Skip to main content
BMC Pharmacology & Toxicology logoLink to BMC Pharmacology & Toxicology
. 2016 Nov 2;17:54. doi: 10.1186/s40360-016-0097-2

Involvement of heat shock proteins on Mn-induced toxicity in Caenorhabditis elegans

Daiana Silva Avila 1, Alexandre Benedetto 2, Catherine Au 3, Julia Bornhorst 4, Michael Aschner 5,6,
PMCID: PMC5090951  PMID: 27802836

Abstract

Background

All living cells display a rapid molecular response to adverse environmental conditions, and the heat shock protein family reflects one such example. Hence, failing to activate heat shock proteins can impair the cellular response. In the present study, we evaluated whether the loss of different isoforms of heat shock protein (hsp) genes in Caenorhabditis elegans would affect their vulnerability to Manganese (Mn) toxicity.

Methods

We exposed wild type and selected hsp mutant worms to Mn (30 min) and next evaluated further the most susceptible strains. We analyzed survival, protein carbonylation (as a marker of oxidative stress) and Parkinson’s disease related gene expression immediately after Mn exposure. Lastly, we observed dopaminergic neurons in wild type worms and in hsp-70 mutants following Mn treatment. Analysis of the data was performed by one-way or two way ANOVA, depending on the case, followed by post-hoc Bonferroni test if the overall p value was less than 0.05.

Results

We verified that the loss of hsp-70, hsp-3 and chn-1 increased the vulnerability to Mn, as exposed mutant worms showed lower survival rate and increased protein oxidation. The importance of hsp-70 against Mn toxicity was then corroborated in dopaminergic neurons, where Mn neurotoxicity was aggravated. The lack of hsp-70 also blocked the transcriptional upregulation of pink1, a gene that has been linked to Parkinson’s disease.

Conclusions

Taken together, our data suggest that Mn exposure modulates heat shock protein expression, particularly HSP-70, in C. elegans. Furthermore, loss of hsp-70 increases protein oxidation and dopaminergic neuronal degeneration following manganese exposure, which is associated with the inhibition of pink1 increased expression, thus potentially exacerbating the vulnerability to this metal.

Keywords: Caenorhabitis elegans, Manganese, Heat shock proteins, hsp-70, pink1

Background

Molecular chaperones are highly evolutionarily conserved and ubiquitously found in subcellular compartments, cells, and tissues, being essential for the stability of the proteome under normal and stressful conditions [1]. The expression of many molecular chaperones is regulated by environmental and physiological stresses that can interfere with folding stability, leading to a flux of misfolded proteins [2]. Stress responsive molecular chaperones are referred to as heat shock proteins (HSPs) and classified by gene families according to their molecular mass as Hsp100, Hsp90, Hsp70, Hsp60, Hsp40 and small Hsps (sHsps). HSPs exert their physiological effect by assisting the formation of new proteins as well as by preserving existing structures. However, they also display major functions in pathological conditions, especially through structural rectification of denatured proteins and solubilization of protein aggregates carrying them on to the proteasome system [2, 3].

Metal exposure at different levels can cause oxidative stress, which can lead to protein aggregation [4, 5]. Thereby, metals themselves are able to generate aberrant interactions with proteins such as beta-amyloid, α synuclein and prion proteins [5, 6]. In this context, Manganese (Mn) poisoning has been associated with increased heat shock protein levels, especially HSP70 [79]. Mn is widely used in industry and in agriculture, being found in several products such as batteries, pesticides, gasoline, parenteral nutrition, water purification agents and drugs [1014]. As a consequence, exposed subjects may develop a syndrome known as manganism, where alterations in movement, speech and face expression may appear [1416].

Manganism and Parkinson´s disease (PD) share several symptoms and molecular mechanisms [17]. Several lines of evidence point out that the behavioral and cognitive impairments are due to the dopaminergic alterations in brain areas that are involved in the movement circuitry. Depletion of dopamine (DA) from the dopaminergic (DAergic) neurons, mitochondrial dysfunction, oxidative stress and neuronal death have been reported in both disorders. While PD is mostly idiopathic in its etiology, many genes have now been associated with the disease called as PD-related genes. The mutation of dj-1, pink-1, parkin, for example, have been strongly linked to the early-onset of PD neurodegenerative disease in humans. In addition, it has been demonstrated that mutation in these genes also relate to onset of manganism [1820]. As a putative treatment, recently, studies provided evidence on the important role of HSP70 in recovering DAergic neurons or degrading misfolded proteins in PD models [21, 22].

In order to study the involvement of HSPs on Mn-induced neurotoxicity, we used the Caenorbabditis elegans model. This nematode incorporates 302 neurons, 8 of them being dopaminergic. Its transparent body and ease of genetic manipulability turns it into very interesting model to study neurodegeneration and to unravel molecular targets of toxicants. Our group has already demonstrated that Mn causes specific degeneration in the dopaminergic neurons through molecular mechanisms that replicate the effects observed in mammalian models. Furthermore, C. elegans possess 21 isoforms of HSP, which have been shown to function as chaperones and to have antioxidant role in worms as well as in mammals [23, 24].

Hence, we hypothesized that the deletion of hsp genes would increase Mn- induced oxidative stress and DAergic neurotoxicity. Furthermore, we investigated whether this deletion would affect the expression of some PD-related genes, based on the hypothesis that HSPs might be carriers of DJ1, PDR1 and PINK1 to the mitochondria following Mn stress.

Methods

Chemicals

Oxyblot protein oxidation analyses kits were purchased from Millipore (S7150- Billerica, CA). All the other reagents were obtained from Sigma (St Louis, MO).

C. elegans strains and handling of the worms

C. elegans Bristol N2 (wild type) PS3551 (hsf-1(sy441)I), BR2823 (chn-1(by155)I), RB1104 (hsp-3(ok1083)X), LL 1009 (daf-21(nr2081)/nT1 [unc-?(n754) let-?] IV;V), RB825 (hsp-43(ok647)X), VC281 (hsp-12.6(gk156) IV), VC1099 (hsp-4(gk514)II), CNH-1 gf (gain-of-function) were handled and maintained at 20 °C on E. coli OP50/ NGM (nematode growth media) plates as previously described [25]. These strains were provided by the Caenorhabditis Genetics Center (CGC, Minnesota). hsp-70 (tm2318) I, was a gift from the Mitani lab. Synchronous L1 population were obtained by isolating embryos from gravid hermaphrodites using bleaching solution (1 % NaOCl; 0.25 M NaOH), followed by floatation on a sucrose gradient to segregate eggs from dissolved worms and bacterial debris, accordingly to standard procedures previously described [26].

Dose–response curves after Mn exposure

Five thousand synchronized L1 stage worms per dose were treated for 30 min with each of the compounds, followed by three washes with 85 mM NaCl soultion. Worms were placed on OP50 seeded NGM plates and the dose–response curves were plotted from scoring the number of surviving worms on each dish at 24 h post-exposure. Dose response curves and LD50 values were obtained from those curves. Worms were then exposed for 30 min to 35 mM manganese chloride (MnCl2), which corresponds to the LD25 for MnCl2 as previously reported by Benedetto et al. [27]. For all dose–response curves, scores were normalized to percent control (0 mM MnCl2 exposure).

Protein oxidation determination

Twenty thousand worms were exposed to MnCl2 (3, 10, 20, 35, 50 mM), as previously described. Next, worms were homogenized by sonication in a lysis buffer containing 85 mM sodium chloride, 1 % Triton X-100, 10 mM Tris Buffer (pH 6.8), 1× protease inhibitor and 50 mM dithiotreitol (DTT). After centrifugation (11,000xg for 1 min), the supernatant was isolated and protein concentration was determined with the Bradford method [28]. One hundred micrograms of proteins were derivatized with 2,4,dinitrophenylhydrazine (DNPH), which is converted to 2,4, dinitrophenylhydrazone (DNP) in the presence of carbonyls from oxidized proteins. The carbonyls were detected by western blotting with a commercial antibody directed against derivatized carbonyl groups (anti 2,4- DNP, rabbit IgG), and visualized by horseradish peroxidase conjugated secondary antibody according to the kit instructions (Oxyblot analysis kit, Millipore). Purified β-actin (A1978, Sigma, St. Louis, MO) was used as a control and the bands’ density was acquired with Image J (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997–2011.).

Confocal microscopy

For each slide, at least 20 worms were mounted on 4 % agarose pads in M9 and anaesthetized with 0.2 % tricaine/0.02 % tetramisole in M9. Fluorescence observations were performed with an epifluorescence microscope (Nikon Eclipse 80i, Nikon Corporation, Tokyo, Japan) equipped with a Lambda LS Xenon lamp (Sutter Instrument Company) and Nikon Plan Fluor 20× dry and Nikon Plan Apo 60 × 1.3 oil objectives. Microscopes were housed in air-conditioned rooms (20–22 °C). Worms were observed 2 h after Mn exposure.

Real time PCR

Total RNA was isolated using the TRIzol reagent (Invitrogen) and the RNeasy mini kit (Qiagen). First-strand cDNA synthesis was performed with an equal amount of RNA using the Thermoscript real-time PCR kit (Invitrogen) as per the kit's instructions. The genes observed through real-time PCR were as follows: hsp-70, pdr-1, dj-1, parkin (Table 1). The housekeeping gene act-1 was used as an internal control. Primer sequences are available on request. mRNA expression was quantified using the SYBR green detection method on an Bio-Rad real-time PCR system. Relative quantification for the expressed genes was done using the comparative C T (ΔΔC T) method.

Table 1.

List of primers used in this study

Gene Seq 5' to 3'- Forward Seq 5' to 3' -Reverse
hsp-70 CCATGACTTAGTGGGACAAC AAGACTACGCCTTCCTACGT
pink1 TCATGTCTCGCTGAGCAACT GGCTCCATATCCGAATGCT
djr1.1 CTCGTGGTGAAATTCGTGTG GCGGACAAGTAGGCTTTCAG
pdr1 CAAATGTCTAGCCTGCAACG CGAACTATTGCACCCTGGAT
act1 ATCACCGCTCTTGCCCCATC GGCCGGACTCGTCGAATTCTTG

Statistics

Dose–response lethality curves, longevity curves and ROS content and oxyblot analysis were generated with GraphPad Prism (GraphPad Software Inc.). We used a sigmoidal dose–response model with a top constraint at 100 % to draw the curves and determine the LD50 or the average lifespan values reported in the graphs. Statistical analysis of significance was carried out by one-way or two way ANOVA, depending on the case, followed by post-hoc Bonferroni test if the overall p value was less than 0.05. In all figures, error bars represent the standard errors of the mean (SEM).

Results

The loss-of-function of some HSP genes led to increased sensitivity towards Mn (Table 2). While Mn-induced lethality of the transgenic strains lacking hsp-4, hsp-43, hsf-1 and hsp-12.6 were indistinguishable from wild type worms, hsp-70 mutants exhibited hypersensitivity to Mn-induced lethality (LD50 = 73.08 mM) compared to N2 worms (LD50 = 46.13 mM) (Fig. 1a, p < 0.05). Conversely, other genetic deletions caused decreased Mn-induced lethality in comparison to wild type worms such as hsp-3 (which has 99.1 % homology to HSPA5 from the HSP70 family, Fig. 1b) and chn-1 (homologous to CHIP (C-terminus of Hsc70 interacting protein), Fig. 1c). In order to identify the possible underlying mechanisms, we determined the extent of Mn-induced oxidative damage through an indirect method: the measurement of protein carbonyl content. We observed that all strains showed increased carbonylation at lower Mn concentrations in comparison to N2, corroborating the findings of the survival assay (Fig. 2a, b and d). Notably, the lack of HSF-1 neither change Mn toxicity (Fig. 1d), nor increased carbonyl content (Fig. 2c).

Table 2.

Lethal concentration 50 % for each HSP strain exposed to Mn

Strain N2 hsp-70 chn-1 CHN-1 gf hsp-3 daf-21 hsp-4 h sp-12.6 hsp-43 h sf-1
LD50 (mM) 73.08 ± 2.2 46.13 ± 2.17a 30.10 ± 2.74a 96.92 ± 2.78a 34.18 ± 2.83a 96.11 ± 3.28a 67.04 ± 3.027 90.40 ± 2.54a 72.34 ± 3.55 56.15 ± 1.68a

Data are expressed as mean ± SEM (n = 3). aIndicates statistical difference from N2 worms

Fig. 1.

Fig. 1

Dose–response curves for acute treatment with Mn (30 min) in different hsp mutants, all compared to N2 (wildtype). a N2, hsp-70, hsp-4, hsp-12.6; (b) N2, hsp-3, daf-21; (c) N2, chn-1 and CHN-1 gf; (d) N2, chn-1, hsp-43 and hsf-1. Data are expressed as mean (percentage of control) ± SEM

Fig. 2.

Fig. 2

Mn-induced protein carbonylation in different hsp mutants. a N2; (b) hsp-70; (c) hsf-1; (d) chn-1. Data are expressed as mean (percentage of control) ± SEM. * indicates statistical difference from control group (p < 0.05)

Considering the higher sensitivity of hsp-70 worms following Mn exposure, we generated transgenic worms lacking hsp-70 and expressing pdat-1::GFP. The expression of the green fluorescent protein (GFP) under the control of a promoter for the dopamine (DA) re-uptake transporter 1 allows the visualization of the architecture of the DAergic neurons. Following Mn exposure the pdat-1::GFP fluorescence and morphology of the mutants lacking hsp-70 was compared to wild type (N2) (Fig. 3). The neurodegeneration induced by Mn in wild type worms occurred as previously reported by Benedetto et al. [27]. Remarkably, the knockout of the hsp-70 gene caused significant degeneration in DAergic neurons following 10 mM (ballooning of the neurons soma) Mn exposure (Fig. 3). Corroborating the importance of hsp-70 gene as a Mn-responsive gene, we further observed that the mRNA expression of this gene increases significantly with increased Mn concentrations (Fig. 4).

Fig. 3.

Fig. 3

Representative images from DAergic neurons in hsp-70 (tm2318);pdat-1::GFP worms exposed to Mn at different concentrations compared to wildtype worms

Fig. 4.

Fig. 4

Mn exposure increases mRNA expression of hsp-70 in C. elegans. Data are expressed as mean values + SEM of at least three independent experiments. * indicates statistical difference from control group (p < 0.05)

In order to evaluate the effect of Mn exposure on the expression of PD-related genes in wild type and hsp-70 mutants, we determined the mRNA levels of pdr-1, djr-1.1 and pink-1. Increased Mn concentrations applied to WT worms led to a dose-dependent increase in the expression of pdr-1, djr-1.1 and pink-1 (Fig. 5). Unexpectedly, mRNA levels of pdr-1 and djr-1.1 remained increased in hsp-70 mutants following increased Mn concentrations (Fig. 5a and c). However, two-way ANOVA revealed a strong interaction between Mn concentration and genotype, supporting the notion that the dynamics of the transcriptional response to Mn exposure differs between wild type and hsp-70 worms. In particular, hsp-70 mutation abrogates the dose-dependent increase in pink-1 expression typically observed upon graded Mn exposure (Fig. 5b). Interestingly, this suggest that HSP-70 is specifically required for the Mn-induced increase in PINK-1 expression.

Fig. 5.

Fig. 5

mRNA expression of PD-related genes in wild type (N2) and hsp-70 mutants following Mn exposure. a pdr-1; (b) pink-1; (c) djr-1.1. * indicates statistical difference from control group (p < 0.05). # indicates statistical difference from N2 group at the same Mn concentration (p < 0.05)

Discussion

The cellular and molecular evolutions of most organisms rely on HSPs, which promote cell adaptation and survival under conditions of stress [2]. In the present study, we used an environmental and occupational metal toxicant and observed that the absence of hsp-70 gene leads to increased sensitivity to Mn-induced neurotoxicity, which was associated with increased oxidative stress and specific alterations in mRNA levels of pink-1 in C. elegans. Other hsp genes may also be related to Mn-induced neurotoxicity. However, worms lacking hsp-4, hsp-43, hsf-1 and hsp-12.6 were less sensitive towards Mn-induced toxicity as compared to nematodes lacking hsp-70.

hsp-70 encodes a member of the HSP70 family genes in C. elegans with 13-members identified in the organism so far [29]. It comprises approximately 100 % homology to the human HSPA8, an isoform of heat shock cognate of 71 kDa (hsc70) [24]. The hsp-70 gene is under normal conditions expressed constitutively throughout nematodes development. With increasing temperatures hsp-70 mRNA synthesis is enhanced 2–6-fold [24, 30]. In mammals a large variety of cellular functions have been attributed to HSPA8 most of them through its cooperation with co-chaperones. Thereby HSPA8 participates in the chaperone-mediated autophagy, an important process that recognizes malformed proteins in order to degrade them through the ubiquitin/proteassome system [31].

Mn exposure modulates the expression of HSPs in different species [79, 3235]. Most of the evidence points out to an increase of HSP-70 levels following acute Mn exposure, thus reflecting an attempt to protect from the toxic and pro-oxidative effects triggered by Mn [79, 32]. This is corroborated herein, as the absence of hsp-70 led to higher vulnerability to Mn exposure, which was associated with oxidative stress, depicted by increased protein carbonylation. Observing the fluorescently labeled DAergic neurons in the outcrossed hsp-70 (tm2318);pdat-1::GFP worms, we verified the importance of HSP-70 in protecting DAergic neurons from Mn exposure. This is in agreement with recent studies providing evidence on the important role of HSP70 in rescuing DAergic neurons in various models of PD. For instance, HSP70 suppressed α-synuclein toxicity in a transgenic Drosophila model of familial PD [36]. Dong et al. demonstrated that a Hsp70 gene transfer into DAergic neurons protect from MPTP- induced DA loss and the associated decline in DA levels in striatal mouse neurons [37]. In addition, in vitro and in vivo studies demonstrated that Hsp70 might play a role in neuroprotection against MPTP and rotenone (two models of PD) by inhibiting pro-apoptotic factors as well as by activating survival pathways [3840]. PD-related genes DJ1, parkin and Pink1 are participating in the oxidative stress response and protect the cell against mitochondrial oxidative stressors such as Mn. Regarding the gene DJ1, the nematode expresses two orthologues named djr-1.1 and djr-1.2. Recently, our group demonstrated that pdr-1 and djr-1.1 loss in C. elegans increased their susceptibility to Mn in comparison to wild type worms and that the observed enhanced oxidative stress is related to increased Mn accumulation [19]. In addition, the higher Mn accumulation caused by loss of pdr-1/parkin gene was due to reduction of ferroportin (a Mn cell exporter) expression in worms [20]. Furthermore, Chen et al. demonstrated that worms overexpressing DJR-1.2 are not subject to lifespan reduction caused by Mn exposure, in contrary to djr-1.2 mutants [41]. Interestingly, under stress conditions, DJ-1 is translocated to mitochondria by HSP-70 [42]. It was further shown that a bcl-2 associated Athanogene 5 (BAG5) can enhance DAergic neuronal death by inhibiting both Parkin and the chaperone activity of Hsp70 [43]. Hence, we hypothesized that the absence of hsp-70 would alter the expression of these genes. First, we verified for the first time that Mn increases mRNA levels of all these genes in wild type worms, which is in agreement with the hypothesis that these proteins are required to protect cells against Mn-induced toxicity [19, 20, 41]. While in the hsp-70 mutants mRNA levels of pdr-1 and djr-1.1 increased dose-dependently in a manner indistinguishable from N2 worms, the pink1 expression failed to increase and was not significantly different compared to non-treated mutants. Pink1 (PTEN-induced kinase 1) is a mitochondrial kinase consisting of 581 aminoacids that encode a mitochondrial targeting sequence, a transmembrane domain and a Ser/Thr kinase domain. PINK1 is believed to confer neuroprotection by policing mitochondrial integrity [44] and a growing amount of data links dysfunction of mitochondrial dynamics with PD [45, 46]. Hence, loss of pink-1 is associated with mitochondrial impairments, oxidative stress, and DAergic neuronal loss, as DA neurons may be particularly vulnerable to mitochondrial dysfunction [47, 48]. A proteomic study of Triplett et al. with PINK1 knockout mice showed that these animals have reduced HSP-70 levels in their brain [49]. Herein, we observed that hsp-70 mutants blocked pink-1 - mRNA expression following Mn exposure compared to the respective dose-dependent increase observed in WT worms, which reinforces the relationship between these two genes. In accordance, as we observed a significant impairment of DAergic neurons in the worms lacking hsp-70, we can infer that the mitochondrial dysfunction provided by Mn, plus absence of an important chaperone and the failure of the cells to increase PINK1 expression would culminate with the higher damage to these neurons. Constructing a worm that overexpress PINK1 in a hsp-70 KO background would give us a more reliable view on the role of pink-1 and hsp-70 in Mn-induced DAergic degeneration.

Working with gene profiling in C. elegans, which can be visualized in vivo using transgenic GFP-tagged strains, Anbalagan et al. demonstrated that Cd2+, Cu2+, Hg2+ and Zn2+ exposure induce the heat shock genes quite strongly (hsp-16.1, hsp-16.2, hsp-6, hsp-60 were at least 2-fold increased) [50]. Notably, we observed that Mn exposure increased mRNA levels of hsp-70 (Fig. 4) and that HSP-4::GFP and HSP-6::GFP levels were significantly increased following Mn exposure, reinforcing the fact that this metal can indeed modulate these chaperones (data not shown).

We also observed that the absence of other chaperones as hsp-3 and chn-1 led to increased Mn-induced toxicity including compared to wild type woms. hsp-3, is expressed constitutively and is non-heat inducible; its mRNA is most abundant at the L1 larval stage [24]. Since mRNA of hsp-3 is found at maximum levels in the L1 stage [30], it might be very important to protect the larvae against toxicants. chn-1 is the homologue of the human CHIP, which is very important for removing defective and misfolded proteins. Springer et al. demonstrated that CHN-1 forms a protein complex with PDR1/Parkin, in order to ubiquitylate proteins [51]. Hence, loss of chn-1 already causes issues in worms development [52]. Consequently, we decided not to pursue further investigations into DAergic neuronal vulnerability in these two mutants. Interestingly, loss of hsf-1 (heat shock factor) did not cause significant vulnerability to Mn exposure (Fig. 1d). This is not surprising because it has been demonstrated that HSF-1 is not the only transcription factor that activates HSPs expression. In fact, it has been demonstrated that DAF-16 and SKN-1 can also modulate the transcription of some HSPs [53, 54].

Conclusions

Taken together, our data suggest that Mn exposure modulates HSP expression, particularly HSP-70, in C. elegans. Furthermore, loss of hsp-70 prones worms to increased protein oxidation and increased DAergic neurodegeneration following Mn exposure. This might be associated with a blockage of the pink1 expression, which can hypothetically exacerbate mitochondrial dysfunction caused by Mn exposure since pink-1 expression is normally increased in wild type worms following Mn exposure. Consequently the current study provides evidence for the neuroprotective role of hsp-70 in Mn-induced neurotoxicity and a possible protective role of overexpressing hsp-70 needs to be clarified in future studies.

Acknowledgements

Authors acknowledge Dr. Mitani for providing hsp-70 mutants and CGC for providing all other strains.

Funding

This work was funded by the DFG (BO 4103/2-1), CNPq/Universal Grant (453963/2014-5). MA was supported in part by grants from the National Institute of Environmental Health Sciences (NIEHS) R01 ES10563 and R01 ES07331. DSA receives CNPq Fellowship (PQ2).

Availability of data and materials

The datasets supporting the conclusions of this article are included within the article or can be available under request to the authors.

Authors’ contributions

DSA worked on the conception and design of the study, data acquisition, analysis and interpretation and drafting the manuscript; AB, CA worked on the conception of the study, interpretation and drafting the manuscript; JB worked on analysis and interpretation of the data and drafting the manuscript; MA worked on the conception of the study and drafting the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Abbreviations

CHIP

C-terminus of Hsc70 interacting protein

DA

dopamine

DAT

dopamine transporter

DNPH

dinitrophenylhydrazine

DTT

dithiothreitol

GFP

green fluorescent protein

HSF

heat shock factor

HSP

heat shock protein

IgG

Immunoglobulin G

Mn

manganese

MPTP

1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine

PD

Parkinson’s Disease

Pink1

PTEN-induced kinase 1

WT

wildtype

Contributor Information

Daiana Silva Avila, Email: daianaavila@unipampa.edu.br.

Alexandre Benedetto, Email: a.benedetto@lancaster.ac.uk.

Catherine Au, Email: catherine.au@ucl.ac.uk.

Julia Bornhorst, Email: jbornhor@uni-potsdam.de.

Michael Aschner, Email: michael.Aschner@einstein.yu.edu.

References

  • 1.Frydman J. Folding of newly translated proteins in vivo: the role of molecular chaperones. Annu Rev Biochem. 2001;70:603–47. doi: 10.1146/annurev.biochem.70.1.603. [DOI] [PubMed] [Google Scholar]
  • 2.Soti C, et al. Heat shock proteins as emerging therapeutic targets. Br J Pharmacol. 2005;146(6):769–80. doi: 10.1038/sj.bjp.0706396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Powers MV, et al. Targeting HSP70: the second potentially druggable heat shock protein and molecular chaperone? Cell Cycle. 2010;9(8):1542–50. doi: 10.4161/cc.9.8.11204. [DOI] [PubMed] [Google Scholar]
  • 4.Dudzik CG, Walter ED, Millhauser GL. Coordination features and affinity of the Cu(2) + site in the alpha-synuclein protein of Parkinson's disease. Biochemistry. 2011;50(11):1771–7. doi: 10.1021/bi101912q. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Santner A, Uversky VN. Metalloproteomics and metal toxicology of alpha-synuclein. Metallomics. 2010;2(6):378–92. doi: 10.1039/b926659c. [DOI] [PubMed] [Google Scholar]
  • 6.Hong L, Simon JD. Insights into the thermodynamics of copper association with amyloid-beta, alpha-synuclein and prion proteins. Metallomics. 2011;3(3):262–6. doi: 10.1039/C0MT00052C. [DOI] [PubMed] [Google Scholar]
  • 7.Oweson C, et al. Manganese effects on haematopoietic cells and circulating coelomocytes of Asterias rubens (Linnaeus) Aquat Toxicol. 2008;89(2):75–81. doi: 10.1016/j.aquatox.2008.05.016. [DOI] [PubMed] [Google Scholar]
  • 8.Pinsino A, et al. Sea urchin embryos as an in vivo model for the assessment of manganese toxicity: developmental and stress response effects. Ecotoxicology. 2010;19(3):555–62. doi: 10.1007/s10646-009-0432-0. [DOI] [PubMed] [Google Scholar]
  • 9.Zhu Y, et al. The effect of manganese-induced cytotoxicity on mRNA expressions of HSP27, HSP40, HSP60, HSP70 and HSP90 in chicken spleen lymphocytes in vitro. Biol Trace Elem Res. 2013;156(1–3):144–52. doi: 10.1007/s12011-013-9817-2. [DOI] [PubMed] [Google Scholar]
  • 10.Aschner JL, Aschner M. Nutritional aspects of manganese homeostasis. Mol Aspects Med. 2005;26(4–5):353–62. doi: 10.1016/j.mam.2005.07.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Aschner M. The transport of manganese across the blood–brain barrier. Neurotoxicology. 2006;27(3):311–4. doi: 10.1016/j.neuro.2005.09.002. [DOI] [PubMed] [Google Scholar]
  • 12.Aschner M. Manganese in the shower: mere speculation over an invalidated public health danger. Med Hypotheses. 2006;66(1):200–1. doi: 10.1016/j.mehy.2005.08.002. [DOI] [PubMed] [Google Scholar]
  • 13.Aschner M, Dorman DC. Manganese: pharmacokinetics and molecular mechanisms of brain uptake. Toxicol Rev. 2006;25(3):147–54. doi: 10.2165/00139709-200625030-00002. [DOI] [PubMed] [Google Scholar]
  • 14.Avila DS, Puntel RL, Aschner M. Manganese in health and disease. Met Ions Life Sci. 2013;13:199–227. doi: 10.1007/978-94-007-7500-8_7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Bowman AB, et al. Role of manganese in neurodegenerative diseases. J Trace Elem Med Biol. 2011;25(4):191–203. doi: 10.1016/j.jtemb.2011.08.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Farina M, et al. Metals, oxidative stress and neurodegeneration: a focus on iron, manganese and mercury. Neurochem Int. 2013;62(5):575–94. doi: 10.1016/j.neuint.2012.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kwakye GF, et al. Manganese-Induced Parkinsonism and Parkinson's Disease: Shared and Distinguishable Features. Int J Environ Res Public Health. 2015;12(7):7519–40. doi: 10.3390/ijerph120707519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Roth JA. Correlation between the biochemical pathways altered by mutated parkinson-related genes and chronic exposure to manganese. Neurotoxicology. 2014;44:314–25. doi: 10.1016/j.neuro.2014.08.006. [DOI] [PubMed] [Google Scholar]
  • 19.Bornhorst J, et al. The effects of pdr1, djr1.1 and pink1 loss in manganese-induced toxicity and the role of alpha-synuclein in C. elegans. Metallomics. 2014;6(3):476–90. doi: 10.1039/C3MT00325F. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Chakraborty S, et al. Loss of pdr-1/parkin influences Mn homeostasis through altered ferroportin expression in C. elegans. Metallomics. 2015;7(5):847–56. doi: 10.1039/C5MT00052A. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Gao X, et al. Human Hsp70 Disaggregase Reverses Parkinson's-Linked alpha-Synuclein Amyloid Fibrils. Mol Cell. 2015;59(5):781–93. doi: 10.1016/j.molcel.2015.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Pastukhov YF, et al. Exogenous protein HSP70 blocks neurodegeneration in the rat model of the clinical stage of Parkinson's disease. Dokl Biol Sci. 2014;457(1):225–7. doi: 10.1134/S0012496614040139. [DOI] [PubMed] [Google Scholar]
  • 23.GuhaThakurta D, et al. Identification of a novel cis-regulatory element involved in the heat shock response in Caenorhabditis elegans using microarray gene expression and computational methods. Genome Res. 2002;12(5):701–12. doi: 10.1101/gr.228902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Snutch TP, Heschl MF, Baillie DL. The Caenorhabditis elegans hsp70 gene family: a molecular genetic characterization. Gene. 1988;64(2):241–55. doi: 10.1016/0378-1119(88)90339-3. [DOI] [PubMed] [Google Scholar]
  • 25.Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71–94. doi: 10.1093/genetics/77.1.71. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Stiernagle T. Maintenance of C. elegans. In: Hope IA, editor. C. elegans: A Practical Approach. New York: Oxford University Press; 1999. [Google Scholar]
  • 27.Benedetto A, Au C, Avila DS, Milatovic D, Aschner M. Extracellular dopamine potentiates mn-induced oxidative stress, lifespan reduction, and dopaminergic neurodegeneration in a BLI-3-dependent manner in Caenorhabditis elegans. PLoS Genet. 2010;6(8):1-18. doi:10.1371/journal.pgen.1001084. [DOI] [PMC free article] [PubMed]
  • 28.Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–54. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
  • 29.Odunuga OO, et al. Caenorhabditis elegans Hsp70-1 expresses highly in bacteria, is sufficiently soluble, and has a catalytic constant similar to Hsc70 and BiP. Protein Expr Purif. 2012;82(1):132–7. doi: 10.1016/j.pep.2011.12.002. [DOI] [PubMed] [Google Scholar]
  • 30.Heschl MF, Baillie DL. Characterization of the hsp70 multigene family of Caenorhabditis elegans. DNA. 1989;8(4):233–43. doi: 10.1089/dna.1.1989.8.233. [DOI] [PubMed] [Google Scholar]
  • 31.Stricher F, et al. HSPA8/HSC70 chaperone protein: structure, function, and chemical targeting. Autophagy. 2013;9(12):1937–54. doi: 10.4161/auto.26448. [DOI] [PubMed] [Google Scholar]
  • 32.Zhang BY, et al. Effect of manganese on heat stress protein synthesis of new-born rats. World J Gastroenterol. 2002;8(1):114–8. doi: 10.3748/wjg.v8.i1.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Xiao J, et al. Prolonged manganese exposure induces severe deficits in lifespan, development and reproduction possibly by altering oxidative stress response in Caenorhabditis elegans. J Environ Sci (China) 2009;21(6):842–8. doi: 10.1016/S1001-0742(08)62350-5. [DOI] [PubMed] [Google Scholar]
  • 34.Zhang S, Fu J, Zhou Z. Changes in the brain mitochondrial proteome of male Sprague–Dawley rats treated with manganese chloride. Toxicol Appl Pharmacol. 2005;202(1):13–7. doi: 10.1016/j.taap.2004.06.001. [DOI] [PubMed] [Google Scholar]
  • 35.Nicosia A, et al. Transcriptional and biochemical effects of cadmium and manganese on the defense system of Octopus vulgaris paralarvae. Biomed Res Int. 2015;2015:437328. doi: 10.1155/2015/437328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Auluck PK, et al. Chaperone suppression of alpha-synuclein toxicity in a Drosophila model for Parkinson's disease. Science. 2002;295(5556):865–8. doi: 10.1126/science.1067389. [DOI] [PubMed] [Google Scholar]
  • 37.Dong Z, et al. Hsp70 gene transfer by adeno-associated virus inhibits MPTP-induced nigrostriatal degeneration in the mouse model of Parkinson disease. Mol Ther. 2005;11(1):80–8. doi: 10.1016/j.ymthe.2004.09.007. [DOI] [PubMed] [Google Scholar]
  • 38.Luo GR, Chen S, Le WD. Are heat shock proteins therapeutic target for Parkinson's disease? Int J Biol Sci. 2007;3(1):20–6. doi: 10.7150/ijbs.3.20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Pan T, et al. Valproic acid-mediated Hsp70 induction and anti-apoptotic neuroprotection in SH-SY5Y cells. FEBS Lett. 2005;579(30):6716–20. doi: 10.1016/j.febslet.2005.10.067. [DOI] [PubMed] [Google Scholar]
  • 40.Shen HY, et al. Geldanamycin induces heat shock protein 70 and protects against MPTP-induced dopaminergic neurotoxicity in mice. J Biol Chem. 2005;280(48):39962–9. doi: 10.1074/jbc.M505524200. [DOI] [PubMed] [Google Scholar]
  • 41.Chen P, et al. Age- and manganese-dependent modulation of dopaminergic phenotypes in a C. elegans DJ-1 genetic model of Parkinson's disease. Metallomics. 2015;7(2):289–98. doi: 10.1039/C4MT00292J. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Li HM, et al. Association of DJ-1 with chaperones and enhanced association and colocalization with mitochondrial Hsp70 by oxidative stress. Free Radic Res. 2005;39(10):1091–9. doi: 10.1080/10715760500260348. [DOI] [PubMed] [Google Scholar]
  • 43.Kalia SK, et al. BAG5 inhibits parkin and enhances dopaminergic neuron degeneration. Neuron. 2004;44(6):931–45. doi: 10.1016/j.neuron.2004.11.026. [DOI] [PubMed] [Google Scholar]
  • 44.Narendra DP, et al. PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol. 2010;8(1) doi: 10.1371/journal.pbio.1000298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Heeman B, et al. Depletion of PINK1 affects mitochondrial metabolism, calcium homeostasis and energy maintenance. J Cell Sci. 2011;124(Pt 7):1115–25. doi: 10.1242/jcs.078303. [DOI] [PubMed] [Google Scholar]
  • 46.Oliveras-Salva M, et al. Loss-of-function rodent models for parkin and PINK1. J Parkinsons Dis. 2011;1(3):229–51. doi: 10.3233/JPD-2011-11041. [DOI] [PubMed] [Google Scholar]
  • 47.Surmeier DJ, et al. The role of calcium and mitochondrial oxidant stress in the loss of substantia nigra pars compacta dopaminergic neurons in Parkinson's disease. Neuroscience. 2011;198:221–31. doi: 10.1016/j.neuroscience.2011.08.045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Liang CL, et al. Mitochondria mass is low in mouse substantia nigra dopamine neurons: implications for Parkinson's disease. Exp Neurol. 2007;203(2):370–80. doi: 10.1016/j.expneurol.2006.08.015. [DOI] [PubMed] [Google Scholar]
  • 49.Triplett JC, et al. Quantitative expression proteomics and phosphoproteomics profile of brain from PINK1 knockout mice: insights into mechanisms of familial Parkinson's disease. J Neurochem. 2015;133(5):750–65. doi: 10.1111/jnc.13039. [DOI] [PubMed] [Google Scholar]
  • 50.Anbalagan C, et al. Transgenic nematodes as biosensors for metal stress in soil pore water samples. Ecotoxicology. 2011. [DOI] [PMC free article] [PubMed]
  • 51.Springer W, et al. A Caenorhabditis elegans Parkin mutant with altered solubility couples alpha-synuclein aggregation to proteotoxic stress. Hum Mol Genet. 2005;14(22):3407–23. doi: 10.1093/hmg/ddi371. [DOI] [PubMed] [Google Scholar]
  • 52.Khan LA, Nukina N. Molecular and functional analysis of Caenorhabditis elegans CHIP, a homologue of Mammalian CHIP. FEBS Lett. 2004;565(1–3):11–8. doi: 10.1016/j.febslet.2004.03.084. [DOI] [PubMed] [Google Scholar]
  • 53.Glover-Cutter KM, Lin S, Blackwell TK. Integration of the unfolded protein and oxidative stress responses through SKN-1/Nrf. PLoS Genet. 2013;9(9):e1003701. doi: 10.1371/journal.pgen.1003701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Walker GA, et al. Heat shock protein accumulation is upregulated in a long-lived mutant of Caenorhabditis elegans. J Gerontol A Biol Sci Med Sci. 2001;56(7):B281–7. doi: 10.1093/gerona/56.7.B281. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The datasets supporting the conclusions of this article are included within the article or can be available under request to the authors.


Articles from BMC Pharmacology & Toxicology are provided here courtesy of BMC

RESOURCES