Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2016 Oct 27;82(22):6768–6778. doi: 10.1128/AEM.01908-16

Expression of Surface Protein LapB by a Wide Spectrum of Listeria monocytogenes Serotypes as Demonstrated with Anti-LapB Monoclonal Antibodies

Teela Boivin a,b, Cathie Elmgren a, Brian W Brooks a, Hongsheng Huang a, Franco Pagotto b,c, Min Lin a,b,✉
Editor: D W Schaffnerd
PMCID: PMC5086570  PMID: 27613687

ABSTRACT

Protein antigens expressed on the surface of all strains of Listeria monocytogenes and absent from nonpathogenic Listeria spp. are presumably useful targets for pathogen identification, detection, and isolation using specific antibodies (Abs). To seek such surface proteins expressed in various strains of L. monocytogenes for diagnostic applications, we focused on a set of surface proteins known to be involved or putatively involved in L. monocytogenes virulence and identified Listeria adhesion protein B (LapB) as a candidate based on the bioinformatics analysis of whole-genome sequences showing that the gene coding for LapB was present in L. monocytogenes strains and absent from strains of other Listeria spp. Immunofluorescence microscopy (IFM), performed with rabbit polyclonal antibodies against the recombinant LapB protein (rLapB) of L. monocytogenes serotype 4b strain L10521, confirmed expression of LapB on the surface. A panel of 48 mouse monoclonal antibodies (MAbs) to rLaB was generated, and 7 of them bound strongly to the surface of L. monocytogenes cells as demonstrated using IFM. Further characterization of these 7 anti-LapB MAbs, using an enzyme-linked immunosorbent assay (ELISA), revealed that 6 anti-LapB MAbs (M3484, M3495, M3500, M3509, M3517, and M3519) reacted strongly with 46 (86.8%) of 53 strains representing 10 of the 12 serotypes tested (1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4ab, 4b, 4d, and 4e). These results indicate that LapB, together with companion anti-LapB MAbs, can be targeted as a biomarker for the detection and isolation of various L. monocytogenes strains from contaminated foods.

IMPORTANCE Strains of L. monocytogenes are traditionally grouped into serotypes. Identification of a surface protein expressed in all or the majority of at least 12 serotypes would aid in the development of surface-binding monoclonal antibodies (MAbs) for detection and isolation of L. monocytogenes from foods. Bioinformatics analysis revealed that the gene coding for Listeria adhesion protein B (LapB), a surface protein involved in L. monocytogenes virulence, was present in L. monocytogenes strains and absent from other Listeria spp. Polyclonal antibodies against recombinant LapB (rLapB) detected the exposed epitopes on the surface of L. monocytogenes. Production and extensive assessment of 48 MAbs to rLapB showed that 6 anti-LapB MAbs (M3484, M3495, M3500, M3509, M3517, and M3519) detected the expression of LapB in a wide range of L. monocytogenes isolates representing 10 of 12 serotypes tested, suggesting that LapB, together with specific MAbs, can be targeted as a biomarker for pathogen detection and isolation.

INTRODUCTION

The Gram-positive bacterium Listeria monocytogenes is an intracellular pathogen that can cause a severe and life-threatening illness referred to as listeriosis in humans (1). This organism is ubiquitous in nature, is commonly found in water, soil, and vegetation, and can survive in harsh environments (2), making foods vulnerable to pathogen contamination during harvesting and/or processing. Consumption of contaminated foods is the most common route of transmission of L. monocytogenes to humans, posing an extremely high risk to newborns, the elderly, pregnant women, and immunocompromised individuals. Although the incidence of listeriosis is low, its high mortality rate of up to 50% (3, 4, 5, 6) continues to make L. monocytogenes a serious foodborne pathogen. Recent outbreaks of listeriosis in Canada, linked to contaminated ready-to-eat meat products resulting in 22 deaths (http://news.gc.ca/web/article-en.do?nid=468909), and in the United States, attributed to cantaloupes causing 33 deaths (http://www.cdc.gov/listeria/outbreaks/cantaloupes-jensen-farms/082712/index.html), highlight the importance of enhancing the capability to detect and identify this pathogen in food chains.

L. monocytogenes belongs to the genus of Listeria, in which 17 species are recognized (7): L. monocytogenes, L. innocua, L. ivanovii, L. grayi, L. seeligeri, L. welshimeri, and the recently described L. marthii, L. rocourtii, L. fleischmannii, L. weihenstephanensis, L. floridensis, L. aquatica, L. cornellensis, L. riparia, L. grandensis, L. booriae, and L. newyorkensis. Only strains of L. monocytogenes and L. ivanovii are considered to be pathogenic, with L. ivanovii mainly infecting animals. Although atypical strains of L. innocua contain some virulence genes specific to L. monocytogenes (8, 9), there is no evidence that they are pathogenic. Conventional procedures for the isolation, detection, and identification of L. monocytogenes from food and environmental samples are laborious and time-consuming, involving primary and secondary culture enrichment followed by plating on selective agar and biochemical and serological tests for confirmation, which can take 5 to 10 days to complete (10, 11). Although molecular methods such as PCR are available to expedite detection and identification, these methods are often hampered by inhibitory substances and a low number of target bacteria present in food samples and are thus frequently dependent on culture enrichment of the target or the availability of pure cultures (12). Because of these drawbacks, L. monocytogenes cells must, in many cases, be separated and concentrated from sample matrices prior to employing molecular detection methods. The lack of rapid and effective methods for L. monocytogenes isolation from food samples forms a major obstacle to the use of molecular detection and identification technologies designed to reduce the turnaround time from sampling to obtaining test results.

Antibody (Ab)-based methods offer means for isolation and detection of L. monocytogenes that are faster than traditional methods (10, 13, 14) but face a considerable challenge, as at least 12 L. monocytogenes serotypes with antigenic variations are recognized (15–17). Monoclonal antibodies (MAbs) which bind specifically to strains of all L. monocytogenes serotypes and which do not cross-react with nonpathogenic Listeria spp. and other bacteria are still being sought for use in the development of rapid and reliable immunological tools for the isolation, detection, and identification of this pathogen. One strategy for the development of L. monocytogenes-specific MAbs is that of identifying surface proteins that are expressed by all serotype strains of L. monocytogenes grown in enrichment culture and targeting these proteins for the development of such antibodies.

Listeria species adhesion protein B (LapB) is a L. monocytogenes LPXTG surface protein (Lmo1666) that is absent from nonpathogenic species and is one of the virulence adhesion molecules involved in entry of L. monocytogenes into eukaryotic cells (18). The aim of the present study was to investigate the expression of LapB in L. monocytogenes strains in a wide range of serotypes by developing and using MAbs against this protein.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

Escherichia coli DH5α was used as a host strain for molecular cloning. E. coli Rosetta (DE3)/pLysS was used as a protein expression host. E. coli strains were grown on Luria-Bertani (LB) agar or in LB broth supplemented as required with 50 μg/ml kanamycin at 37°C overnight. Listeria strains (Table 1) were grown on brain heart infusion (BHI) agar or in BHI broth at 37°C overnight. Listeria cell concentrations were determined using an optical density at 620 nm (OD620) of 0.61 (equivalent to 1 × 109 cells/ml) and confirmed by plating (19). E. coli O157:H7, E. coli American Type Culture Collection (ATCC) 25922, Salmonella, and Campylobacter strains were cultured and quantified for cell concentrations as described previously (19).

TABLE 1.

Number of strains of L. monocytogenes and other organisms grown in brain heart infusion broth that were positive on ELISA with selected MAbs

Organism Serotype Total no. of strains No. (%) of strains positivea on ELISA with indicated MAb or mean OD414 ± SD
M3484 M3495 M3500 M3509 M3517 M3519 M3524
L. monocytogenes
    Lineage I 1/2b 9 9 9 9 9 9 9 7
3b 2 2 2 2 2 2 2 2
3c 1 1 1 1 1 1 1 0
4ab 2 2 2 2 2 2 2 2
4b 10 10 10 10 10 10 10 10
4d 1 1 1 1 1 1 1 1
4e 2 1 1 1 1 1 1 1
Total 27 26 (96.3) 26 (96.3) 26 (96.3) 26 (96.3) 26 (96.3) 26 (96.3) 23 (85.2)
Mean OD414 ± SDb 1.6 ± 0.5 1.5 ± 0.5 1.4 ± 0.5 1.2 ± 0.4 1.6 ± 0.5 1.4 ± 0.4 0.4 ± 0.2
    Lineage II 1/2a 10 10 9 9 9 9 9 1
1/2c 5 5 5 5 5 5 5 0
3a 6 6 6 6 6 6 6 0
Total 21 21 (100) 20 (95.2) 20 (95.2) 20 (95.2) 20 (95.2) 20 (95.2) 1 (4.8)
Mean OD414 ± SD 1.3 ± 0.5 1.2 ± 0.5 1.1 ± 0.5 1.0 ± 0.4 1.3 ± 0.5 1.1 ± 0.4 0.1 ± 0.1
    Lineage III/IV 4a 2 0 0 0 0 0 0 0
4c 3 0 0 0 0 0 0 0
Total 5 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Mean OD414 ± SD 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.1 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0 0.1 ± 0.0
L. innocua 1 0 0 0 0 0 0 0
L. ivanovii 1 0 0 0 0 0 0 0
L. grayi 1 0 0 0 0 0 0 0
L. seeligeri 1 1 1 0 1 1 0 0
L. welshimeri 1 0 0 0 0 0 0 0
Total 5 1 (20) 1 (20) 0 (0) 1 (20) 1 (20) 0 (0) 0 (0)
Mean OD414 ± SD 0.1 ± 0.1 0.1 ± 0.1 0.1 ± 0.1 0.2 ± 0.0 0.1 ± 0.1 0.1 ± 0.1 0.1 ± 0.0
Other bacteriac 5 0 0 0 0 0 0 0
Total 5 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Mean OD414 ± SD 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.1 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0
a

OD414 = >0.2.

b

ELISA mean OD414 ± standard deviation.

c

E. coli O157:H7, E. coli, S. Typhimurium, S. California, C. jejuni.

Bioinformatic analysis.

LapB (Lmo1666), encoded by the genome of L. monocytogenes EGDe serotype 1/2a, was first characterized as a LPXTG surface protein required for adhesion to and entry into mammalian cells and for virulence in a mouse model (18). To determine if LapB is well conserved among strains of L. monocytogenes, the LapB homolog (Lmof2365_1690) from L. monocytogenes strain F2365 serotype 4b (20) was used as a reference to perform a similarity search within the public databases using the BLASTp search tool. Similar proteins identified by the BLSATp search were retrieved from the databases and compared by multiple-sequence alignments using the MegAlign module of the Lasergene software package (DNAStar, Madison, WI).

LapB expression construct.

All DNA manipulations were essentially performed according to established procedures (21). Genomic DNA was extracted from L. monocytogenes strain L10521 serotype 4b using DNAzol (Invitrogen) according to the manufacturer's instructions and was used as a template to synthesize the DNA fragment coding for the mature LapB (amino acids [aa] 26 to 1682) by PCR. The primers, p912(F) (TTTAAGAAGGAGATATAAGTCATGAAATCGGTGGGAGATATTTC) and p913(R) (AGTGGTGGTGGTGGTGGTGAGTCCCGCTTTCATTTGTAGCGGTA), were designed to allow the PCR-derived lapB gene fragment to be cloned into the pLIC-CHis vector using a ligation-independent cloning procedure (22). This resulted in an expression construct, designated pLapB, which was propagated in E. coli DH5α. The presence of the correct insertion in pLapB was confirmed by PCR and DNA sequencing with T7 promoter and T7 terminator primers. The recombinant LapB (rLapB) expressed from pLapB in E. coli Rosetta (DE3)/pLysS contained a 6×His tag at the C terminus.

Expression and purification of recombinant LapB.

A colony of E. coli Rosetta (DE3)/pLysS cells containing pLapB was inoculated into 5 ml of LB broth containing 50 μg/ml kanamycin and incubated at 37°C with continuous shaking for 16 h. The 16-h culture (5 ml) was added to 500 ml of LB broth containing 50 μg/ml kanamycin and incubated at 37°C with continuous shaking until an OD at 595 nm of 0.5 to 0.8 was obtained. The expression of rLapB was induced by the addition of 1 mM isopropyl-β-d-thiogalactopyranoside (IPTG) followed by incubation for an additional 3 h. The cells were harvested by centrifugation at 8,000 × g for 20 min at 4°C and stored frozen at −80°C until use.

Frozen cell pellets were thawed and suspended in 10 ml of phosphate-buffered saline (PBS; pH 7.2) containing 1 mM phenylmethylsulfonyl fluoride (PMSF). The cell suspensions were passed through a French press (SLM Instruments Inc.) twice at 1,500 lb/in2. Lysed cells were centrifuged at 27,000 × g for 20 min at 4°C, and the supernatant (designated crude protein extract) was collected. The extract was mixed with 1 volume of wash buffer (50 mM NaH2PO4, 300 mM NaCl, 20 mM imidazole, pH 8.0) and then applied at 1.0 ml/min to a nickel-nitrilotriacetic acid (Ni-NTA) agarose column (1 cm by 2.5 cm) which had been preequilibrated with 30 ml of wash buffer. The column was washed with 30 ml of wash buffer at 1 ml/min followed by 30 ml of elution buffer (50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0). Fractions of eluted protein were collected and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting (WB) with an anti-His tag MAb (Qiagen). Fractions containing rLapB were pooled and concentrated by centrifugation at 3,270 × g for 30 to 60 min using Amicon filter centrifugal devices (Millipore). Protein concentrations were quantified using the Bradford method (23) with bovine serum albumin (BSA) as the standard.

Preparation of killed Listeria cells for ELISA.

Killed cells of the Listeria strains were prepared for use as coating antigens in an enzyme-linked immunosorbent assay (ELISA). One colony of each Listeria strain, maintained on brain heart infusion (BHI) agar at 4°C, was inoculated into BHI broth and incubated at 37°C overnight. Cell concentrations were determined based on the OD620 value as described above. Cells were centrifuged at 8,000 × g for 10 min and washed 3 times with PBS. Pelleted cells were killed by treatment with 0.3% (vol/vol) formalin for 24 h at room temperature. Killed bacteria were centrifuged and washed as described above. Cells were resuspended in PBS, mixed with an equal volume of glycerol to give a final concentration of 109 cells/ml, and stored at −20°C until use.

Extraction of L. monocytogenes total cellular proteins.

A colony of L. monocytogenes strain LI0521 serotype 4b from a BHI agar plate was inoculated into 50 ml of BHI broth and incubated with shaking at 225 rpm for 16 h at 37°C. Cells were centrifuged at 8,000 × g for 10 min and resuspended in 500 μl of 0.5 M Tris-HCl (pH 6.8) containing 10% (wt/vol) SDS and 1 mM PMSF. The cell suspension was transferred to a Lysing Matrix B tube (MP Biomedicals) and homogenized using a FastPrep FP120 cell disrupter (Thermo Electron) for 40 s at speed level 6. A 500-μl volume of a 2× SDS-PAGE sample buffer was added, and the mixture was boiled for 10 min. The supernatant was kept at −20°C for analysis by SDS-PAGE and WB.

SDS-PAGE and Western blotting.

SDS-PAGE was carried out as described by Laemmli (24), using a 4% (wt/vol) stacking gel and a 10% (wt/vol) separating gel. Following electrophoresis, the separated proteins were either stained with Coomassie blue or electrotransferred onto a nitrocellulose membrane for WB (19). Prior to WB, successful transfer of proteins was confirmed by staining the membrane with 0.1% (wt/vol) Ponceau S–5% (vol/vol) acetic acid for 2 min. The membrane was then blocked with PBS-TT (PBS, 0.05% [vol/vol] Tween 20, 0.2% [vol/vol] Triton X-100) containing 3% (wt/vol) BSA for 1 h at room temperature or overnight at 4°C. WB detection of proteins was performed using specific MAbs followed by peroxidase-conjugated goat anti-mouse IgG (H+L) (Jackson ImmunoResearch Laboratories) as described previously (19).

Production of LapB PAbs.

Polyclonal antibodies (PAbs) were raised by immunizing rabbits with rLapB. A blood sample was collected prior to immunization. Purified rLapB (200 μg in 0.5 ml PBS) was emulsified with an equal volume of incomplete Freund's adjuvant (IFA) and used to inject subcutaneously each of two New Zealand White female rabbits (Charles River Laboratories, Senneville, Quebec, Canada) on day 0 (total volume = 1 ml for each rabbit). Booster inoculations were given with a mixture of 100 μg of the purified protein and 0.5 ml PBS emulsified with an equal volume of IFA on days 14 and 28. After a test bleed performed on day 42, rabbits were exsanguinated on day 46 to collect the maximal volume of blood samples.

PAbs against LapB were also obtained from mice immunized with rLapB for production of MAbs (see below).

All experiments involving animals were approved by the local Animal Care Committee under the guidelines of the Canadian Council on Animal Care.

Production of LapB monoclonal antibodies.

Six-week-old Swiss Webster (CFW) mice and BALB/c mice (3 of each strain; Charles River Laboratories) were immunized with purified rLapB at scheduled intervals over a 2-month period. The mice were bled prior to immunization. On day 0, each mouse was injected subcutaneously with rLapB protein (30 μg) emulsified with an equal volume of complete Freund's adjuvant (total volume = 100 μl). Booster inoculations were given to each mouse intraperitoneally with 20 μg and 10 μg of the protein emulsified with incomplete Freund's adjuvant (1:1 [vol/vol]; total volume = 200 μl) on days 21 and 42, respectively. Mice were bled on day 64 for the assessment of the anti-LapB antibody response by ELISA. One CFW mouse and one BALB/c mouse that exhibited high titers of antibodies to rLapB were selected for MAb production, and each was inoculated intraperitoneally with 0.5 μg epinephrine and 100 μg dehydroepiandrosterone sulfate and intravenously with 5 μg of rLapB–100 μl PBS 5 days before splenectomy was performed. Blood was also collected on the day of splenectomy.

Mouse Sp2/0-Ag14 myeloma cells were fused with spleen cells from two mice as previously described (19). Undiluted tissue culture fluid (TCF) samples of parent hybridomas from the two fusions were screened by an indirect ELISA procedure (19) for antibody reactivity to purified rLapB protein coated on Nunc 96-well microtiter plates (Thermo Scientific) at a concentration of 1 μg/ml (100 μl/well) mixed with 60 mM carbonate buffer (pH 9.6). TCF samples from positive hybridomas were further screened by ELISA against killed L. monocytogenes cells (serotypes 4b, 1/2a, and 1/2c) coated on microtiter plates at 37°C overnight at 5 × 108 cells/ml (100 μl/well) mixed with PBS. The subclass of immunoglobulin secreted by the hybridoma cell lines was determined by ELISA using commercial reagents according to the instructions of the manufacturer (SBA Clonotyping system; Southern Biotech). In addition, immunofluorescence microscopy (IFM) analysis (see below) was performed to evaluate binding of MAbs to the cell surface of L. monocytogenes serotype 4b strain L10521 cells. Based on the results of ELISA, IFM analysis, and isotyping, hybridomas were selected for single-cell cloning and expansion.

Immunofluorescence microscopy analysis.

IFM was performed as previously described (19). Bacterial cells were probed with rabbit antiserum (1:500 dilution) or mouse MAbs (TCF at 1:25 dilution) followed by immunofluorescence staining with Dylight 488 goat anti-rabbit IgG (1:50 dilution) or anti-mouse IgG (1:100 dilution) (Jackson ImmunoResearch) mixed with PBS–5% (wt/vol) BSA. Phase contrast and fluorescence images of bacteria were viewed and captured with a fluorescence microscope (Olympus BX60) equipped with a charge-coupled camera.

ELISA analysis of LapB expression.

Indirect ELISA was performed with anti-LapB MAbs as described above to evaluate the expression of LapB in 53 L. monocytogenes strains (Table 1) and other bacterial species: L. innocua, L. ivanovii, L. grayi, L. seeligeri, L. welshimeri, E. coli O157:H7 ATCC 43889, E. coli ATCC 25922, Salmonella enterica serovar Typhimurium DT104 SA03-1907, S. enterica serovar California, and Campylobacter jejuni NCTC11168. Microtiter plates were coated with bacteria at 2 × 108 cells/ml (100 μl/well) mixed with PBS. An ELISA OD414 value of ≥0.2 was considered to represent a positive result.

LapB expression in enrichment culture.

To assess the expression of LapB during enrichment in media used in a diagnostic procedure for the isolation of L. monocytogenes and other Listeria spp. from food and environmental samples (MFHPB-07 method; the Compendium of Analytical Methods, Health Canada [http://www.hc-sc.gc.ca/fn-an/res-rech/analy-meth/microbio/volume2-eng.php]), a single colony of each of 4 selected Listeria strains (3 L. monocytogenes strains and 1 L. innocua strain) was inoculated into 7 ml of Palcam broth (Oxoid) and incubated at 35°C with shaking at 225 rpm overnight. A 1-ml volume of the overnight culture was transferred into 9 ml of fresh UVM broth (BD Diagnostics) and incubated at 30°C with shaking at 225 rpm overnight. Bacterial cells were then centrifuged and washed 3 times with PBS and used to coat microplate wells (Nunc Maxisorp plates; Thermo Scientific) at 2 × 108 cells/ml (100 μl/well) overnight at 37°C and evaluated for the expression of LapB by ELISA with MAbs as described above.

RESULTS

LapB protein expression in L. monocytogenes.

To characterize the cell surface expression of LapB protein in L. monocytogenes and investigate if LapB could be targeted for the development of MAbs recognizing various L. monocytogenes strains, polyclonal antibodies were first raised against the recombinant form of LapB for use as a probe. Figure 1A shows the expression in E. coli of the rLapB (aa 26 to 1682) carrying a C-terminal 6×His tag from the construct pLapB, as detected by WB with an anti-His MAb. The rLapB protein migrated to a position with an apparent mass close to the calculated value of 180 kDa. The presence of rLapB in the E. coli whole-cell lysates was not evident by SDS-PAGE analysis (Fig. 1B), indicating a low level of rLapB expression upon induction with IPTG.

FIG 1.

FIG 1

SDS-PAGE and Western blot (WB) analysis of rLapB protein expression in E. coli Rosetta (DE3) cells. (A) WB analysis. Lane 1, prestained protein standards with their molecular masses indicated (in kilodaltons) on the left; lane 2, lysate from uninduced E. coli cells; lane 3, lysate from IPTG-induced E. coli cells. (B) SDS-PAGE. Lane 1, prestained protein standards with their molecular masses indicated (in kilodaltons) on the left; lane 2, lysate from uninduced E. coli cells; lane 3, lysate from IPTG induced E. coli cells. (C) WB. Lane 1, prestained protein standards with their molecular masses indicated (in kilodaltons) on the left; lanes 2 to 6, fractions 1 to 5 of LapB protein eluted from a Ni-NTA agarose affinity column. (D) WB. Lane 1, prestained protein standards with their molecular mass in kilodalton on the left; lane 2, concentrated pool of eluted fractions of purified rLapB protein. (E) SDS-PAGE. Lane 1, prestained protein standards with their molecular masses indicated (in kilodaltons) on the left; lane 2, concentrated pool of eluted fractions of rLapB protein. The blot or gel shown in panels A and B was spliced along the narrow white gap between lane 1 and lane 2 to remove the lanes irrelevant to this work. Arrows indicate the rLapB protein at ∼195 kDa, close to the theoretical molecular mass of 180 kDa for LapB protein.

For PAb generation, an adequate amount of soluble rLapB was purified from pLapB-transformed E. coli cells using Ni-NTA agarose affinity chromatography. Eluted fractions that were confirmed to contain the rLapB protein by WB using anti-His MAb (Fig. 1C) were pooled and concentrated to approximately 1.0 mg/ml. SDS-PAGE and WB revealed that the concentrated rLapB preparation had only minimal contamination with E. coli proteins (Fig. 1D and E). Sera from rabbits immunized with rLapB were demonstrated to contain specific anti-LapB PAbs by ELISA and WB (data not shown).

The surface expression of LapB protein on live L. monocytogenes cells was probed with PAbs to rLapB in IFM analysis. The PAbs bound to the surface of L. monocytogenes serotype 4b L10521 cells, and no fluorescence signal was detected with the preimmune serum (Fig. 2). This result demonstrated that LapB is surface expressed in L. monocytogenes, suggesting that LapB could be explored as a candidate antigen against which MAbs could be raised for pathogen detection and capture by immunological methods. Consistent with this observation was the finding that antiserum from mice immunized with rLapB recognized the native protein in the total protein extract of L. monocytogenes on WB (see Fig. S1 in the supplemental material).

FIG 2.

FIG 2

Cell surface expression of native LapB protein in L. monocytogenes serotype 4b cells observed with immunofluorescence microscopy. L. monocytogenes cells were incubated with (A) preimmune serum and (B) antiserum from a rabbit immunized with rLapB protein and then with a goat anti-rabbit fluorescent IgG conjugate. Phase contrast images are shown in the panels on the left, and fluorescence images are shown in the panels on the right (magnification, ×100).

Development of MAbs to LapB.

A total of 48 stable hybridoma clones secreting MAbs to rLapB were obtained. Of these MAbs, 41 were Ig subclass G1 (M3478 to M3491, M3493 to M3495, M3497 to M3511, M3514 to M3519, M3521, M3524, and M3525) and 7 were Ig subclass G2a (M3492, M3496, M3512 and M3513, M3520, M3522, and M3523). All 48 MAbs, with the exception of M3511, reacted to rLapB in ELISA with an OD414 of >2.0, and all but one MAb (M3511) did not react with soluble proteins of E. coli BL21(DE3)/pLysS (with no pLapB expression vector) (see Fig. S2 in the supplemental material).

Binding of anti-LapB MAbs to the surface of L. monocytogenes serotype 4b.

The ELISA results (Fig. 3) showed that 11 of the 48 MAbs reacted strongly (OD414 = >1.0) with L. monocytogenes serotype 4b L10521 cells. Seven (M3484, M3495, M3500, M3509, M3517, M3519, and M3524) of the 11 MAbs bound strongly to the surface of the serotype 4b L10521 strain as revealed with IFM, while four MAbs (M3482, M3493, M3498, and M3499) had a negative to weak immunofluorescence signal (Fig. 4).

FIG 3.

FIG 3

Indirect ELISA reactivity of 48 anti-LapB MAbs with L. monocytogenes serotype 4b strain L10521 cells grown in BHI broth. Microplate wells were coated with L. monocytogenes cells at a concentration of 5 × 108 cells/ml. Positive and negative controls were anti-IspC MAb M2799 and 10% fetal calf serum, respectively. ELISA OD414 values represent averages of duplicate determinations for each MAb. The dashed line indicates the negative-positive threshold OD414 value of 0.20.

FIG 4.

FIG 4

Analysis of binding of anti-LapB MAbs to the surface of L. monocytogenes 4b strain L10521 cells using immunofluorescence microscopy. L. monocytogenes cells were probed with (A) mouse preimmune serum (1:50), (B) MAb M3484, (C) MAb M3495, (D) MAb M3500, (E) MAb M3509, (F) MAb M3517, (G) MAb M3519 (H) MAb M3524, (I) MAb M3482, (J) MAb M3493, (K) MAb M3498, and (L) MAb M3499 hybridoma tissue culture fluid (1:25 dilution). Both phase contrast and fluorescence images of bacterial cells were captured at a magnification of ×100.

Reactivity of anti-LapB MAbs with various strains of L. monocytogenes grown in BHI broth.

The seven MAbs that bound to the surface of L. monocytogenes serotype 4b L10521 cells were further tested by ELISA with 53 L. monocytogenes strains representing 12 serotypes (1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4ab, 4a, 4b, 4c, 4d, and 4e). The reactivity of each MAb with all L. monocytogenes strains tested was given a score (− to +++) based on the mean OD414 values from three separate experiments (see Table S1 in the supplemental material). As shown in Table 1, six of the seven anti-LapB MAbs (M3484, M3495, M3500, M3509, M3517, and M3519) detected 46 (86.8%) of 53 strains, which represented 10 of the 12 L. monocytogenes serotypes tested. M3524 showed weaker reactivity to the majority of strains and recognized only 24 of 53 strains (Table 1). None of the anti-LapB MAbs reacted with the three 4c strains or the two 4a strains tested. Overall, M3484 reacted with the highest number of L. monocytogenes strains (47 of 53) and had the highest reactivity scores among the seven MAbs (see Table S1). As shown in Fig. 5, M3484 reacted with the majority of the L. monocytogenes strains tested but not with non-L. monocytogenes strains except for L. seeligeri.

FIG 5.

FIG 5

Indirect ELISA reactivity of anti-LapB MAb M3484 with 53 strains of L. monocytogenes representing 12 serotypes and 10 non-L. monocytogenes bacterial species. Bacterial cells were coated on 96-well microplates at a concentration of 1 × 108 cells/ml. Error bars represent 1 standard deviation from the mean OD414 of the results of three independent experiments. The dashed line indicates the cutoff for a negative reaction (OD414 < 0.20).

Cross-reactivity of anti-LapB MAbs with nonpathogenic Listeria spp. and other microorganisms.

ELISA results showed that none of the seven MAbs (M3484, M3495, M3500, M3509, M3517, M3519, and M3524) reacted with the L. innocua, L. ivanovii, L. grayi, or L. welshimeri strains tested (Table 1). Three of the MAbs (M3500, M3519, and M3524) did not react with a L. seeligeri strain, whereas two MAbs (M3495 and M3509) reacted very weakly (OD414 values of 0.2 to 0.3) and two (M3484 and M3517) reacted moderately (OD414 values of 0.3 to 1.0) with this strain. None of these seven MAbs reacted with the E. coli O157, Salmonella enterica, or C. jejuni strains tested (Table 1).

LapB expression in L. monocytogenes under culture enrichment conditions.

L. monocytogenes serotype 4b strains L10521 and HPB5906 and serotype 1/2a strain HPB6036 and L. innocua strain HPB583 were cultured in enrichment broths (i.e., first in Palcam and then in UVM), and the cells were tested by ELISA for LapB expression using MAbs M3484, M3495, M3500, M3509, M3517, and M3519. All three L. monocytogenes strains, but not the L. innocua strain, were detected by each of the six anti-LapB MAbs (Fig. 6). As observed with the Listeria cells grown in BHI broth (Table 1), these anti-LapB MAbs reacted more strongly with L. monocytogenes strains HPB5906 and HPB6036 than with the L10521 immunizing strain.

FIG 6.

FIG 6

Indirect ELISA reactivity of six LapB MAbs with cells of three L. monocytogenes strains and one L. innocua strain cultured in an enrichment condition. Bacterial cells were grown first in Palcam broth and then in UVM broth prior to being coated on 96-well microplates at 2 × 108 cells/ml. The cells were probed with six anti-LapB MAbs (M3484, M3495, M3500, M3509, M3517, and M3519) and anti-IspC MAb M2799 specific to L. monocytogenes serotype 4b (positive control) and 10% fetal calf serum (FCS) (negative control). L. monocytogenes serotype 4b strains L10521 (L10521-4b) and HPB4906 (4906-4b), L. monocytogenes serotype 1/2a strain HPB6036 (6036-1/2a), and L. innocua strain HPB583 (583-Li) were tested. ELISA OD414 readings represent the averages of duplicate determinations. The ELISA OD414 values for L. innocua ranged from 0.062 to 0.106. The dashed line indicates the cutoff for a negative reaction (OD414 <0.20). Similar results were obtained with a repeat of the experiment.

DISCUSSION

LapB is a LPXTG surface protein encoded by lapB, a L. monocytogenes-specific gene that has not previously been found in nonpathogenic Listeria species (18). The expression of LapB in L. monocytogenes would provide a unique surface marker for the detection, isolation, and identification of this pathogen by immunological methods. The objective of the present study was to examine if the LapB protein was expressed in a wide range of L. monocytogenes strains and to evaluate if this protein can serve as a suitable target in the antibody-based diagnostic methods. Through producing a recombinant form of LapB (rLapB) and raising polyclonal antibodies against this protein, we confirmed with IFM that LapB is surface localized in L. monocytogenes. This result is consistent with previous findings that LapB was detected in the cell wall proteome of L. monocytogenes (25) and was absent in the surface extract of a L. monocytogenes ΔsrtA mutant (18). The surface exposure characteristic of LapB meets the minimum requirement for the use of LapB as a biomarker for the antibody-based detection and isolation of L. monocytogenes. Production and characterization of a number of mouse MAbs against the LapB protein revealed that several of these MAbs were capable of recognizing strains of 10 L. monocytogenes serotypes and thus have the potential for use in the detection and isolation of L. monocytogenes in food, clinical, and environmental sources.

In the present study of 58 Listeria strains, using MAbs raised against rLapB, the LapB protein was shown to be present and exposed on the surface of L. monocytogenes strains of lineage I (serotypes 1/2b, 3b, 3c, 4ab, 4b, 4d, and 4e) and lineage II (serotypes 1/2a, 1/2c, and 3a) (26). LapB was not detected in the rare lineage III strains (serotypes 4a and 4c) (26) or the L. innocua, L. ivanovii, L. grayi, or L. welshimeri strains tested but was detected in the L. seeligeri strain. These results are consistent with the findings of some previous investigations. In an analysis of surface protein-encoding genes, Cabanes et al. (27) provided evidence that L. monocytogenes protein Lmo1666, later renamed LapB (18), contains an LPXTG sequence motif, indicating that this protein is covalently linked to the cell wall through sortase A (SrtA) and an Arg-Gly-Asp (RGD) motif which is found in proteins mediating adhesion to eukaryotic cells. Doumith et al. (28) examined 113 Listeria strains using comparative genomics and DNA hybridization techniques and showed that the lmo1666 gene is present in L. monocytogenes lineages I and II and in one of the two L. seeligeri strains studied but absent from L. monocytogenes lineage III, L. innocua, L. ivanovii, L. welshimeri, and L. grayi. Calvo et al. (25) demonstrated that Lmo1666 is present in the cell wall proteome of L. monocytogenes but absent from that of L. innocua, and Reis et al. (18) found no similarity between the N-terminal part of the LapB protein (amino acids 25 to 839) and that of other proteins by a BLAST search of the public sequence databases.

Some anti-LapB MAbs were unable to detect all the L. monocytogenes strains of the same serotype. A possible explanation for this observation is the absence of the lapB gene in certain strains of the same serotype. Consistent with this explanation is the high genetic diversity among L. monocytogenes isolates, which has formed the basis of grouping isolates of the same serotype into genetically distinct lineages (26). In fact, Doumith et al. showed the absence of lapB in several strains of serotypes 4c and 4a (28). Another possible explanation is differential expression of the lapB gene among strains of the same serotype. It has been shown that a number of genes found in both lineages I and II are expressed differentially among isolates of both lineages at 37°C (26). Comparative genomics and gene expression studies are necessary to provide a definitive explanation for the observed reactivity of anti-LapB MAbs with isolates of the same serotype.

As LapB is highly specific for L. monocytogenes and appears to be conserved in the serotypes most frequently associated with foodborne infections, the anti-LapB MAbs developed in this study are potentially valuable for the development of improved antibody-based methods for detection and isolation of this organism from clinical specimens and from environmental and food samples. Six MAbs (M3484, M3495, M3500, M3509, M3517, and M3519) reacted with at least 46 (95.8%) of the 48 L. monocytogenes lineage I and II strains tested; isolates of these two lineages are known to be most frequently associated with human clinical cases (26). The reason that the six MAbs did not react or reacted weakly with one serotype 4e strain and one serotype 1/2a strain is not clear, but possible explanations include a lack of expression or minimal expression of LapB under the culture conditions used, an absence of the lmo1666 gene, or a mutation in the lmo1666 gene resulting in the expression of an altered or nonfunctional epitope. None of the six MAbs reacted with a strain of E. coli, S. enterica, or C. jejuni. Characterization with other Gram-positive bacteria such as Brochothrix (in the same family of Listeriaceae as Listeria), Enterococcus, and Bacillus species is needed to further assess the specificity of these anti-LapB MAbs and to address this limitation of the study. Given that these MAbs showed a lack of cross-reactivity with several non-L. monocytogenes species, it is unlikely that they would detect any other genetically distinct Gram-negative or -positive bacteria, although this remains to be experimentally investigated.

MAbs to Listeria have also been described in previous studies. In contrast to the anti-LapB MAbs that were shown here to react with the L. moncytogenes serotypes most frequently associated with foodborne outbreaks, some of which (M3500, M3519, and M3524) are highly specific for L. monocytogenes, the majority of those anti-Listeria MAbs previously reported in the literature are not specific for L. monocytogenes or do not recognize a wide spectrum of L. monocytogenes serotypes. Most of them recognize antigens of unknown identity. Butman et al. (29) reported that 15 MAbs recognizing a 30-to-38-kDa protein reacted with L. monocytogenes (1, 1a, 1b, 1/2a, 1/2b, 2, 3, 3a, 3b, 4b, 4c, 4d, and 4e), L. denitrificans (reclassified as Jonesia denitrificans), L. grayi, L. innocua, L. ivanovii, and L. seeligeri. Siragusa and Johnson (30) showed that MAb P5C9 recognized a 18.5-kDa antigen and was capable of reacting with 31 L. monocytogenes strains, L. innocua, and L. welshimeri but not with other Listeria spp. MAbs 20-10-2, 36-6-12, and 59-9-16 (31) were shown to react with L. monocytogenes, L. innocua, L. ivanovii, and L. seeligeri; the antigen recognized by these MAbs was not identified. MAb C11E9 (32) reacted with L. monocytogenes and L. innocua but not with L. ivanovii, L. grayi, L. welshimeri, L. seeligeri, or L. murrayi; these MAbs detected several proteins of 76, 66, 56, and 52 kDa in L. monocytogenes and 66, 56, and 52 kDa in L. innocua. MAb EM-7G1 (33) recognized a 66-kDa cell surface protein and detected all 34 L. monocytogenes strains tested but not L. innocua, L. seeligeri, L. welshimeri, L. grayi, L. murrayi, or L. ivanovii. MAb EM-6E11 (32) reacted with all 7 Listeria spp. and recognized 43-kDa and 94-to 97-kDa proteins. MAb 55-44 (34) reacted with all 11 L. monocytogenes 4b strains tested, with some L. monocytogenes 1/2b, 3c, 4a, 4ab, and 4d strains, and with L. innocua and L. welshimeri; this MAb detected 90-to-95-kDa and 35-kDa proteins. MAb B4 (35) reacts with viable L. monocytogenes (65 strains) and L. innocua (14 strains) but not with heat-killed cells of these bacteria or with L. ivanovii, L. seeligeri, L. welshimeri, or L. grayi. MAb p6007 (36), an antibody recognizing a 60-kDa p60 murein hydrolase protein (secreted in large quantity into the growth medium), detected L. monocytogenes but not L. innocua, L. grayi, L. welshimeri, L. ivanovii, or L. seeligeri. Another anti-p60 MAb, p6017 (36), reacted with L. monocytogenes, L. innocua, L. grayi, L. welshimeri, L. ivanovii, and L. seeligeri. MAb mAb2B3 (37) was shown to detect L. monocytogenes 1/2a, 1/2c, 4a, and 4b (the only serotypes tested) but not L. innocua, L. welshimeri, L. seeligeri, or L. ivanovii; the antigen was an 80-kDa protein assumed to be internalin A. MAb 22D10 (38) recognized a 66-kDa protein and was capable of detecting live and heat-killed L. monocytogenes cells of most serotypes except 4c and 4e and L. innocua, L. ivanovii, L. murrayi, L. seeligeri, and L. welshimeri. We recently reported the production and characterization of MAbs to a surface autolysin (IspC) of L. monocytogenes 4b with an apparent molecular mass of 77 kDa and possessing N-acetylglucosaminidase activity (39–41); some of these MAbs (M2774, M2775, M2780, M2790, and M2797) are specific for L. monocytogenes 4b strains. LapB is a surface adhesion molecule of L. monocytogenes required for entry into eukaryotic cells and virulence (18), is expected to be conserved in a wide range of pathogenic strains of L. monocytogenes, and therefore may serve as a useful diagnostic marker for the detection and isolation of this deadly pathogen by the anti-LapB MAbs developed in this study.

Expression of a protein antigen on the surface of L. monocytogenes under different environmental conditions is an essential requirement for the protein to be a useful diagnostic marker for the antibody-based detection and isolation of this pathogen. The anti-LapB MAbs were able to detect the expression of LapB on L. monocytogenes cells grown in BHI broth at 37°C, Palcam broth at 35°C, and UVM broth at 30°C; Palcam and UVM media are routinely used for primary and secondary culture enrichment at 35°C and 30°C, respectively (MFHPB-07 method). These steps are necessary to increase the cell number of L. monocytogenes in food samples to a level suitable for isolation and detection. Expression of LapB in L. monocytogenes grown under these culture enrichment conditions points to the feasibility of using anti-LapB MAbs to isolate and detect L. monocytogenes from food samples following culture enrichment. This is in contrast to the few previous studies performed with two MAbs (EM-6E11 and C11E9) that do not detect L. monocytogenes cells grown in UVM broth (42, 43). Expression of the lapB gene is presumably directed by a σB-dependent promoter predicted 67 bp upstream of its translational start codon (44) and was reported to be positively regulated by transcriptional activator PrfA (18, 45). The regulation of lapB by PrfA suggests a role of LapB in virulence, which has been demonstrated recently (18). σB regulation suggests that LapB is involved in stress response. The multicopy small RNA (sRNA) LhrC was recently shown to negatively regulate lapB expression at the posttranscriptional level (46). Given that expression of LapB is highly regulated, it may be possible to identify some enrichment conditions that promote the expression of LapB at a high level for the sensitive detection and isolation of the pathogen by anti-LapB MAbs in an immunomagnetic separation (IMS) procedure. This study demonstrated expression of LapB in L. monocytogenes cultured in a limited number of enrichment media described in one Canadian official method (MFHPB-07). It becomes necessary to determine whether LapB is expressed in other commonly used enrichment broths such as Listeria enrichment broth (LEB—UVM1 formulation) and in modified Fraser broth (MFB) in the other Canadian official method (MFHPB-30) (http://www.hc-sc.gc.ca/fn-an/res-rech/analy-meth/microbio/volume2-eng.php) or half-Fraser broth in the ISO method (47). As well, practical use of anti-LapB MAbs in the isolation and detection of L. monocytogenes remains to be demonstrated with food matrices.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We thank K. Amoako and J. Guan for providing constructive comments and suggestions for the manuscript. We acknowledge the assistance from the Monoclonal Antibody Unit (K. Arnold, J. Widdison) at the Canadian Food Inspection Agency (CFIA) in the production of monoclonal antibodies.

This work was supported by the funding of the CFIA Research Partnership Strategies program (M. Lin, H. Huang, B. W. Brooks). T. Boivin was supported in part by the Walkerton Clean Water Centre (WCWC) scholarship.

Footnotes

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.01908-16.

REFERENCES

  • 1.Hamon M, Bierne H, Cossart P. 2006. Listeria monocytogenes: a multifaceted model. Nat Rev Microbiol 4:423–434. doi: 10.1038/nrmicro1413. [DOI] [PubMed] [Google Scholar]
  • 2.Weis J, Seeliger HP. 1975. Incidence of Listeria monocytogenes in nature. Appl Microbiol 30:29–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.McLauchlin J. 1990. Human listeriosis in Britain, 1967–85, a summary of 722 cases. 2. Listeriosis in non-pregnant individuals, a changing pattern of infection and seasonal incidence. Epidemiol Infect 104:191–201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.McLauchlin J. 1990. Human listeriosis in Britain, 1967–85, a summary of 722 cases. 1. Listeriosis during pregnancy and in the newborn. Epidemiol Infect 104:181–189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.McLauchlin J. 1990. Distribution of serovars of Listeria monocytogenes isolated from different categories of patients with listeriosis. Eur J Clin Microbiol Infect Dis 9:210–213. doi: 10.1007/BF01963840. [DOI] [PubMed] [Google Scholar]
  • 6.McLauchlin J. 1991. Epidemiology of listeriosis in Britain, p 38–47. In Amgar A. (ed), Proceedings of the International Conference on Listeria and Food Safety. Aseptic Processing Association, Laval, France. [Google Scholar]
  • 7.Orsi RH, Wiedmann M. 2016. Characteristics and distribution of Listeria spp., including Listeria species newly described since 2009. Appl Microbiol Biotechnol 100:5273–5287. doi: 10.1007/s00253-016-7552-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Moreno LZ, Paixão R, Gobbi DD, Raimundo DC, Ferreira TP, Hofer E, Matte MH, Moreno AM. 2012. Characterization of atypical Listeria innocua isolated from swine slaughterhouses and meat markets. Res Microbiol 163:268–271. doi: 10.1016/j.resmic.2012.02.004. [DOI] [PubMed] [Google Scholar]
  • 9.Clayton EM, Daly KM, Guinane M CM, Hill C, Cotter PD, Ross PR. 2014. Atypical Listeria innocua strains possess an intact LIPI-3. BMC Microbiol 14:58. doi: 10.1186/1471-2180-14-58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Klein PG, Juneja VK. 1997. Sensitive detection of viable Listeria monocytogenes by reverse transcription-PCR. Appl Environ Microbiol 63:4441–4448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gasanov U, Hughes D, Hansbro PM. 2005. Methods for the isolation and identification of Listeria spp. and Listeria monocytogenes: a review. FEMS Microbiol Rev 29:851–875. doi: 10.1016/j.femsre.2004.12.002. [DOI] [PubMed] [Google Scholar]
  • 12.Schrader C, Schielke L, Ellerbroek L, Johne R. 2012. PCR inhibitors – occurrence, properties and removal. J Appl Microbiol 113:1014–1026. doi: 10.1111/j.1365-2672.2012.05384.x. [DOI] [PubMed] [Google Scholar]
  • 13.D'Urso OF, De Blasi MD, Manera MG, Latronico MF, Rella R, Poltronieri P. 2008. Listeria monocytogenes detection with surface plasmon resonance and protein arrays, p 458–461. In Proceedings of the Seventh IEEE Conference on Sensors, the IEEE Sensors Council, Lecce, Italy. [Google Scholar]
  • 14.Geng T, Hahm BK, Bhunia AK. 2006. Selective enrichment media affect the antibody-based detection of stress-exposed Listeria monocytogenes due to differential expression of antibody-reactive antigens identified by protein sequencing. J Food Prot 69:1879–1886. [DOI] [PubMed] [Google Scholar]
  • 15.Gilbreth SE, Call JE, Wallace FM, Scott VN, Chen Y, Luchansky JB. 2005. Relatedness of Listeria monocytogenes isolates recovered from selected ready-to-eat foods and listeriosis patients in the United States. Appl Environ Microbiol 71:8115–8122. doi: 10.1128/AEM.71.12.8115-8122.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Swaminathan B, Gerner-Smidt P. 2007. The epidemiology of human listeriosis. Microbes Infect 9:1236–1243. doi: 10.1016/j.micinf.2007.05.011. [DOI] [PubMed] [Google Scholar]
  • 17.Ramaswamy V, Cresence VM, Rejitha JS, Lekshmi MU, Dharsana KS, Prasad SP, Vijila HM. 2007. Listeria–review of epidemiology and pathogenesis. J Microbiol Immunol Infect 40:4–13. [PubMed] [Google Scholar]
  • 18.Reis O, Sousa S, Camejo A, Villiers V, Gouin E, Cossart P, Cabanes D. 2010. LapB, a novel Listeria monocytogenes LPXTG surface adhesin, required for entry into eukaryotic cells and virulence. J Infect Dis 202:551–562. doi: 10.1086/654880. [DOI] [PubMed] [Google Scholar]
  • 19.Lin M, Todoric D, Mallory M, Luo BS, Trottier E, Dan H. 2006. Monoclonal antibodies binding to the cell surface of Listeria monocytogenes serotype 4b. J Med Microbiol 55:291–299. doi: 10.1099/jmm.0.46305-0. [DOI] [PubMed] [Google Scholar]
  • 20.Nelson KE, Fouts DE, Mongodin EF, Ravel J, DeBoy RT, Kolonay JF, Rasko DA, Angiuoli SV, Gill SR, Paulsen IT, Peterson J, White O, Nelson WC, Nierman W, Beanan MJ, Brinkac LM, Daugherty SC, Dodson RJ, Durkin AS, Madupu R, Haft DH, Selengut J, Van Aken S, Khouri H, Fedorova N, Forberger H, Tran B, Kathariou S, Wonderling LD, Uhlich GA, Bayles DO, Luchansky JB, Fraser CM. 2004. Whole genome comparisons of serotype 4b and 1/2a strains of the food-borne pathogen Listeria monocytogenes reveal new insights into the core genome components of this species. Nucleic Acids Res 32:2386–2395. doi: 10.1093/nar/gkh562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sambrook J, Russell DW. 2001. Molecular cloning: a laboratory manual, 3rd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
  • 22.Dan H, Balachandran A, Lin M. 2009. A pair of ligation-independent Escherichia coli expression vectors for rapid addition of a polyhistidine affinity tag to the N- or C-termini of recombinant proteins. J Biomol Tech 20:241–248. [PMC free article] [PubMed] [Google Scholar]
  • 23.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 24.Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685. doi: 10.1038/227680a0. [DOI] [PubMed] [Google Scholar]
  • 25.Calvo E, Pucciarelli MG, Bierne H, Cossart P, Albar JP, Garcia-Del Portillo F. 2005. Analysis of the Listeria cell wall proteome by two-dimensional nanoliquid chromatography coupled to mass spectrometry. Proteomics 5:433–443. doi: 10.1002/pmic.200400936. [DOI] [PubMed] [Google Scholar]
  • 26.Orsi RH, den Bakker HC, Wiedmann M. 2011. Listeria monocytogenes lineages: genomics, evolution, ecology, and phenotypic characteristics. Int J Med Microbiol 301:79–96. doi: 10.1016/j.ijmm.2010.05.002. [DOI] [PubMed] [Google Scholar]
  • 27.Cabanes D, Dehoux P, Dussurget O, Frangeul L, Cossart P. 2002. Surface proteins and the pathogenic potential of Listeria monocytogenes. Trends Microbiol 10:238–245. doi: 10.1016/S0966-842X(02)02342-9. [DOI] [PubMed] [Google Scholar]
  • 28.Doumith M, Cazalet C, Simoes N, Frangeul L, Jacquet C, Kunst F, Martin P, Cossart P, Glaser P, Buchrieser C. 2004. New aspects regarding evolution and virulence of Listeria monocytogenes revealed by comparative genomics and DNA arrays. Infect Immun 72:1072–1083. doi: 10.1128/IAI.72.2.1072-1083.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Butman BT, Plank MC, Durham RJ, Mattingly JA. 1988. Monoclonal antibodies which identify a genus-specific Listeria antigen. Appl Environ Microbiol 54:1564–1569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Siragusa GR, Johnson MG. 1990. Monoclonal antibody specific for Listeria monocytogenes, Listeria innocua, and Listeria welshimeri. Appl Environ Microbiol 56:1897–1904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Gavalchin J, Tortorello ML, Malek R, Landers M, Batt CA. 1991. Isolation of monoclonal antibodies that react preferentially with Listeria monocytogenes. Food Microbiol 8:325–330. doi: 10.1016/S0740-0020(05)80006-1. [DOI] [Google Scholar]
  • 32.Bhunia AK, Ball PH, Fuad AT, Kurz BW, Emerson JW, Johnson MG. 1991. Development and characterization of a monoclonal antibody specific for Listeria monocytogenes and Listeria innocua. Infect Immun 59:3176–3184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Bhunia AK, Johnson MG. 1992. Monoclonal antibody specific for Listeria monocytogenes associated with a 66-kilodalton cell surface antigen. Appl Environ Microbiol 58:1924–1929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Torensma R, Visser MJ, Aarsman CJ, Poppelier MJ, Fluit AC, Verhoef J. 1993. Monoclonal antibodies that react with live Listeria spp. Appl Environ Microbiol 59:2713–2716. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sølve M, Boel J, Nørrung B. 2000. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua. Int J Food Microbiol 57:219–224. doi: 10.1016/S0168-1605(00)00157-4. [DOI] [PubMed] [Google Scholar]
  • 36.Yu KY, Noh Y, Chung M, Park HJ, Lee N, Youn M, Jung BY, Youn BS. 2004. Use of monoclonal antibodies that recognize p60 for identification of Listeria monocytogenes. Clin Diagn Lab Immunol 11:446–451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hearty S, Leonard P, Quinn J, O'Kennedy R. 2006. Production, characterisation and potential application of a novel monoclonal antibody for rapid identification of virulent Listeria monocytogenes. J Microbiol Methods 66:294–312. doi: 10.1016/j.mimet.2005.12.009. [DOI] [PubMed] [Google Scholar]
  • 38.Heo SA, Nannapaneni R, Story RP, Johnson MG. 2007. Characterization of new hybridoma clones producing monoclonal antibodies reactive against both live and heat-killed Listeria monocytogenes. J Food Sci 72:M008–M015. [DOI] [PubMed] [Google Scholar]
  • 39.Lin M, Armstrong S, Ronholm J, Dan H, Auclair ME, Zhang Z, Cao X. 2009. Screening and characterization of monoclonal antibodies to the surface antigens of Listeria monocytogenes serotype 4b. J Appl Microbiol 106:1705–1714. doi: 10.1111/j.1365-2672.2008.04140.x. [DOI] [PubMed] [Google Scholar]
  • 40.Ronholm J, Wang L, Hayashi I, Sugai M, Zhang Z, Cao X, Lin M. 2012. The Listeria monocytogenes serotype 4b autolysin IspC has N-acetylglucosaminidase activity. Glycobiology 22:1311–1320. doi: 10.1093/glycob/cws100. [DOI] [PubMed] [Google Scholar]
  • 41.Ronholm J, van Faassen H, MacKenzie R, Zhang Z, Cao X, Lin M. 2013. Monoclonal antibodies recognizing the surface autolysin IspC of Listeria monocytogenes serotype 4b: epitope localization, kinetic characterization, and cross-reaction studies. PLoS One 8:e55098. doi: 10.1371/journal.pone.0055098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Nannapaneni R, Story R, Bhunia AK, Johnson MG. 1998. Reactivities of genus-specific monoclonal antibody EM-6E11 against Listeria species and serotypes of Listeria monocytogenes grown in nonselective and selective enrichment broth media. J Food Prot 61:1195–1198. [DOI] [PubMed] [Google Scholar]
  • 43.Geng T, Kim KP, Gomez R, Sherman DM, Bashir R, Ladisch MR, Bhunia AK. 2003. Expression of cellular antigens of Listeria monocytogenes that react with monoclonal antibodies C11E9 and EM-7G1 under acid-, salt- or temperature-induced stress environments. J Appl Microbiol 95:762–772. doi: 10.1046/j.1365-2672.2003.02035.x. [DOI] [PubMed] [Google Scholar]
  • 44.Raengpradub S, Wiedmann M, Boor KJ. 2008. Comparative analysis of the sigma B-dependent stress responses in Listeria monocytogenes and Listeria innocua strains exposed to selected stress conditions. Appl Environ Microbiol 74:158–171. doi: 10.1128/AEM.00951-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Milohanic E, Glaser P, Coppee JY, Frangeul L, Vega Y, Vazquez-Boland JA, Kunst F, Cossart P, Buchrieser C. 2003. Transcriptome analysis of Listeria monocytogenes identifies three groups of genes differently regulated by PrfA. Mol Microbiol 47:1613–1625. doi: 10.1046/j.1365-2958.2003.03413.x. [DOI] [PubMed] [Google Scholar]
  • 46.Sievers S, Lillebaek EM, Jacobsen K, Lund A, Mollerup MS, Nielsen PK, Kallipolitis BH. 2014. A multicopy sRNA of Listeria monocytogenes regulates expression of the virulence adhesin LapB. Nucleic Acids Res 42:9383–9398. doi: 10.1093/nar/gku630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.International Organization for Standardization (ISO). 2014. ISO/DIS 11290-1. Microbiology of the food chain—horizontal method for the detection and enumeration of Listeria monocytogenes and other Listeria spp.—part 1: detection method. ISO, Geneva, Switzerland: http://www.iso.org/iso/catalogue_detail.htm?csnumber=60313. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES