-Erler ML, Terenzi H, Vieira LG, Steffens MB, Weiss VA, Pereira LF, Almeida MI, Alves LR, Marin A, Araujo LM, Balsanelli E, Baura VA, Chubatsu LS, Faoro H, Favetti A, Friedermann G, Glienke C, Karp S, Kava-Cordeiro V, Raittz RT, Ramos HJ, Ribeiro EM, Rigo LU, Rocha SN, Schwab S, Silva AG, Souza EM, Tadra-Sfeir MZ, Torres RA, Dabul AN, Soares MA, Gasques LS, Gimenes CC, Valle JS, Ciferri RR, Correa LC, et al. 2011. Genome of Herbaspirillum seropedicae strain SmR1, a specialized diazotrophic endophyte of tropical grasses. PLoS Genet 7:e1002064. doi: 10.1371/journal.pgen.1002064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Suwantarat N, Adams LTL, Romagnoli M, Carroll KC. 2015. Fatal case of Herbaspirillum seropedicae bacteremia secondary to pneumonia in an end-stage renal disease patient with multiple myeloma. Diagn Microbiol Infect Dis 82:331–333. doi: 10.1016/j.diagmicrobio.2015.04.011. [DOI] [PubMed] [Google Scholar]
  • 10.Ziga ED, Druley T, Burnham CA. 2010. Herbaspirillum species bacteremia in a pediatric oncology patient. J Clin Microbiol 48:4320–4321. doi: 10.1128/JCM.01479-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Monteiro RA, Balsanelli E, Wassem R, Marin AM, Brusamarello-Santos LCC, Schmidt MA, Tadra-Sfeir MZ, Pankievicz VCS, Cruz LM, Chubatsu LS. 2012. Herbaspirillum-plant interactions: microscopical, histological and molecular aspects. Plant Soil 356:175–196. doi: 10.1007/s11104-012-1125-7. [DOI] [Google Scholar]
  • 12.Pankievicz VC, Camilios-Neto D, Bonato P, Balsanelli E, Tadra-Sfeir MZ, Faoro H, Chubatsu LS, Donatti L, Wajnberg G, Passetti F, Monteiro RA, Pedrosa FO, Souza EM. 2016. RNA-seq transcriptional profiling of Herbaspirillum seropedicae colonizing wheat (Triticum aestivum) roots. Plant Mol Biol 90:589–603. doi: 10.1007/s11103-016-0430-6. [DOI] [PubMed] [Google Scholar]
  • 13.Balsanelli E, Tadra-Sfeir MZ, Faoro H, Pankievicz VC, de Baura VA, Pedrosa FO, de Souza EM, Dixon R, Monteiro RA. 2016. Molecular adaptations of Herbaspirillum seropedicae during colonization of the maize rhizosphere. Environ Microbiol 18:2343–2356. doi: 10.1111/1462-2920.12887. [DOI] [PubMed] [Google Scholar]
  • 14.Alberton D, Muller-Santos M, Brusamarello-Santos LC, Valdameri G, Cordeiro FA, Yates MG, de Oliveira Pedrosa F, de Souza EM. 2013. Comparative proteomics analysis of the rice roots colonized by Herbaspirillum seropedicae strain SmR1 reveals induction of the methionine recycling in the plant host. J Proteome Res 12:4757–4768. doi: 10.1021/pr400425f. [DOI] [PubMed] [Google Scholar]
  • 15.Malfanova N, Lugtenberg BJJ, Berg G. 2013. Bacterial endophytes: who and where, and what are they doing there?, p 391–403. In de Bruijn FJ. (ed), Molecular microbial ecology of the rhizosphere. John Wiley & Sons, Inc., Hoboken, NJ. [Google Scholar]
  • 16.Mitter B, Petric A, Shin MW, Chain PS, Hauberg-Lotte L, Reinhold-Hurek B, Nowak J, Sessitsch A. 2013. Comparative genome analysis of Burkholderia phytofirmans PsJN reveals a wide spectrum of endophytic lifestyles based on interaction strategies with host plants. Front Plant Sci 4:120. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Sessitsch A, Hardoim P, Doring J, Weilharter A, Krause A, Woyke T, Mitter B, Hauberg-Lotte L, Friedrich F, Rahalkar M, Hurek T, Sarkar A, Bodrossy L, van Overbeek L, Brar D, van Elsas JD, Reinhold-Hurek B. 2012. Functional characteristics of an endophyte community colonizing rice roots as revealed by metagenomic analysis. Mol Plant Microbe Interact 25:28–36. doi: 10.1094/MPMI-08-11-0204. [DOI] [PubMed] [Google Scholar]
  • 18.Balsanelli E, Serrato RV, de Baura VA, Sassaki G, Yates MG, Rigo LU, Pedrosa FO, de Souza EM, Monteiro RA. 2010. Herbaspirillum seropedicae rfbB and rfbC genes are required for maize colonization. Environ Microbiol 12:2233–2244. [DOI] [PubMed] [Google Scholar]
  • 19.Rosconi F, Trovero MF, de Souza EM, Fabiano E. 2016. Serobactins-mediated iron acquisition systems optimize competitive fitness of Herbaspirillum seropedicae inside rice plants. Environ Microbiol 18:2523–2533. doi: 10.1111/1462-2920.13202. [DOI] [PubMed] [Google Scholar]
  • 20.Kwon YM, Ricke SC, Mandal RK. 2016. Transposon sequencing: methods and expanding applications. Appl Microbiol Biotechnol 100:31–43. doi: 10.1007/s00253-015-7037-8. [DOI] [PubMed] [Google Scholar]
  • 21.Barquist L, Boinett CJ, Cain AK. 2013. Approaches to querying bacterial genomes with transposon-insertion sequencing. RNA Biol 10:1161–1169. doi: 10.4161/rna.24765. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.van Opijnen T, Camilli A. 2013. Transposon insertion sequencing: a new tool for systems-level analysis of microorganisms. Nat Rev Microbiol 11:435–442. doi: 10.1038/nrmicro3033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Miller VL, Mekalanos JJ. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 170:2575–2583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bolivar F, Rodriguez RL, Greene PJ, Betlach MC, Heyneker HL, Boyer HW, Crosa JH, Falkow S. 1977. Construction and characterization of new cloning vehicle. II. A multipurpose cloning system. Gene 2:95–113. doi: 10.1016/0378-1119(77)90000-2. [DOI] [PubMed] [Google Scholar]
  • 25.Perry BJ, Yost CK. 2014. Construction of a mariner-based transposon vector for use in insertion sequence mutagenesis in selected members of the Rhizobiaceae. BMC Microbiol 14:298. doi: 10.1186/s12866-014-0298-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sambrook J, Russell DW. 2001. Molecular cloning, 3rd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 27.Karlyshev AV, Pallen MJ, Wren BW. 2000. Single-primer PCR procedure for rapid identification of transposon insertion sites. Biotechniques 28:1078–1082. [DOI] [PubMed] [Google Scholar]
  • 28.van Opijnen T, Lazinski DW, Camilli A. 2014. Genome-wide fitness and genetic interactions determined by Tn-seq, a high-throughput massively parallel sequencing method for microorganisms. Curr Protoc Mol Biol 106:7.16.1–7.16.24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Burghout P, Zomer A, van der Gaast-de Jongh CE, Janssen-Megens EM, Francoijs KJ, Stunnenberg HG, Hermans PW. 2013. Streptococcus pneumoniae folate biosynthesis responds to environmental CO2 levels. J Bacteriol 195:1573–1582. doi: 10.1128/JB.01942-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zomer A, Burghout P, Bootsma HJ, Hermans PWM, van Hijum SA. 2012. ESSENTIALS: software for rapid analysis of high throughput transposon insertion sequencing data. PLoS One 7:e43012. doi: 10.1371/journal.pone.0043012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Storey JD, Tibshirani R. 2003. Statistical significance for genomewide studies. Proc Natl Acad Sci U S A 100:9440–9445. doi: 10.1073/pnas.1530509100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Carver T, Thomson N, Bleasby A, Berriman M, Parkhill J. 2009. DNAPlotter: circular and linear interactive genome visualization. Bioinformatics 25:119–120. doi: 10.1093/bioinformatics/btn578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Markowitz VM, Chen IM, Palaniappan K, Chu K, Szeto E, Grechkin Y, Ratner A, Anderson I, Lykidis A, Mavromatis K, Ivanova NN, Kyrpides NC. 2010. The integrated microbial genomes system: an expanding comparative analysis resource. Nucleic Acids Res 38:D382–D390. doi: 10.1093/nar/gkp887. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Klassen G, Pedrosa FO, Souza EM, Funayama S, Rigo LU. 1997. Effect of nitrogen compounds on nitrogenase activity in Herbaspirillum seropedicae SMR1. Can J Microbiol 43:887–891. doi: 10.1139/m97-129. [DOI] [Google Scholar]
  • 35.Suzuki A, Knaff DB. 2005. Glutamate synthase: structural, mechanistic and regulatory properties, and role in the amino acid metabolism. Photosynth Res 83:191–217. doi: 10.1007/s11120-004-3478-0. [DOI] [PubMed] [Google Scholar]
  • 36.Chubatsu LS, Monteiro RA, de Souza EM, de Oliveira MAS, Yates MG, Wassem R, Bonatto AC, Huergo LF, Steffens MBR, Rigo LU, Pedrosa FDO. 2012. Nitrogen fixation control in Herbaspirillum seropedicae. Plant Soil 356:197–207. doi: 10.1007/s11104-011-0819-6. [DOI] [Google Scholar]
  • 37.Persuhn DC, Souza EM, Steffens MB, Pedrosa FO, Yates MG, Rigo LU. 2000. The transcriptional activator NtrC controls the expression and activity of glutamine synthetase in Herbaspirillum seropedicae. FEMS Microbiol Lett 192:217–221. doi: 10.1111/j.1574-6968.2000.tb09385.x. [DOI] [PubMed] [Google Scholar]
  • 38.McNeil MB, Hampton HG, Hards KJ, Watson BN, Cook GM, Fineran PC. 2014. The succinate dehydrogenase assembly factor, SdhE, is required for the flavinylation and activation of fumarate reductase in bacteria. FEBS Lett 588:414–421. doi: 10.1016/j.febslet.2013.12.019. [DOI] [PubMed] [Google Scholar]
  • 39.Rosconi F, Souza EM, Pedrosa FO, Platero RA, Gonzalez C, Gonzalez M, Batista S, Gill PR, Fabiano ER. 2006. Iron depletion affects nitrogenase activity and expression of nifH and nifA genes in Herbaspirillum seropedicae. FEMS Microbiol Lett 258:214–219. doi: 10.1111/j.1574-6968.2006.00218.x. [DOI] [PubMed] [Google Scholar]
  • 40.Luo H, Lin Y, Gao F, Zhang CT, Zhang R. 2014. DEG 10, an update of the Database of Essential Genes that includes both protein-coding genes and noncoding genomic elements. Nucleic Acids Res 42:D574–D580. doi: 10.1093/nar/gkt1131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Dong TG, Ho BT, Yoder-Himes DR, Mekalanos JJ. 2013. Identification of T6SS-dependent effector and immunity proteins by Tn-seq in Vibrio cholera. Proc Natl Acad Sci U S A 110:2623–2628. doi: 10.1073/pnas.1222783110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Mhedbi-Hajri N, Malfatti P, Pedron J, Gaubert S, Reverchon S, Van Gijsegem F. 2011. PecS is an important player in the regulatory network governing the coordinated expression of virulence genes during the interaction between Dickeya dadantii 3937 and plants. Environ Microbiol 13:2901–2914. doi: 10.1111/j.1462-2920.2011.02566.x. [DOI] [PubMed] [Google Scholar]
  • 43.Hommais F, Oger-Desfeux van Gijsegem CF, Castang S, Ligori S, Expert D, Nasser W, Reverchon S. 2008. PecS is a global requlator of the symptomatic phase in phytopathogenic bacterium Erwinia chrysanthemi 3937. J Bacteriol 190:7508–7522. doi: 10.1128/JB.00553-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Baugh L, Gallagher LA, Patrapuvich R, Clifton MC, Gardberg AS, Edwards TE, Armour B, Begley DW, Dieterich SH, Dranow DM, Abendroth J, Fairman JW, Fox D III, Staker BL, Phan I, Gillespie A, Choi R, Nakazawa-Hewitt S, Nguyen MT, Napuli A, Barrett L, Buchko GW, Stacy R, Myler PJ, Stewart LJ, Manoil C, Van Voorhis WC. 2013. Combining functional and structural genomics to sample the essential Burkholderia structome. PLoS One 8:e53851. doi: 10.1371/journal.pone.0053851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Moule MG, Hemsley CM, Seet Q, Guerra-Assuncao JA, Lim J, Sarkar-Tyson M, Clark TG, Tan PB, Titball RW, Cuccui J, Wren BW. 2014. Genome-wide saturation mutagenesis of Burkholderia pseudomallei K96243 predicts essential genes and novel targets for antimicrobial development. mBio 5:e00926-13. doi: 10.1128/mBio.00926-13. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES